A method for in vivo screening of nucleic acid aptamers and nucleic acid aptamers obtained by screening

Abstract

The present invention provides a method for in vivo screening of nucleic acid aptamers and the nucleic acid aptamers obtained by screening. The screening method comprises: first performing a single round of in vitro screening to pre-enrich the library sequences; then performing in vivo screening to recover the sequences bound to the tumor site; and finally, constructing a library, sequencing, and performing sequence analysis through a molecular ID tagging strategy, and then verifying the selected sequences. The method provided by the present invention can be implemented through a single round of in vivo screening, significantly shortening the screening cycle; the nucleic acid aptamers obtained by the screening method of the present invention have a high screening success rate because they have been tested in the actual in vivo environment. At the same time, the nucleic acid aptamers that specifically recognize the CD318 protein obtained by the screening of the present invention have good targeting and resistance to nuclease degradation in vivo.

Description

Technical Field

[0001] The present invention relates to the field of cancer diagnosis and treatment, and in particular to a single-round in vivo nucleic acid aptamer screening method based on molecular ID recognition and a nucleic acid aptamer obtained by screening that specifically recognizes CD318 molecules. Background Art

[0002] Aptamers are single-stranded oligonucleotide sequences (DNA / RNA) produced by the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) technology. They can fold into different structures and bind specifically to target molecules. They have the advantages of a wide range of target molecules, low immunogenicity, good thermal stability, small molecular weight, easy synthesis, small batch-to-batch variability, and easy modification. They are mostly used in clinical diagnosis and clinical treatment research. Traditional SELEX technology mainly screens recombinant proteins or cell lines. Due to differences in antigen density, interaction and microenvironment, the ability of aptamers screened in vitro to target organs or tissues under physiological conditions is weak. To solve this problem, the researchers used tumor-bearing mice as research subjects and screened out aptamers that can specifically target tumor sites under physiological conditions, confirming the feasibility of screening in living animals. Traditional SELEX technology requires counter-screening to remove nonspecific binding molecules. However, in in vivo screening, non-binding molecules are eliminated through the kidneys. Molecules enriched in other non-target tissues in the body can serve as controls to eliminate nonspecific binding, thereby screening for aptamers that have good targeting properties and are resistant to nuclease degradation under physiological conditions. Furthermore, since the target of in vivo screening is unknown, the interaction between aptamers and tissue proteins can be used to screen for new tissue-specific markers for tumor diagnosis and targeted therapy.

[0003] Existing in vivo aptamer screening strategies are essentially the same as traditional in vitro screening strategies. Modified or unmodified libraries are injected into tumor-bearing mice via the tail vein. After a period of circulation, tumor-bound aptamers are extracted and amplified. After multiple rounds of screening, aptamers are obtained through high-throughput sequencing. The main challenges currently faced by in vivo screening are the difficulty in recovering and amplifying aptamers, and the generation of a large number of short fragments. As the number of screening rounds increases, the efficiency of PCR amplification decreases significantly, often resulting in screening failure. Traditional in vivo screening faces challenges such as low success rates and time-consuming and labor-intensive processes. Therefore, shortening the number of in vivo screening rounds is crucial for successful screening. Summary of the Invention

[0004] One objective of the present invention is to provide a single-round in vivo aptamer screening method based on molecular ID recognition. The screening method comprises: first, a single round of in vitro screening to pre-enrich library sequences, reduce metabolic sequence loss, and increase sequence diversity; then, in vivo screening to recover sequences that bind to tumor sites; and finally, library construction, sequencing, and sequence analysis using a molecular ID labeling strategy to select sequences for verification. This method significantly shortens the aptamer screening cycle and improves the screening success rate.

[0005] In a first aspect, the present invention provides a single-round in vivo nucleic acid aptamer screening method based on molecular ID recognition, the method comprising:

[0006] 1) Incubating the random nucleic acid library with target cells for in vitro screening to obtain the first round of ssDNA library;

[0007] 2) combining the ssDNA library obtained by screening in step 1) with in vivo tumor tissue for in vivo screening to obtain a second round of ssDNA library;

[0008] 3) The second-round ssDNA library obtained by screening in step 2) is incubated with target cells, and the sequences bound to the target cells are subjected to high-throughput sequencing based on molecular ID tags.

[0009] In some embodiments, the in vitro screening in step 1) is specifically:

[0010] i) performing renaturation treatment on the random nucleic acid library;

[0011] ii) preparing target cells;

[0012] iii) incubating the renatured random nucleic acid library in step i) with the target cells in step ii);

[0013] iv) PCR amplification;

[0014] v) Preparation of the first-round ssDNA library.

[0015] Preferably, the random nucleic acid library used in step 1) is:

[0016] AAG GAG CAG CGT GGA GGA TA-NNNNNNNNNN NNNNNNNNNN NNNNNNNNNNNNNNNNNN NNNNN-TTA GGG TGT GTC GTC GTG GT;

[0017] Upstream primer: 5′-fluorescein isothiocyanate-AAG GAG CAG CGT GGA GGA TA TA-3′;

[0018] Downstream primer: 5′-biotin-ACC ACG ACG ACA CAC CCT AA-3′;

[0019] N represents any random base among A, T, C, and G.

[0020] In some embodiments, the in vivo screening in step 2) is specifically:

[0021] i) performing denaturation and annealing treatment on the first-round ssDNA library obtained by screening in step 1);

[0022] ii) injecting the first-round ssDNA library renatured in step i) into tumor tissue in vivo;

[0023] iii) After a period of time, the tumor tissue is removed, denatured, and amplified by PCR;

[0024] iv) Preparation of the second round ssDNA library.

[0025] Preferably, the tumor tissue in step ii) in step 2) is obtained by transplanting the target cells in step 1);

[0026] Preferably, in step ii) of step 2), the ssDNA obtained by screening in step 1) is injected into the tumor tissue by intravenous injection, for example, by tail vein injection;

[0027] Preferably, the tumor tissue is, for example, ovarian tumor tissue, tumor tissue of the OVCAR3 cell line, or tumor tissue of a mouse xenografted with an OVCAR3 cell line;

[0028] In some embodiments, the high-throughput sequencing of the sequences bound to the target cells based on molecular ID tags in step 3) is specifically:

[0029] i) performing denaturation and annealing treatment on the second-round ssDNA library obtained by screening in step 2);

[0030] ii) preparing target cells;

[0031] iii) incubating the second-round ssDNA library renatured in step i) with the target cells in step ii);

[0032] iv) denaturing the incubation product after the incubation, then adding TBLK, UMI, and DNA ligase for incubation, and performing PCR amplification;

[0033] TBLK: aaaAGG CAG ACA AGA CAG GTA CCA CGA CGA CAC ACCaaa;

[0034] UMI: P'-CCTGTCTTGTCTGCCTACCT(N)xACCTCTCAGAATTCGCACCA;

[0035] Upstream primer: 5-AAG GAG CAG CGT GGA GGA TA TA-3'

[0036] Downstream primer: 5-TGG TGC GAA TTC TGA GAG GT-3',

[0037] N represents any random base among A, T, C, and G;

[0038] X is selected from any integer between 7 and 100;

[0039] v) High-throughput assays.

[0040] In some embodiments, the target cells used in steps 1)-3) are the same and are selected from primary cells obtained from tumor tissue, such as primary cells obtained from ovarian tumor tissue; for example, primary cells obtained from tumor tissue of the OVCAR3 cell line, and primary cells obtained from tumor tissue of mice xenografted with the OVCAR3 cell line.

[0041] Another object of the present invention is to provide nucleic acid aptamers that specifically recognize the CD318 protein, obtained by screening using the single-round in vivo screening method based on the molecular ID recognition strategy described in the first aspect. Because the nucleic acid aptamers undergo the actual in vivo environment during the screening process, the selected nucleic acid aptamers that specifically recognize the CD318 protein exhibit good in vivo targeting and resistance to nuclease degradation.

[0042] In a second aspect, the present invention provides a nucleic acid aptamer that specifically recognizes CD318 protein, wherein the nucleic acid aptamer comprises at least one of the sequences shown in SEQ NO. 1-4:

[0043] SEQ NO.1: HIM XQ-Apt3-CD318:

[0044] AAGGAGCAGCGTGGAGGATAACCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTATCGATTAGGGTGTGTCGTCGTGGT;

[0045] SEQ NO.2: HIM XQ-Apt3a-CD318:

[0046] AGGATAACCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTATCGA;

[0047] SEQ NO.3: HIM XQ-Apt3b-CD318:

[0048] ATAACCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTAT;

[0049] SEQ NO.4: HIM XQ-Apt-CD318:

[0050] ATACCCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTAT.

[0051] In some embodiments, the nucleic acid aptamer further comprises at least one of the following:

[0052] (1) a sequence obtained by modifying the nucleic acid aptamer;

[0053] (2) performing coupling modification on the nucleic acid aptamer to obtain a sequence;

[0054] (3) A sequence obtained by deleting and / or adding one, two or more nucleotides to the nucleic acid aptamer and having the same or extremely similar function as the nucleic acid aptamer.

[0055] Specifically, one, two or more nucleotides are deleted and / or added, and the similarity is above 80% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%), and the aptamer has the same or very similar functions as the above-mentioned aptamer.

[0056] Preferably, the modification comprises at least one of the following modification methods:

[0057] (1) Phosphorylation; (2) Methylation; (3) Amination; (4) Sulfhydrylation; (5) Isotopization; (6) Fluorination; (7) Substitution of oxygen with sulfur; (8) Substitution of oxygen with selenium.

[0058] Preferably, the coupling modification comprises at least one of the following modification methods:

[0059] (1) Connecting a fluorescent marker to the aptamer;

[0060] (2) attaching radioactive substances to the aptamer;

[0061] (3) Connecting therapeutic substances (such as anti-tumor drugs) to nucleic acid aptamers;

[0062] (4) attaching biotin to the aptamer;

[0063] (5) Connecting a biological enzyme to the nucleic acid aptamer;

[0064] (6) Connecting nanomaterials to nucleic acid aptamers;

[0065] (7) Connecting a small peptide to the nucleic acid aptamer;

[0066] (8) Connecting siRNA to the aptamer;

[0067] (9) Connecting micronized materials to the nucleic acid aptamer;

[0068] (10) Connecting cells and / or vesicles to the nucleic acid aptamer.

[0069] In a third aspect, the present invention further provides the nucleic acid aptamer derivative that specifically recognizes the CD318 protein according to the second aspect, wherein the nucleic acid aptamer derivative comprises at least one of the following:

[0070] (1) a phosphorothioate backbone sequence derived from the aforementioned aptamer backbone;

[0071] (2) A peptide nucleic acid sequence modified from the above-mentioned nucleic acid aptamer.

[0072] In a fourth aspect, the present invention further provides a use of the nucleic acid aptamer according to the second aspect or the nucleic acid aptamer derivative according to the third aspect, wherein the use comprises at least one of the following:

[0073] (1) Use in the preparation of a reagent that specifically recognizes CD318 protein;

[0074] (2) Use in the preparation of reagents for qualitative or quantitative detection of CD318 protein;

[0075] (3) Use in the preparation of CD318 protein antagonists;

[0076] (4) Use in the preparation of CD318 protein imaging agents;

[0077] (5) Use as a drug carrier (e.g., a tumor-targeted drug carrier);

[0078] (6) Application in the preparation of molecular probes and cell maps.

[0079] In a fifth aspect, the present invention further provides a drug comprising the nucleic acid aptamer described in the second aspect or the nucleic acid aptamer derivative described in the third aspect.

[0080] In a sixth aspect, the present invention further provides a use of the drug according to the fifth aspect, wherein the use is selected from at least one of the following:

[0081] (1) Use in the preparation of drugs for inhibiting or reversing drug resistance of tumors (such as ovarian cancer, gastric cancer, colorectal cancer, etc.);

[0082] (2) Use in the preparation of drugs for treating, assisting in the treatment or preventing tumors / cancers (such as ovarian cancer, gastric cancer, colorectal cancer, etc.).

[0083] In a seventh aspect, the present invention further provides a reagent comprising the nucleic acid aptamer according to the second aspect or the nucleic acid aptamer derivative according to the third aspect; the reagent is selected from at least one of the following:

[0084] (1) Reagents that target and recognize CD318 protein;

[0085] (2) Reagents for qualitative or quantitative detection of CD318 protein;

[0086] (3) inhibitors that inhibit or reverse drug resistance in tumors / cancers (e.g., ovarian cancer, gastric cancer, colorectal cancer, etc.);

[0087] (4) imaging agents that bind to CD318 protein;

[0088] (5) Molecular probes and cell mapping reagents.

[0089] Beneficial effects

[0090] The present invention provides a single-round in vivo aptamer screening method based on molecular ID recognition. This method significantly shortens the aptamer screening cycle and improves the screening success rate. While traditional in vivo screening often requires 10-20 rounds of screening, the method provided by the present invention can be achieved with a single round of in vivo screening. Furthermore, compared to traditional in vitro screening, the aptamers obtained through the screening method of the present invention have been tested in the actual in vivo environment, and therefore can screen for aptamers that are well-targeted in vivo, resistant to nuclease degradation, and otherwise suitable for in vivo applications.

[0091] The nucleic acid aptamer specifically recognizing CD318 protein obtained by the present invention through single-round in vivo screening based on the molecular ID recognition strategy is stable, easy to synthesize, and has excellent performance, and can be used for the application and research of CD318 protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0092] Figure 1 A) In vivo screening flow chart; B) Distribution of nucleic acid aptamer candidate copy numbers.

[0093] Figure 2 .Binding of nucleic acid aptamers to OVCAR3 cell lines before and after truncation optimization.

[0094] Figure 3 .HIM XQ-Apt-CD318 competition experiment.

[0095] Figure 4Binding of HIM XQ-Apt-CD318 to single-cell suspensions prepared from tumor tissue.

[0096] Figure 5 .Equilibrium dissociation constant of HIM XQ-Apt-CD318.

[0097] Figure 6 A) Stability of HIM XQ-Apt-CD318 in 10% serum; B) Stability of HIM XQ-Apt-CD318 in 100% serum.

[0098] Figure 7 .HIM XQ-Apt-CD318 target protein knockdown verification.

[0099] Figure 8 .A) Binding of HIM XQ-Apt-CD318 to CD318 protein; B) Equilibrium dissociation constant of HIM XQ-Apt-CD318 to CD318 protein.

[0100] Figure 9 .Heat map of HIM XQ-Apt-CD318 binding to different cells.

[0101] Figure 10 Confocal images of HIM XQ-Apt-CD318 binding to HCT-8 cells at different temperatures.

[0102] Figure 11 A) In vivo imaging of OVCAR3 xenograft mice intravenously injected with the Cy5.5-labeled aptamer HIM XQ-Apt-CD318; B) Fluorescent images of different organs after dissection of mice intravenously injected with the Cy5.5-labeled aptamer HIM XQ-Apt-CD318.

[0103] Figure 12 .Binding of HIM XQ-Apt-CD318-GEM to HCT-8 cells at different temperatures.

[0104] Figure 13 .CCK-8 was used to detect the cytotoxicity of HIM XQ-Apt-CD318-GEM and Random sequence-GEM. DETAILED DESCRIPTION

[0105] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples were purchased from conventional biochemical reagent stores unless otherwise specified.

[0106] The present invention utilizes in vivo screening technology to screen randomly synthesized ssDNA sequences, using OVCAR3 human ovarian cancer cell line xenografted mice as experimental subjects, aiming to screen nucleic acid aptamers that can specifically recognize ovarian cancer under physiological conditions.

[0107] Example 1: In vivo screening of nucleic acid aptamers

[0108] 1. Cell Culture

[0109] (1) Cell line culture

[0110] The specific cell sources and the required basic culture medium are shown in Table 1. All culture media were supplemented with 10% fetal bovine serum (FBS) and 100 U / mL penicillin and streptomycin. The cells were cultured in a 37°C incubator with 5% CO2. Cells were passaged using 0.25% Trypsin-EDTA as the digestion medium, and cryopreserved in a commercial serum-free freezing medium.

[0111] Table 1 Cell culture

[0112]

[0113] (2) Primary cell culture

[0114] The primary cells used in this experiment were derived from tumor tissue of mice xenografted with the OVCAR3 cell line. The culture medium used was DMEM / F12 (1:1) supplemented with 10% FBS, 100 U / mL penicillin and streptomycin, and 1% non-essential amino acids. The cells were cultured in a 37°C incubator with 5% CO2. The digestion solution used for cell passage was 0.25% Trypsin-EDTA.

[0115] 2. Construction and Rearing of Tumor-bearing Mice

[0116] The mice required for the experiment were 4-8 weeks old nude mice, purchased from the Laboratory Animal Center of the Institute of Basic Medical Sciences and Oncology, Chinese Academy of Sciences. The experiments were conducted in accordance with the standard specifications approved by the Institute of Basic Medical Sciences and Oncology, Chinese Academy of Sciences. OVCAR3 cell suspension (100 μL, 5×10 6 cells) were injected subcutaneously into the back of nude mice, with a volume of 1000 mm 3 When performing in vivo screening or imaging.

[0117] The nude mice used in the experiment were housed in a clean laminar flow rack in an SPF-grade animal room barrier system, with a temperature of 20-25°C and a relative humidity of 40%-70%. 12 hours of light and 12 hours of darkness were ensured every day, and the noise level was less than 60 decibels. The mice could eat at will, and the bedding, feed, and drinking water required for growth were sterilized.

[0118] 3. Solution Preparation

[0119] ① Washing buffer solution: DPBS buffer (pH=7.4), 5 mM MgCl2, 4.5 g / L glucose.

[0120] ② Binding buffer solution: consists of washing buffer plus 1 mg / mL bovine serum albumin (BSA) and 0.1 mg / mL herring sperm DNA.

[0121] ③Tumor tissue digestion fluid: It is composed of DMEM basic culture medium with 2 mg / mL neutral protease, 0.2 mg / mL collagenase IV and 0.002 mg / mL DNase I added.

[0122] ④5X Mix solution: consists of upstream primer (final concentration: 6 μM), downstream primer (final concentration: 6 μM), dNTP (final concentration: 375 μM), Taq DNA polymerase, 10X Buffer and ultrapure water.

[0123] When screening the above-mentioned nucleic acid aptamers, the nucleic acid library and primers used are designed as follows:

[0124] Random nucleic acid library (LibTB1 DNA):

[0125] AAG GAG CAG CGT GGA GGA TA-NNNNNNNNNN NNNNNNNNNN NNNNNNNNNNNNNNNNNN NNNNN-TTA GGG TGT GTC GTC GTG GT

[0126] Upstream primer: 5'-fluorescein isothiocyanate-AAG GAG CAG CGT GGA GGA TA TA-3'

[0127] Downstream primer: 5′-biotin-ACC ACG ACG ACA CAC CCT AA-3′.

[0128] Where N represents any random base among A, T, C, and G.

[0129] 4. The in vivo screening process is as follows Figure 1 As shown in A, the specific steps are as follows:

[0130] (1) First round - in vitro screening

[0131] 1) Library preparation: 7.2 nmol of Lib TB1 library was dissolved in 150 μL of DPBS, denatured at 95°C for 10 min, cooled on ice for 5 min, and renatured at room temperature for 15 min.

[0132] 2) Target cell preparation and treatment

[0133] ①Preparation of single-cell suspension of tumor tissue

[0134] a) One OVCAR3 cell line xenografted mouse was sacrificed, and the tumor tissue was removed, washed three times with DPBS, and cut into 2 mm pieces. 2 Small pieces.

[0135] b) Add 2 mL of tumor tissue digestion solution to the chopped tumor tissue fragments and digest in a 37°C constant temperature water bath for 20 min.

[0136] c) Filter the tissue cell mixture obtained in the previous step through a 70 μm filter to collect the single cell suspension, centrifuge it at 1500 rpm for 5 minutes in a low-speed automatic balancing centrifuge, and remove the supernatant.

[0137] d) Wash the cells twice with 5 mL of DPBS and centrifuge at 1500 rpm for 5 min in a low-speed automatic balancing centrifuge. Remove the supernatant to obtain the cell pellet.

[0138] e) Add 5 mL of red blood cell lysis buffer to the cell pellet, mix thoroughly, and let stand at room temperature for 5 minutes. Neutralize with DPBS and centrifuge at 1500 rpm for 5 minutes in a low-speed, automatically balanced benchtop centrifuge. Remove the supernatant.

[0139] f) Wash the cells twice with 5 mL of DPBS and centrifuge at 1500 rpm for 5 minutes in a low-speed automatic balancing centrifuge. Remove the supernatant to obtain a cell pellet.

[0140] g) Add DMEM / F12 (1:1) complete medium to the cell pellet to resuspend, count, and culture overnight.

[0141] ②Cell treatment

[0142] a) Remove the cells treated the day before, remove the culture medium, and wash twice with DPBS.

[0143] b) The adherent cells were digested with a cell digestion solution containing 0.02% EDTA in a 37° C. incubator for 5 minutes, gently pipetted and collected into a 1.5 mL EP tube, centrifuged at 2000 rpm for 1 minute, and the supernatant was removed.

[0144] c) Wash the cell pellet obtained in the previous step twice with wash buffer and resuspend in 850 μL binding buffer.

[0145] 3) Add 150 μL of the prepared Lib TB1 DNA library solution to 850 μL of the cell suspension, mix well, and incubate on ice for 1 hour.

[0146] 4) After incubation, remove the supernatant and gently wash the cells three times with wash buffer.

[0147] 5) After washing, add 160 μL of ultrapure water to the cells, denature at 95°C for 10 min, cool on ice for 10 min, and then use for PCR amplification.

[0148] 6) PCR amplification

[0149] a) PCR1 amplification system:

[0150] ①160μL supernatant + 40μL 5X Mix, divided into two tubes, 100μL each.

[0151] ②Cell pellet + 160 μL ultrapure water + 40 μL 5X Mix, divide into two tubes, 100 μL each.

[0152] The annealing temperature for ① and ② was set to 60°C, the number of cycles was set to 8, and after the amplification was completed, the supernatant was collected into a 1.5 mL EP tube for later use.

[0153] b) Cycle Optimization for PCR 2: Mix 1 μL of PCR 1 product with 10 μL of 5X Mix and 39 μL of ultrapure water. Aliquot 10 μL into five tubes. Set the annealing temperature to 60°C and perform a cycle number of 8-16, with two cycles between each sample. Confirm that the optimal cycle number is 16 based on band analysis on 8% denaturing polyacrylamide gel electrophoresis (PAGE).

[0154] c) PCR3: Based on the conditions explored in PCR2, PCR3 amplification was performed. The amplification system was 1 mL (20 μL PCR1 product + 200 μL 5X Mix + 780 μL ultrapure water).

[0155] 7) Preparation of ssDNA

[0156] a) Add 70 μL of the streptavidin agarose bead suspension to an empty microcolumn tube and filter under pressure to remove the liquid. The beads will remain on the top of the filter cartridge.

[0157] b) Wash the column twice with 100 μL DPBS.

[0158] c) The products obtained from PCR3 were combined and passed through a microcolumn.

[0159] d) Wash twice with 100 μL DPBS.

[0160] e) Wash the microcolumn twice with 50 μL of 200 mM NaOH solution, and collect the eluate.

[0161] f) Pre-wash a NAP-5 desalting column (GE Healthcare, UK) with ultrapure water (no less than 15 mL).

[0162] g) Add 100 μL of ssDNA eluate to the column.

[0163] h) After all the liquid has entered the column, add 400 μL of ultrapure water.

[0164] i) After all the liquid has entered the column, add 600 μL of ultrapure water.

[0165] j) Use a 1.5 mL EP tube to collect the effluent, the volume is about 600 μL.

[0166] k) Determine the ssDNA content using a UV spectrophotometer.

[0167] l) Label the prepared ssDNA, vacuum dry it, and freeze it at -40°C for use in the next round of screening.

[0168] (2) Second round - in vivo screening

[0169] 1) Dissolve 1 nmol of the ssDNA library prepared in the previous round in 150 μL DPBS, denature at 95°C for 10 min, cool on ice for 5 min, and anneal at room temperature for 15 min.

[0170] 2) 150 μL of the renatured library was injected into OVCAR3 cell line xenograft mice via tail vein injection. The mice were killed suddenly 40 minutes later, and the tumor tissue was removed, washed three times with DPBS, minced, and placed on ice for later use.

[0171] 3) Add 160 μL of ultrapure water to the tumor tissue fragments obtained in the previous step, denature at 95°C for 10 min, cool on ice for 10 min, and set aside.

[0172] 4) PCR amplification

[0173] a) PCR1 amplification system:

[0174] ①160μL supernatant + 40μL 5X Mix, divided into two tubes, 100μL each.

[0175] ②Cell pellet + 160 μL ultrapure water + 40 μL 5X Mix, divide into two tubes, 100 μL each.

[0176] The annealing temperature for ① and ② was set to 60°C, the number of cycles was set to 8, and after the amplification was completed, the supernatant was collected into a 1.5 mL EP tube for later use.

[0177] b) Cycle Optimization for PCR 2: Mix 15 μL of PCR 1 product with 10 μL of 5X Mix and 25 μL of ultrapure water, then aliquot into five tubes (10 μL per tube). Set the annealing temperature to 60°C and perform 16-24 cycles, with two cycles between each sample. Confirm that the optimal cycle number is 24 based on band analysis on 8% denaturing polyacrylamide gel electrophoresis (PAGE).

[0178] c) Use a DNA purification kit (FastPure Gel DNA Extraction Mini Kit) to recover the target band to remove some impurity bands, and finally obtain 60 μL of product.

[0179] d) PCR3: PCR3 amplification was performed according to the conditions explored in PCR2. The amplification system was 500 μL (60 μL PCR1 product + 100 μL 5X Mix + 340 μL ultrapure water).

[0180] 5) Preparation of ssDNA: The preparation method is the same as that in step 7) of the first round of in vitro screening, vacuum-dried, and stored at -40°C until use.

[0181] 5. High-throughput sequencing based on molecular ID strategy

[0182] (1) Molecular ID tagging of binding sequence

[0183] 1) Library preparation: The ssDNA library obtained from the second round of screening was diluted with DPBS, denatured at 95°C for 10 min, cooled on ice for 5 min, and annealed at room temperature for 15 min.

[0184] 2) Preparation of target cells: The target cell preparation and treatment methods are consistent with those in step 2) of the first round of in vitro screening. Count and ensure that each sample has 5×10 5 cells.

[0185] 3) The library prepared in step 1) (final concentration 400 nM) was mixed with the target cells in step 2) and incubated with occasional shaking on ice for 30 min.

[0186] 4) After incubation, wash the cells twice with washing buffer, add 15 μL of sterile water, and denature at 95°C for 10 minutes.

[0187] 5) Add 2μM TBLK (aaaAGG CAG ACA AGA CAG GTA CCA CGA CGACAC ACCaaa, final concentration 80nM), 2μM UMI (P'-CCTGTCTTGTCTGCCTACCT nnnnnnnnnn nnnnnnnnnnnnnnnnnn ACCTCTCAGAATTCGCACCA, final concentration 80nM), and 1X DNA Ligase Buffer to the product from the previous step. Mix thoroughly, then place in a PCR instrument at 95°C for 3 minutes, then at 55°C for 3 minutes. Incubate at room temperature for several minutes. Add 10X T4 DNA buffer, mix thoroughly, and incubate at room temperature for 20 minutes. Add T4 DNA Ligase, mix thoroughly, and incubate at room temperature for 30 minutes. The UMI is a molecular ID tag used to label the target. The CCTGTCTTGTCTGCCT portion is a known fixed sequence with variable sequence and length, used to label and screen libraries under the guidance of a linker sequence. ACCT is a known fixed sequence with variable sequence and length, used to label aptamers or for labeling different experiments. nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn is a random sequence with a length of 7-100, used for molecule counting. ACCTCTCAGAATTCGCACCA is used for PCR amplification after labeling library molecules. TBLK is used to assist in coupling potential aptamers with a unique ID tag.

[0188] 6) Inactivate the product from the previous step in a PCR instrument at 65°C for 10 minutes to inactivate T4 DNA Ligase.

[0189] 7) PCR amplification

[0190] a) PCR1 amplification system:

[0191] A certain proportion of 5X Mix was added to the above-mentioned ligation complex, mixed and then PCR amplification was performed, with the annealing temperature set to 57° C. and the number of cycles set to 10.

[0192] Upstream primer: 5-AAG GAG CAG CGT GGA GGA TA TA-3'

[0193] Downstream primer: 5-TGG TGC GAA TTC TGA GAG GT-3',

[0194] b) PCR2:

[0195] Take 1 μL of PCR1 product and perform further amplification at 57°C for 25 cycles. Determine whether the ssDNA is successfully linked to the UMI (approximately 150 bp in length) by 8% denaturing polyacrylamide gel electrophoresis (PAGE). If the band is lighter in color, increase the template input appropriately.

[0196] c) PCR3:

[0197] PCR3 amplification was performed according to the conditions explored in PCR2, and the amplification system was 100 μL.

[0198] (2) High-throughput assay

[0199] The PCR3 product was sequenced by Hangzhou Ruipu Gene Technology Co., Ltd.

[0200] The sequencing results are as follows Figure 1 As shown in B, after a single round of in vivo screening, the types and quantities of nucleic acid sequences in the enriched library showed significant differences. The open source software Python was used to sort the results obtained from high-throughput sequencing based on sequence repetitiveness, abundance, and homology. One candidate sequence, HIM XQ-Apt3-CD318, was selected for chemical synthesis and truncation optimization to verify its binding properties.

[0201] To achieve a single round of in vivo screening, Example 1 first performs in vitro screening to pre-enrich the library sequences and reduce the loss of library sequences due to metabolism. If a non-single copy nucleic acid library is synthesized by chemical synthesis, this step can also be omitted. Then, in vivo screening is performed to recover sequences bound to the tumor site. This process directly tests the nucleic acid library in a real environment in vivo. Finally, the nucleic acid sequences bound to the target cells are labeled using a molecular ID labeling strategy, and the library is constructed, sequenced, and sequence analyzed. The selected sequences are then verified.

[0202] Compared with traditional in vivo screening methods, Example 1 significantly shortens the aptamer screening cycle. Traditional in vivo screening often requires 10-20 rounds of screening, while the method of the present invention can be achieved with a single round of ex vivo-in vivo screening, shortening the screening cycle from 1-2 months to 1-2 weeks. This reduces the possibility of failure due to excessive uncontrollable interference factors during the in vivo screening process, thereby increasing the likelihood of success. Furthermore, because the aptamers have been tested in the actual in vivo environment during the screening process, it is possible to screen for aptamers that have good in vivo targeting, are resistant to nuclease degradation, and meet the requirements for in vivo applications.

[0203] Example 2: Optimization and characterization of nucleic acid aptamers

[0204] 1. Sequence Optimization of the Aptamer HIM XQ-Apt3-CD318

[0205] Based on the high-throughput sequencing results, sequence enrichment and homology analysis were performed, and a potential nucleic acid aptamer sequence, HIM XQ-Apt3-CD318, was selected and truncated and optimized. The specific sequence information is shown in Table 2. First, the binding of fluorescein isothiocyanate (FITC)-labeled aptamers (HIM XQ-Apt3-CD318, HIM XQ-Apt3a-CD318, HIM XQ-Apt3b-CD318, and HIM XQ-Apt-CD318) to OVCAR3 cells was determined by flow cytometry.

[0206] like Figure 2 As shown in the figure, compared with the control sequence, HIM XQ-Apt3-CD318, HIM XQ-Apt3a-CD318, HIM XQ-Apt3b-CD318, and HIM XQ-Apt-CD318 all have good binding ability to OVCAR3 cells, and the binding conditions with the cells are basically consistent, indicating that the four sequences before and after truncation may all be potential nucleic acid aptamers.

[0207] Table 2 Sequence information

[0208]

[0209] 2. Aptamer Competition Experiment

[0210] To further investigate whether HIM XQ-Apt3-CD318 still recognizes the same target before and after truncation, unlabeled HIM XQ-Apt-CD318 and four FITC-labeled aptamers were mixed with cells and incubated on ice for 30 min. The cells were washed, centrifuged, resuspended, and detected by flow cytometry. Figure 3 ) indicates that the four sequences recognize the same target and compete with each other. Compared to the original sequence, HIM XQ-Apt-CD318 has the shortest sequence. After truncation optimization, its binding to cells remained unchanged, so it was used in subsequent experimental studies.

[0211] 3. Characterization of the binding of the nucleic acid aptamer HIM XQ-Apt-CD318 to tumor tissue single cell suspension

[0212] The binding ability of HIM XQ-Apt-CD318 has been preliminarily verified on cell lines. To further explore the binding of HIM XQ-Apt-CD318 (labeled with cyanine dye Cy5.5) to tumor tissue, an OVCAR3 xenograft mouse was randomly selected, and the tumor tissue was removed to prepare a single cell suspension (see Example 1 for specific steps). Then, the cells were incubated with HIM XQ-Apt-CD318 (labeled with cyanine dye Cy5.5) on ice for 30 minutes, washed and resuspended, and detected by flow cytometry. The flow cytometry results showed that HIMXQ-Apt-CD318 had strong binding to the single cell suspension of tumor tissue ( Figure 4 ).

[0213] 4. Affinity Determination of Aptamer HIM XQ-Apt-CD318

[0214] The affinity of the FITC-labeled aptamer HIM XQ-Apt-CD318 obtained by screening was characterized by flow cytometry. 5 OVCAR3 cells were mixed and incubated on ice for 30 minutes. After washing, centrifugation, and resuspending, the cells were analyzed by flow cytometry. Flow cytometry data were processed using FlowJo software and plotted using GraphPad Prism 8.0 software. The horizontal axis represents the single-stranded DNA concentration (nM) and the vertical axis represents the mean fluorescence intensity after deducting the cell autofluorescence value. The binding dissociation constant of the nucleic acid aptamer was calculated using the formula Y = BmaxX / (Kd+X), as shown in Figure 5. Figure 5 As shown, the apparent equilibrium dissociation constant (Kd=14.15±3.065 nM) of HIM XQ-Apt-CD318 is in the nanomolar range, indicating that it has a strong affinity.

[0215] 5. Stability of the Nucleic Acid Aptamer HIM XQ-Apt-CD318 in Serum

[0216] 1) Stability of HIM XQ-Apt-CD318 in 10% serum

[0217] The nucleic acid aptamer HIM XQ-Apt-CD318 was diluted to 100 μM with DPBS, denatured at 95°C for 10 minutes, cooled on ice for 5 minutes, and placed at room temperature for 15 minutes. 6.6 μL of 100 μM HIM XQ-Apt-CD318 (final concentration of 3 μM) was added to 213.4 μL of DMEM culture medium containing 10% FBS, and divided equally into 11 samples, each 20 μL, and placed in a 37°C biochemical incubator for incubation. The samples were taken out at 0, 1, 2, 4, 6, 10, 12, 18, 24, 36, and 48 hours, denatured at 95°C for 10 minutes, and then frozen at -80°C. The degradation of HIM XQ-Apt-CD318 was observed by 3% agarose gel. The results showed (see Figure 6 A) HIM XQ-Apt-CD318 began to degrade after 10 hours and showed obvious degradation after 24 hours. The half-life was 22 hours. The nucleic acid aptamer HIM XQ-Apt-CD318 had good stability.

[0218] 2) Stability of HIM XQ-Apt-CD318 in 100% serum

[0219] The nucleic acid aptamer HIM XQ-Apt-CD318 was diluted to 100 μM with DPBS, denatured at 95°C for 10 minutes, cooled on ice for 5 minutes, and placed at room temperature for 15 minutes. 6 μL of 100 μM HIM XQ-Apt-CD318 (final concentration of 3 μM) was added to 194 μL of 100% FBS and divided equally into 10 samples, each 20 μL, and incubated in a 37°C biochemical incubator. The samples were taken out at 0, 5, 10, 20, 30, 45, 60, 90, 120, and 180 minutes, denatured at 95°C for 10 minutes, and then frozen at -80°C. The degradation of HIM XQ-Apt-CD318 was observed by 8% denaturing polyacrylamide gel electrophoresis. The results showed (see Figure 6 B) HIM XQ-Apt-CD318 began to show a degradation trend at 30 minutes and showed relatively obvious degradation at 90 minutes. The half-life was 93 minutes. The nucleic acid aptamer HIM XQ-Apt-CD318 had good stability in 100% serum.

[0220] Example 3. Capture of the target protein by the nucleic acid aptamer HIM XQ-Apt-CD318 and verification of the results

[0221] 1. Preparation of Stable Isotope Labeled Cells

[0222] OVCAR4 cells, a cell line with high CD318 expression, were selected for target protein identification. OVCAR4 cells had been passaged no more than 10 times and maintained good cell growth and adherence. Standard culture medium was discarded, and cells were washed twice with DPBS. SILAC-specific complete culture medium containing light and heavy isotopic amino acids was added and the cells were passaged for at least eight passages. Stably isotope-labeled cells were collected for mass spectrometry identification.

[0223] 2. Aptamer Target Capture and Mass Spectrometry Identification

[0224] 1) Cell preparation: OVCAR4 cells cultured in SILAC complete medium containing light and heavy isotopic amino acids were taken separately. The medium was discarded, and the cells were washed twice with DPBS. Then, they were digested with cell digestion solution containing 0.02% EDTA in a 37°C incubator for 5 minutes. The cells were gently pipetted off and collected separately. They were washed twice with washing buffer and counted to ensure that the number of cells in each sample was no less than 10 8 .

[0225] 2) Add biotin-modified HIM XQ-Apt-CD318 and a control sequence (final concentration: 200 nM) to the cells, respectively, as shown in Table 3. Incubate on ice for 30 minutes. After incubation, centrifuge and remove the supernatant. Gently wash the cells twice with wash buffer and monitor binding using a small amount of the cell suspension using flow cytometry.

[0226] Table 3 Sample information

[0227]

[0228] 3) Formaldehyde cross-linking: Add 2% formaldehyde solution to the sample and incubate on ice for 15 minutes. After the incubation, add 3M glycine solution to terminate the cross-linking.

[0229] 4) Cell lysis: Add freshly prepared cell lysis buffer (1 mL of lysis buffer containing 10 μL PMSF and 10 μL of cocktail protease inhibitor) to the sample and shake at 4°C for 1 h.

[0230] 5) Protein extraction: Place the sample in a pre-cooled 4°C high-speed centrifuge and centrifuge at 10,000 g for 10 min. After centrifugation, transfer the protein supernatant to a new centrifuge tube.

[0231] 6) Capture target protein: Add 20 μL of streptavidin agarose beads (purchased from Steril, Cat. No. 17511301) to each of the protein supernatants and incubate at 4°C for 2 h. After incubation, wash the beads three times with cell lysis buffer and then three times with DPBS.

[0232] 7) Mixing of light and heavy isotopes: Mix the agarose beads corresponding to sample ① with the agarose beads corresponding to sample ④, and mix the agarose beads corresponding to sample ② with the agarose beads corresponding to sample ③. Incubate at 4°C overnight.

[0233] 8) Electrophoresis separation: Equal amounts of 2X SDS loading were added to the mixed samples, heated at 95°C for denaturation for 1 h, and separated by 12% SDS-PAGE gel.

[0234] 9) Gel cutting and decolorization: Recover the 1 cm gel behind the bromophenol blue band and cut it into small pieces. Add 50% acetonitrile ammonium bicarbonate solution and wash for 30 minutes twice. Then add 100% acetonitrile and wash once. Remove the acetonitrile and air-dry for later use.

[0235] 10) Denaturation: Add 300 μL of 1.5 mg / mL DTT solution to the sample, heat at 56°C for 45 min, remove the DTT solution by centrifugation, and wash twice with 50% acetonitrile and ammonium bicarbonate solution for 30 min. Then, wash once with 100% acetonitrile, remove the acetonitrile, and air dry. Then, add 300 μL of 10 mg / mL IAA solution to each sample, let it stand at room temperature for 30 min, remove the IAA solution by centrifugation, and wash twice with 50% acetonitrile and ammonium bicarbonate solution for 30 min. Then, wash once with 100% acetonitrile, remove the acetonitrile, and air dry for later use.

[0236] 11) Overnight enzymatic hydrolysis: Add 100 μL of trypsin to the sample, with the liquid level above the gel, place on ice for 30 minutes, and then incubate at 37°C overnight.

[0237] 12) Peptide Collection: Add 100 μL of acetonitrile to the sample, vortex to mix, and centrifuge. Place the supernatant in a new centrifuge tube. Add 200 μL of Solution A (1% formic acid, 50% acetonitrile, 50% deionized water) to the new tube and wash twice. Centrifuge to recover the peptide supernatant and vacuum dry.

[0238] 13) Peptide Desalting: Solution B (100% acetonitrile, 0.1% formic acid), Solution C (50% acetonitrile, 50% deionized water, 0.1% formic acid), and Solution D (deionized water, 0.1% formic acid) were added sequentially to the desalting column for activation and equilibrium. The spin-dried peptide was dissolved in 150 μL of 0.1% formic acid solution. The desalting column was then pipetted 20 times in a centrifuge tube containing the peptide solution to adsorb the peptide. The column was then pipetted twice with Solution D for desalting, and the peptide was eluted with Solution C 20 times. The peptide solution was then vacuum concentrated for later use.

[0239] 14) Mass Spectrometry Detection and Analysis: The peptide products were analyzed and identified using an LTQ-Orbitrap Velos mass spectrometer (Thermo Fisher Scientific, San Jose, CA). The raw mass spectrometry data were searched against the Uniprot protein database using the MaxQuant search engine.

[0240] The database search parameters were as follows: fixed modifications were alkylation on cysteine, variable modifications were oxidation on methionine and acetylation on the protein N-terminus. Two missed cleavage sites were allowed, the precursor ion tolerance was 20 ppm, and the MS / MS fragment ion mass error was 0.5 Da.

[0241] The results of two repeated experiments showed (see Table 4) that the ratio of the protein intensity captured by the nucleic acid sequence HIM XQ-Apt-CD318 to the protein intensity captured by the control sequence was greater than 20 for CDCP1, and the ratios of the other endogenous biotinylated proteins were close to 1, indicating that the nucleic acid aptamer HIM XQ-Apt-CD318 has the ability to specifically separate and pull down the target protein and can specifically capture the CD318 protein (CUB domain protein 1, CDCP1 protein).

[0242] Table 4 Identification of HIM XQ-Apt-CD318 target proteins using SILAC

[0243]

[0244]

[0245] (Note: F and R represent two replicate experiments. F1 represents the ratio of the amount of captured protein in sample ③ to the amount of captured protein in sample ②, and F2 represents the ratio of the amount of captured protein in sample ① to the amount of captured protein in sample ④. R1 represents the ratio of the amount of captured protein in sample ③ to the amount of captured protein in sample ②, and R2 represents the ratio of the amount of captured protein in sample ① to the amount of captured protein in sample ④.)

[0246] 3. Verification of the Target Protein of the Nucleic Acid Aptamer HIM XQ-Apt-CD318

[0247] Mass spectrometry revealed that the target protein of the nucleic acid aptamer HIM XQ-Apt-CD318 may be CD318 (CDCP1). To further confirm the target protein of HIM XQ-Apt-CD318, the present invention conducted siRNA interference experiments (the siRNA used in the experiment were all from published literature, guide strand: 5'-GCUCUGCCACGAGAAAGCAACAUUA-3', antisense strand: 5'-UAAUGUUGCUUUCUCGUGGCAGAGC-3', synthesized by Shanghai Jima Gene Co., Ltd.) to knock down the CD318 protein. Flow cytometry (see Figure 7 ) found that the binding of the nucleic acid aptamer HIM XQ-Apt-CD318 to CD318 protein knockdown cells was significantly weakened, further proving that the target protein of HIM XQ-Apt-CD318 is CD318.

[0248] Example 4: Characterization of the affinity of HIM XQ-Apt-CD318 to CD318 by surface plasmon resonance (SPR)

[0249] 1) Reagent Preparation

[0250] a) Unlabeled nucleic acid aptamer HIM XQ-Apt-CD318 was diluted to 100 μM with DPBS, denatured at 95°C for 10 min, cooled on ice for 5 min, and renatured at room temperature for 15 min before use.

[0251] b) His protein (purchased from Nanjing GenScript Biotech Co., Ltd., catalog number: C556AHK150-1 / PE8715) was diluted with water to 19 mg / mL for later use.

[0252] c) CD318 protein (purchased from Beijing Sino Biological Technology Co., Ltd., catalog number: 13262-H08H) was diluted with water to 0.25 mg / mL for later use.

[0253] d) SPR buffer preparation: DPBS buffer (pH=7.4), 5 mM MgCl2.

[0254] 2) Protein coupling:

[0255] Flow cell channel 1: Equal volumes of NHS (0.1 M N-hydroxysuccinimide) and EDC (0.4 M 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) premixed in a 96-well microplate were added to activate the carboxyl groups on the CM5 chip at a flow rate of 10 μL / min. His protein, a control antibody, was diluted in 10 mM sodium acetate (pH 4.5) and added to the 96-well plate for coupling. The coupling time was 900 s at a flow rate of 10 μL / min, resulting in a final His protein coupling amount of 684.2 Ru. The chip was then blocked with ammonium acetate at a flow rate of 10 μL / min.

[0256] Flow cell channel 2: Equal volumes of NHS (0.1 M N-hydroxysuccinimide) and EDC (0.4 M aqueous solution) premixed were added to a 96-well microplate to activate the carboxyl groups on the CM5 chip at a flow rate of 10 μL / min. CD318 protein was diluted to 20 μg / mL in 10 mM sodium acetate, pH 5.0, and added to the 96-well plate for coupling. The coupling time was 900 s at a flow rate of 10 μL / min, resulting in a final CD318 protein coupling concentration of 4637.3 Ru. The chip was then blocked with ammonium acetate at a flow rate of 10 μL / min.

[0257] 3) Detection of binding between HIM XQ-Apt-CD318 and CD318

[0258] The nucleic acid aptamer HIM XQ-Apt-CD318 was diluted to 500 nM with SPR buffer, and the binding of HIM XQ-Apt-CD318 to CD318 protein was detected by surface plasmon resonance (Biacore 8K) with an association time of 120 s, a dissociation time of 180 s, and a regeneration reaction of 1.5 M NaCl at a flow rate of 30 μL / min. Figure 8 As shown in A, HIM XQ-Apt-CD318 has a relatively strong binding to CD318 protein, with fast binding and slow dissociation.

[0259] 4) Affinity determination of HIM XQ-Apt-CD318 and CD318:

[0260] The nucleic acid aptamer HIM XQ-Apt-CD318 was diluted with SPR buffer in a gradient manner to concentrations of 800nM, 400nM, 200nM, 100nM, 50nM, 25nM, 12.5nM, 6.25nM, 3.125nM, and 1.5625nM, respectively. The samples were injected sequentially, and the binding to CD318 protein was detected by surface plasmon resonance, and the data were fitted. Figure 8As shown in B, the dissociation constant of HIM XQ-Apt-CD318 and CD318 (Kd = 8.24 × 10 -8 M) At the nanomolar level, HIM XQ-Apt-CD318 has a relatively strong affinity for CD318 protein, which is basically consistent with the results of Example 2.

[0261] Example 5: Detection of CD318 molecules on the cell surface using the nucleic acid aptamer HIM XQ-Apt-CD318

[0262] Based on the above experimental results, the present invention further explored the binding of the nucleic acid aptamer HIM XQ-Apt-CD318 to various cells (human normal ovarian epithelial cells, human ovarian cancer cells, human gastric cancer cells, human leukemia cells, human lung cancer cells, etc.). FITC-labeled nucleic acid aptamers (final concentration: 200 nM) were mixed with the cells and incubated on ice for 30 minutes. After incubation, the cells were washed twice with wash buffer and monitored using a flow cytometer. Flow cytometry data were processed using FlowJo software and plotted using GraphPad Prism 8.0 software.

[0263] The results are as follows Figure 9 As shown, HIM XQ-Apt-CD318 has different binding abilities to various cells, enabling detection of CD318 molecule expression in different cells. Therefore, nucleic acid aptamers have the ability to characterize different cell membrane proteins and can be used in applications such as molecular probes and cell maps.

[0264] Example 6: Application of nucleic acid aptamer HIM XQ-Apt-CD318 in fluorescence imaging

[0265] 1. Application of the Nucleic Acid Aptamer HIM XQ-Apt-CD318 in Cell Imaging

[0266] 1) Dissolve the FITC-labeled and Cy5.5-labeled nucleic acid aptamer HIM XQ-Apt-CD318 in DPBS to a concentration of 4 μM, heat denature at 95°C for 10 min, place on ice for 5 min, and anneal at room temperature for 15 min before use.

[0267] 2) Cell treatment

[0268] According to Example 5 ( Figure 9 ), this experiment selected HCT-8 cells that bind more strongly to HIM XQ-Apt-CD318 for the experiment.

[0269] a) HCT-8 cells were plated on a 35 mm confocal culture dish and cultured for 48 h. The culture medium was then removed and the cells were washed twice with wash buffer.

[0270] b) Add 100 μL of binding buffer containing 200 nM HIM XQ-Apt-CD318 to the confocal microplate dish and incubate at 4°C (FITC-labeled aptamer) and 37°C (Cy5.5-labeled aptamer) for 30 min. Wash twice with wash buffer.

[0271] c) Add 100 μL of 4% paraformaldehyde and fix the cells at room temperature for 15 minutes, then wash twice with washing buffer.

[0272] d) Add 100 μL of 1X Hoechst 33342 and incubate at room temperature for 10 min. Wash twice with wash buffer.

[0273] e) Observed using a Nikon single-photon confocal scanning microscope.

[0274] like Figure 10 As shown, HIM XQ-Apt-CD318 bound to HCT-8 cells at both 4°C and 37°C. At 4°C, HIM XQ-Apt-CD318 bound to the cell membrane of HCT-8 cells. At 37°C, part of HIM XQ-Apt-CD318 bound to the cell membrane and part was internalized into the cells, further confirming that the screened nucleic acid aptamer HIM XQ-Apt-CD318 can specifically bind to cells at both 4°C and 37°C.

[0275] 2. Application of the Nucleic Acid Aptamer HIM XQ-Apt-CD318 in In Vivo Imaging

[0276] The Cy5.5-labeled aptamer HIM XQ-Apt-CD318 (2.15 nmol) and the control sequence RandomSequence (2.4 nmol) were dissolved in 150 μL DPBS, heated at 95°C for 10 min, placed on ice for 5 min, and renatured at room temperature for 15 min. The dissolved aptamer (HIM XQ-Apt-CD318) and the control sequence (RandomSequence) were injected into OVCAR3 cell line xenograft mice through the tail vein, and in vivo imaging was performed at intervals ( LuminaIII small animal in vivo imaging system), the mice were sacrificed after 1 hour, and the tumor, heart, liver, spleen, lung and kidney were taken out for imaging. Figure 11 As shown, HIM XQ-Apt-CD318 has good tumor targeting ability compared with the control sequence.

[0277] Example 7: CD318-targeted aptamer-coupled drug HIM XQ-Apt-CD318-GEMd proliferation inhibition experiment on HCT-8 cells

[0278] 1. Characterization of the binding ability of CD318-targeted aptamer-drug conjugate HIM XQ-Apt-CD318-GEM

[0279] HCT-8 cells, a cell line with high CD318 expression, were selected as in vitro experimental subjects. The binding of FITC-labeled CD318-targeting aptamer-drug conjugate HIM XQ-Apt-CD318-GEM to cells was characterized by flow cytometry. First, the aptamer (HIM XQ-Apt-CD318 / Random Sequence) and the aptamer-drug conjugate (HIM XQ-Apt-CD318-GEM / Random Sequence-GEM) were diluted and mixed with 3×10 5 The HCT-8 cells were mixed and incubated on ice or at 37°C for 30 min. The cells were washed, centrifuged, and resuspended, and the binding was detected by flow cytometry.

[0280] like Figure 12 As shown, HIM XQ-Apt-CD318-GEM maintained good cell binding at both 4°C and 37°C compared to Random Sequence-GEM.

[0281] 2. Proliferation inhibition experiment of CD318-targeted aptamer-drug conjugate HIM XQ-Apt-CD318-GEM

[0282] HCT-8 cells were seeded into 96-well plates (3000 cells per well) and cultured at 37°C, 5% CO2 for 24 hours. Aptamer-drug conjugates (HIM XQ-Apt-CD318-GEM / Random Sequence-GEM) at various concentrations (1.95 nM, 3.9 nM, 7.8 nM, 15.625 nM, 31.25 nM, 62.5 nM, 125 nM, 250 nM, 400 nM, and 500 nM) were then added to 1640 complete medium (containing 5% FBS) for 8 hours. Untreated cells served as controls. The drug-containing medium was discarded and replaced with drug-free medium for an additional 72 hours. After this, 100 μL of complete cell culture medium containing 10% CCK-8 was added as a replacement. After the appropriate incubation period, cell viability was determined by measuring absorbance at 450 nm on a microplate reader. The data were processed using Excel software and graphed using GraphPad Prism 8.0 software.

[0283] The results are as follows Figure 13As shown in Figure 2, compared with RandomSequence-GEM, the CD318-targeted aptamer-coupled drug HIM XQ-Apt-CD318-GEM has a better cell proliferation inhibitory effect on colorectal cancer HCT-8 cells, and its IC 50 The value is 300nM.

[0284] The above describes the embodiments of the present invention. However, the present invention is not limited to the above embodiments. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included in the scope of protection of the present invention.

Claims

1. A nucleic acid aptamer that specifically recognizes CD318 protein, wherein the nucleic acid aptamer is selected from at least one of the sequences shown in SEQ NOs. 1-4: SEQ NO.1: HIM SEQ NO. 2: HIM XQ-Apt3a-CD318: AGGATAACCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTATCGA; SEQ NO. 3: HIM XQ-Apt3b-CD318: ATAACCCGTAGTAGGTTGCGTAGCTAGTGTTAGAGGTCGGGGTAT; SEQ NO. 4: HIM 2. The nucleic acid aptamer according to claim 1, characterized in that The nucleic acid aptamer further comprises at least one of the following: (1) modifying the nucleic acid aptamer; (2) Performing coupling modification on the nucleic acid aptamer.

3. The nucleic acid aptamer according to claim 2, characterized in that The modification includes at least one of the following modification methods: (1) Phosphorylation; (2) Methylation; (3) Amination; (4) Sulfhydrylation; (5) Isotopization; (6) Fluorination; (7) Substitution of oxygen with sulfur; (8) Substitution of oxygen with selenium; And / or, the coupling modification comprises at least one of the following modification methods: (1) Connecting a fluorescent marker to the aptamer; (2) Connecting radioactive substances to the aptamer; (3) Connecting biotin to the nucleic acid aptamer.

4. The nucleic acid aptamer according to claim 2, characterized in that The transformation method of the coupling transformation is: The therapeutic substance is linked to the nucleic acid aptamer.

5. The nucleic acid aptamer according to claim 2, characterized in that The transformation method of the coupling transformation is: Connecting nanomaterials to nucleic acid aptamers.

6. The nucleic acid aptamer according to claim 2, characterized in that The transformation method of the coupling transformation is: Connect micromaterials to nucleic acid aptamers.

7. Use of the nucleic acid aptamer that specifically recognizes CD318 protein according to any one of claims 1 to 6, comprising at least one of the following: (1) Use in the preparation of a reagent that specifically recognizes CD318 protein; (2) Use in the preparation of reagents for qualitative or quantitative detection of CD318 protein; (3) Use in the preparation of CD318 protein imaging agents; (4) Use in the preparation of drug carriers; (5) Application in the preparation of molecular probes.

8. A pharmaceutical composition comprising the nucleic acid aptamer that specifically recognizes CD318 protein according to any one of claims 1 to 6.

9. A reagent comprising the nucleic acid aptamer that specifically recognizes CD318 protein according to any one of claims 1 to 6; the reagent is selected from at least one of the following: (1) Reagents that target and recognize CD318 protein; (2) Reagents for qualitative or quantitative detection of CD318 protein; (3) Imaging agents that bind to CD318 protein; (4) Reagents for molecular probes.

Images