Maternal effect gene org and its sgRNA fragment in medaka

Abstract

The present invention discloses a maternal effect gene org of medaka and an sgRNA fragment thereof, belonging to the technical field of molecular biology, wherein the nucleotide sequence of the maternal effect gene org of medaka is SEQ ID NO.1, and the sgRNA fragment sequence is SEQ ID NO.2‑3. The present invention proves through CRISPR / Cas9 technology that the deletion of the org gene causes the embryo to be unable to complete the activation of the early zygotic genome and the genetic control process of the maternal to zygotic transition, resulting in stagnation of early embryonic development and eventual death, and that the gene org plays an important role in early embryonic development as a maternal effect gene.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and designs a sea medaka maternal effect gene org and an sgRNA fragment thereof. Background Art

[0002] Maternal effect genes (MEGs) transcribe maternal factors during the growth and development of oocytes and accumulate in the oocyte cytoplasm. These maternal factors are involved in the recovery of animal oocyte meiosis, the fusion of male and female pronuclei after fertilization, and the activation of early embryonic zygote genes. These maternal effect genes play specific functions in different processes to ensure the normal progress of life activities. In recent years, researchers have identified many maternal effect genes in mammals, including Hsf1, Bnc1, Figla and Nlrp5 genes in mice. However, the exploration of maternal effect genes in fish is not deep enough, especially the function of maternal effect genes in sea medaka is less studied. Sea medaka has been recognized as a model fish for ecotoxicology and environmental research in Asia. It has the characteristics of short reproductive cycle (3-4 months), daily spawning, small size (3-4 cm), transparent embryos, and easy large-scale cultivation in the laboratory. These characteristics make sea medaka a model organism for in vivo gene function testing.

[0003] In recent years, the development of CRISPR / Cas9 gene editing technology has achieved revolutionary success, and its application in the model organism medaka has become more and more mature. For example, researchers have obtained albino medaka through CRISPR / Cas9 technology, providing an important platform for studying pigmentation. In addition, the donor plasmid containing the heat shock promoter and the reporter gene was transferred into the medaka embryo by the non-homologous end-joining method, which efficiently generated knock-in transgenic medaka fish and promoted the analysis of gene function. These provide a theoretical and experimental basis for us to use CRISPR / Cas9 technology to study gene function with sea medaka as the experimental object. Summary of the invention

[0004] The present invention uses CRISPR / Cas9 technology to identify the maternal effect gene org and its sgRNA fragment in the sea medaka. It is found that the sea medaka org gene is consistent with other maternal effect genes. Its loss will cause the embryo to be unable to complete the activation of the early zygotic genome and the genetic control process of the maternal to zygotic transition, resulting in early embryonic development stagnation and eventual death. In addition, we found that the expression pattern of the org gene is consistent with that of other maternal effect genes in early embryonic development.

[0005] The present invention is achieved through the following technical solutions:

[0006] The first aspect of the present invention provides a maternal effect gene org of medaka, the nucleotide sequence of the gene is SEQ ID NO.1.

[0007] The second aspect of the present invention provides sgRNA of the org gene, SEQ ID NO.2: GGTGGGTCCAGAGCGCTCTG and SEQ ID NO.3: CTCAGCGTTTCCACCCAGGA.

[0008] The beneficial effects of the present invention compared with the prior art: The present invention cloned the org gene related to oogenesis of the sea medaka for the first time, designed and synthesized the sgRNA of the org gene, and tested the effectiveness of the sgRNA. We successfully knocked out the org gene in the early embryo of the sea medaka using CRISPR / Cas9 technology. The absence of the org gene in the experimental group caused the embryo to be unable to complete the activation of the early zygotic genome and the genetic control process of the maternal to zygote transition, resulting in stagnation of early embryonic development and eventual death, which is consistent with the embryonic development after knockout of other maternal effect genes. In addition, we studied the expression pattern of the org gene in early embryonic development, which is consistent with other maternal effect genes. The expression level is very abundant during the zygote activation period, and it is degraded after completing the genetic control process of the maternal to zygote transition. It proves the important role of org as a maternal effect gene in early embryonic development.

[0009] The present invention provides a nucleotide sequence of the org gene, the nucleotide sequence is SEQ ID NO.1; provides an org gene target site sequence and a designed and synthesized sgRNA sequence SEQ ID NO.2-3, and provides primers for amplifying target site fragments, the primer sequences are org-gRNAF12, org-gRNAF3 and org-gRNAR. In addition, the present invention provides specific steps for breeding and embryo microinjection of sea medaka, specific steps for sgRNA design and synthesis; steps for extracting DNA from a single embryo of sea medaka and primers for RT-qPCR: O.melastigma-qF, O.melastigma-qR, O.melastigma-actin-qF, O.melastigma-actin-qR. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1 This is a sequence diagram of the org gene target site in Example 3 of the present invention.

[0011] Figure 2 This is the electrophoresis result diagram of the sgRNA after synthesis and purification in Example 3 of the present invention.

[0012] Figure 3This is a phenotype diagram of the development of wild-type embryos and experimental group embryos in Example 4 of the present invention.

[0013] Figure 4 This is the working efficiency detection peak diagram of SEQ ID NO.2 in Example 5 of the present invention.

[0014] Figure 5 This is the working efficiency detection peak diagram of SEQ ID NO.3 in Example 5 of the present invention.

[0015] Figure 6 This is a diagram showing the expression pattern of the org gene in Example 6 of the present invention during early embryonic development. DETAILED DESCRIPTION

[0016] The technical solution of the present invention will be described clearly and completely below in conjunction with the accompanying drawings in the examples. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technical personnel in the field without creative work are within the scope of protection of the present invention.

[0017] Embodiment 1: The method of cultivating medaka and collecting fertilized eggs comprises the following steps:

[0018] 1. Marine medaka and embryo culture

[0019] The circulating culture system of medaka was purchased from Shanghai Haisheng Biological Experiment Equipment Co., Ltd. The water temperature of the circulating system is 26℃, the pH range is maintained at 7.0-8.0, the salinity range is 32-34, the dissolved oxygen is 5-8mg / L, and the photoperiod is 14 hours (8:00-22:00) of light and 10 hours (22:00-8:00) of darkness. According to the mating and spawning characteristics of medaka, the ratio of female fish to male fish in each fish tank is 3:2, and the breeding density is generally 5-10 fish / L. Fresh worms are fed 2-3 times a day to ensure the growth and reproduction of medaka. Each adult medaka lays 30-50 eggs per day. After spawning, the eggs are collected in time and placed in a culture dish for culture. The seawater in the culture dish is replaced every day to ensure sufficient oxygen content in the seawater to maintain the normal development of the embryo.

[0020] 2. Collection of fertilized eggs of medaka

[0021] The night before microinjection, sexually mature male and female medaka were separated into tanks, with 6-8 females and 6 males in each tank. On the day of injection, the male and female medaka were put into one tank one hour before the system lights were turned on. The females began to lay eggs, and the males chased after them and completed fertilization after the system lights were turned on. The number of male and female fish in the experiment can be adjusted in real time according to the number of eggs laid by the females and the arrangement of the later experiments.

[0022] About half an hour after fertilization, the fertilized egg develops to the single-cell stage. The embryos hanging around the genital pore are promptly removed and washed 2-3 times with circulating system water. The development period of the embryos is observed under a microscope. The single-cell embryos are sucked with a pipette and arranged on the prepared embryo slot. The position of the embryos is adjusted in the microscope field of view so that the animal pole is in a straight line with the microinjection needle. The remaining embryos are placed on ice or in a 4°C refrigerator to slow down the division rate. Embryos after the two-cell stage are no longer suitable for microinjection.

[0023] Example 2: Microinjection of medaka embryos comprises the following steps:

[0024] 1. Preparation of embryo cassettes for microinjection

[0025] Take 2% agar and dissolve it in 50mL sterile water. Heat it in a microwave oven until it boils and pour it into a 70mm sterile culture dish with a thickness of about 2 / 3. Place the ridged side of the ovulation mold on the upper layer of the agar solution in the culture dish and put it in a 4°C refrigerator to accelerate solidification. After solidification, remove the mold from the agar to complete the preparation of the embryo groove. Before use, add a 26°C incubator to preheat the slot. After use, add sterile water to the slot and store it in a 4°C refrigerator. It can be reused repeatedly.

[0026] 2. Microinjection Needle Preparation

[0027] The microinjection needle was pulled from a capillary glass tube in a horizontal needle puller (Sutter Instrument, P-1000) according to the parameters of the medaka embryo. The capillary glass tube was purchased from WPI (World Precision Instruments) and had an outer diameter of 0.8 mm. The needle pulling parameters for medaka embryos were: PULL: 55, HEAT: 550, Pressure: 300, and VEL: 60. The capillary glass tube was fixed in the heating wire of the needle puller, and the glass tube was burned off by the temperature of the heating wire and the pulling force at both ends of the glass tube, and it was in a closed state. Before microinjection, fix the microinjection needle (containing 0.05% phenol red indicator solution) in the syringe, place a glass slide on the microscope stage, adjust the angle of the microinjection needle to about 40-50 degrees with the glass slide, adjust the position of the microinjection needle in the field of view to the center of the field of view, slowly adjust the nut until the needle just touches the glass slide, and lift the microinjection needle immediately after phenol red indicator solution flows out to complete the needle breaking.

[0028] 3. Microinjection of Medaka Embryos

[0029] (1) First open the large valve of the nitrogen tank and control it at 12-13 MPa, then open the pressure reducing valve to within 0.3 MPa, turn on the syringe, adjust the injection pressure of the syringe to below 16 psi, and keep the hold pressure within the zero range. Adjust the switch at the hold pressure to vent to open the passage here, and adjust the switch at the eject pressure to hold to prevent backflow.

[0030] (2) Loading the needle. Use an RNase free pipette tip to draw 2 μL of RNP complex reagent onto the tip of the microinjection needle, taking care not to create bubbles.

[0031] (3) Adjust the microinjection dose. Place the microinjection needle in the center of the field of view, first increase the hold pressure slowly, so that the RNA complex forms droplets and gathers on the microinjection needle, and then fine-tune the hold pressure so that the droplets no longer grow or drip.

[0032] (4) Injection. Place the one-cell embryo under a stereomicroscope, adjust the field of view and the position of the embryo so that the microinjection needle is at the same level as the embryo's animal pole cells. Rotate the spiral to allow the needle tip to enter the one-cell embryo's animal pole. Press the foot pedal. The injection is successful if red droplets (RNP complexes) appear at the animal pole and the embryo is not damaged.

[0033] (5) After the injection is completed, close the nitrogen tank valve first, operate the system until it is completely exhausted, then close the pressure reducing valve and place the used microinjection needle into the discarded medical box.

[0034] (6) After the injection, the eggs were placed in a culture dish filled with seawater and cultured in an incubator at 26°C. The eggs were observed daily, dead eggs were sucked out, and the water was changed.

[0035] Example 3: sgRNA design and synthesis purification includes the following steps:

[0036] 1. sgRNA design

[0037] The NCBI database was used to query the medaka org gene sequence information, and the medaka ovary RNA was extracted and converted into cDNA. The specific steps are as follows:

[0038] Total RNA was extracted using the Total RNA Purification Kit (Norgen Biotek, Canada). The specific steps are as follows:

[0039] (1) Select a female sexually mature medaka and anesthetize it with ice water. Use sterilized forceps, scalpels and other tools to dissect the ovarian tissue. Place about 20 mg of ovarian tissue into a 1.5 mL RNase-free centrifuge tube, add 300 μL of Buffer RL, and grind it with a tissue grinder until the solution is transparent.

[0040] (2) Add 300 μL of Buffer RL to the fully ground solution to make up to 600 μL, then add 600 μL of 70% alcohol solution and vortex to mix.

[0041] (3) Transfer the mixture into the RNA Binding Column, centrifuge at 13,000 rpm for 1 min, and discard the filtrate.

[0042] (4) Repeat step 3.

[0043] (5) Place the RNA Binding Column in a new RNase-free 1.5 mL centrifuge tube, add 50 μL of Elution Solution A, centrifuge at 200 rpm for 2 min, and then centrifuge at 14,000 rpm for 1 min.

[0044] (6) Take 1 μL of the total RNA dissolved in Elution Solution A and use a NanoDrop2000 spectrophotometer (Thermo, Waltham, MA, USA) to detect the RNA concentration and purity. Take another 1 μL of the RNA solution and use 1% agarose gel electrophoresis to detect the integrity of the RNA. The rest is stored in an ultra-low temperature refrigerator at -80°C.

[0045] DNA-free TM Kit (ambion Inc, Austin) was used for DNA erasure. The specific steps are as follows:

[0046] (1) Take 3 μg of qualified RNA and put it into a 200 μL RNase-free centrifuge tube, place it on ice, add 10× DNase I Buffer and 1 μL rDNase I, and mix well.

[0047] (2) Place the centrifuge tube in a PCR instrument and incubate at 37°C for 30 min.

[0048] (3) After incubation, remove the centrifuge tube, place it on ice, add DNase Inactivation Reagent and mix well.

[0049] (4) Leave at room temperature for 2 min, pipetting 1-2 times in between.

[0050] (5) Centrifuge at 10,000 rpm for 1.5 min and transfer the RNA to a new RNase-free centrifuge tube.

[0051] Use Takara's PrimeScript to generate RNA after DNA erasure TMII 1st Strand cDNA Synthesis Kit instructions for reverse transcription, the specific steps are as follows:

[0052] (1) Take 1 μg of RNA after DNA erasure and place it in a 200 μL RNase-free centrifuge tube and place it on ice. Add 1 μL Oligo dT Primer, 1 μL dNTP Mixture, and RNase Free water to make the total system 10 μL. Mix well and centrifuge briefly.

[0053] (2) Place the centrifuge tube in a PCR instrument and incubate at 65°C for 5 min. Immediately place on ice to terminate the reaction.

[0054] (3) Take a new centrifuge tube, add 4 μL 5× PrimeScript II Buffer, 0.5 μL RNase Inhibitor, 1 μL PrimeScript II RTase, and 4.5 μL RNase Free water. Transfer the product in step 1 to the new centrifuge tube, mix well, and centrifuge briefly.

[0055] (4) The mixed sample was placed in a PCR instrument, reacted at 42°C for 60 min and 95°C for 5 min to obtain cDNA, and the product was placed in a -20°C refrigerator for subsequent use.

[0056] Primers were designed based on the org gene sequence and sequence verification was performed using the ovary cDNA of the sea medaka as a template. The CDS region sequence of the org gene of the sea medaka (SEQ ID NO.1) is:

[0057] .

[0058] The sgRNA sequence design for the org gene follows the following principles: First, sgRNAs with more than 4 thymine nucleotides (5'-TTTT-3') are excluded because they are recognized as transcription termination signals by RNA polymerase III. Secondly, for the efficiency of gRNA, the target site should be located in the first exon as much as possible, the target site sequence length should be 20bp, and should not be a multiple of 3, and the GC content should generally be around 60%. Three sgRNAs were designed for the org gene sequence of medaka:

[0059] SEQ ID NO.2:GGTGGGTCCAGAGCGCTCTG;

[0060] SEQ ID NO.3:CTCAGCGTTTCCACCCAGGA;

[0061] SEQ ID NO.4: ACTCGAACCACGAGCCCGAA In addition, the target site base sequence was input on the entire genome of the medaka using the BLAST tool in NCBI to check the specificity of the target site sequence.

[0062] like Figure 1 These are the three target sites selected according to the sgRNA design principles. The sequences in the boxes represent the target sequences of the sgRNAs, and the underlined sequences represent the NGG protospacer adjacent motif sequences.

[0063] 2. sgRNA synthesis and purification

[0064] Plasmid PGL3-U6-sgRNA-PGK-puromycin (Addgene, USA) was used as a template. The forward primer was the T7 promoter primer sequence + the base GGG to improve the efficiency of T7 polymerase + the target site sequence + 20 bases upstream of the gRNA backbone; the reverse primer was the reverse complementary sequence downstream of the gRNA backbone. The upstream and downstream primers were: org-gRNAF1:TGTAATACGACTCACTATAGGAGCTCACCTGAAGAAGCGCGGTTTTAGAGCTAGAAAT; org-gRNAF2:TGTAATACGACTCACTATAGGTGGACGGCGCGTGGACGCAGGTTTTAGAGCTAGAAAT; org-gRNAF3:TGTAATACGACTCACTATAGGGGAGCGGGGAGGAGCCTCTGGTTTTAGAGCTAGAAAT; org-gRNAR:AAAAGCACCGACTCGGTGCC. The PCR products were verified and purified by agarose gel electrophoresis. The purified product was used as a transcription template and a T7 High Yield Transcription Kit (Thermo Fisher) was used for transcription reaction. 0.5 μg of template input could produce 150-200 μg of RNA.

[0065] The transcribed RNA was purified as follows:

[0066] (1) Add 160 μL RNase-free ddH2O to dilute the product to 180 μL.

[0067] (2) Add 20 μL of 3 M sodium acetate (pH 5.2) to the diluted product and mix thoroughly.

[0068] (3) Add 200 μL of phenol / chloroform mixture (1:1) for extraction, centrifuge at 12,000 rpm for 5 min at room temperature, and transfer the upper layer solution to a new RNase-free EP tube.

[0069] (4) Add an equal volume of chloroform to the aqueous phase and extract twice, then collect the upper aqueous phase.

[0070] (5) Add 2 volumes of anhydrous ethanol, mix well, incubate at -20°C for 30 min, and centrifuge at 12,000 rpm at 4°C for 15 min.

[0071] (6) Discard the supernatant, add 500 μL of pre-cooled 70% ethanol to wash the RNA precipitate, centrifuge at 12,000 rpm at 4°C, and discard the supernatant.

[0072] (7) Open the lid and dry for 2 min. Add 20 μL RNase-free ddH2O or other buffer to dissolve the RNA precipitate and store at -80°C.

[0073] like Figure 2 This is the electrophoresis diagram of sgRNA after purification. The band size of org sgRNA is about 120bp. The concentrations of org sgRNA are org SEQ ID NO.2: 903.76ng / μL, org SEQ ID NO.3: 872.05ng / μL, and org SEQ ID NO.4: 956.63ng / μL.

[0074] Example 4: Development of embryos in the microinjection group

[0075] The three sgRNAs were diluted to 100 ng / μL with 0.05% sterile enzyme-free tracking indicator phenol red solution, and the cas9mRNA was diluted to 400 ng / μL. The sgRNAs were incubated with cas9mRNA at room temperature for 5-10 min to form RNP complexes. 2nL of RNP complex was injected into the animal pole of the medaka embryo at the single-cell stage each time. About 100 fertilized eggs can be injected before the two-cell stage. Wild-type fertilized eggs were used as controls. The embryos of the experimental group and the wild group were placed in a constant temperature incubator at 26°C, and dead eggs were removed in time to prevent contamination of other embryos. The development of the embryo was observed according to different stages of embryonic development, such as the rate of cell division at the animal pole. Figure 3As shown in the figure, we found that within 3 hours after fertilization, there was no significant difference in embryonic development between the wild group and the experimental group. However, 3 hours after fertilization, the embryos in the experimental group began to develop slowly. At about 6 hours after fertilization, there was a significant difference in the embryonic development speed between the wild group and the experimental group. The number of animal pole cells in the experimental group did not increase compared with the embryos 3 hours after fertilization, and the cell morphology was abnormal. About 10 hours after fertilization, the animal pole cells of the embryos in the experimental group apoptosis, and the yolk membrane color turned black. At about 22 hours after fertilization, the yolk membrane of the embryos in the experimental group shrank and died. In contrast, the wild-type embryos developed normally. Based on the embryonic development process of the sea medaka combined with the embryonic development process recorded by time, it can be concluded that the embryos in the experimental group have stopped developing before the morula stage and began to die in the late blastocyst stage. About 54% of the embryos died completely 24 hours after fertilization, and the remaining about 56% of the embryos were slightly delayed in development compared with the wild group.

[0076] Example 5: Target site working efficiency detection

[0077] Embryos from the experimental group and the wild group were collected, and genomic DNA of medaka embryos was extracted using the lysis method.

[0078] Here’s how:

[0079] (1) Place the cleaned single embryo into a 200 μL microcentrifuge tube and pierce the embryo with an RNase Free pipette tip or a toothpick (sterilized at high temperature).

[0080] (2) Add 8 μL of DNA lysis buffer (containing 20 mg / ml proteinase K) to the centrifuge tube, mix thoroughly and centrifuge briefly.

[0081] (3) Place the centrifuge tube into a PCR instrument and react at 65°C for 30 min and 95°C for 10 min. Centrifuge at 12,000 rpm for 5 min, take the supernatant solution DNA and store it at -20°C.

[0082] Design primers to amplify the org gene using genomic DNA as a template. Upstream and downstream primers (sgRNA1-2F: AGCGGAGCGGGGAGGAGC; sgRNA1-2R: CCCCGCCGCATTTTGGTT; sgRNA-3F: TGCGTCCCACAGAAATCC; sgRNA-3R: CCGTGTTGTTGTGGGAGG) are designed 400-500bp upstream and downstream of the target site. The product length should be within 800bp to ensure the correctness of sequencing. The PCR system is 1μL DNA template, 1μL forward and reverse primers, 10μL Rapid enzyme, and 7μL ddH2O. The PCR product is detected by agarose gel electrophoresis, and the single band product is sent to the company for Sanger sequencing to check whether there are overlapping peaks near the target site. If there are overlapping peaks, it means that the knockout is successful. If it is a single band, it means that the knockout has failed.

[0083] like Figure 4 , 5 As shown: The org gene sequence peaks of the wild-type and experimental group embryos that did not die were all single peaks, while 23 embryos in the experimental group that died had base mutations, with continuous peaks at target site 1 and target site 2, respectively. The mutation of target site 1 occurred on the antisense strand, and the mutation of target site 2 occurred on the sense strand. There was no mutation at target site 3, indicating that sgRNA1 and sgRNA2 have the function of guiding cas9 protein to perform cutting. According to statistics, there were 23 embryos in the experimental group that had base mutations, accounting for 36.5% of the dead embryos in the experimental group (63 embryos) and 20.5% of the entire experimental group (112 embryos). In this experiment, the embryos with org gene knockout stagnate and eventually die, and the reason for the death or developmental retardation of embryos without org gene knockout may be that the embryos are physically damaged.

[0084] Example 6: Expression pattern of org gene in early embryonic development:

[0085] We designed primers based on the medaka org gene sequence:

[0086] O.melastigma-qF:CCCTGTCCCCAGAAATCC;

[0087] O. melastigma-qR: CTCCTGGCTCAGCGTTTC;

[0088] O.melastigma-actin-qF: CTGAGGATTGCTGAGCCTTACAT;

[0089] O.melastigma-actin-qR:CTCAACACAGATGATCCGTATT.

[0090] The expression level of org gene during early embryonic development of medaka was detected by RT-qPCR. Figure 6 As shown in the figure, the expression level of org gene increases slightly from the single-cell stage to the blastocyst stage, and reaches the highest value in the blastocyst stage, after which the expression level of org mRNA decreases rapidly, and the expression of org gene is almost undetectable during the organogenesis period. In this example, we explored the expression pattern of org gene in the early embryo of medaka, and the expression pattern of maternal effect gene nmp2 was consistent, with abundant expression in the early zygotic gene activation stage and rapid degradation during the transition from maternal to zygotic genetic control.

[0091] The process of embryonic development after knocking out the org gene in the present invention is consistent with the developmental phenotype after knocking out the maternal effect genes nmp2 and foxr1, and the expression patterns of the org gene and the maternal effect gene nmp2 in the early embryonic development of the sea medaka are consistent, proving that org, as a maternal effect gene, ensures the normal development of the embryo by participating in the activation process of the zygotic gene in the early embryo. The knockout of the org gene causes the activation of the early zygotic genome to fail, and the org gene may be involved in the translation activation of specific maternal mRNA in the early embryo. After knocking out the org gene, the maternal product cannot accumulate before the blastocyst stage, resulting in the embryo failing to transition from maternal control to zygotic control, and the omnipotence of the embryo is destroyed, thereby causing the embryo to die.

[0092] The present invention is not limited to the above specific embodiments, which are only for the purpose of describing the use of the present invention in detail, and production methods and technical details with the same functions also belong to a part of the present invention. In fact, those skilled in the art can find different adjustment schemes according to the above description, and these adjustments are also within the scope of the claims attached hereto.

Claims

1. Maternal effect genes in medaka people The application of sgRNA is characterized in that The nucleotide sequence of the sgRNA is SEQ ID NO.2 or SEQ ID NO.3, and the application is to insert the maternal effect gene of the sea medaka into the people The sgRNA was injected into medaka embryos to regulate the activation process of early embryonic zygotic genes.

Images