Application of mutant zebrafish in establishing animal models of coagulation disorders

Abstract

The present invention belongs to the field of biotechnology and specifically relates to the use of mutant zebrafish in preparing animal models for coagulation disorders. The present invention uses CRISPANT technology to construct a zebrafish model with the adcyap1b gene knocked out. The adcyap1b mutant zebrafish exhibit severe bleeding and coagulation disorders. Furthermore, detection of the expression of coagulation factors and genes involved in the anticoagulation and fibrinolytic systems in the adcyap1b mutant zebrafish revealed that transcripts related to coagulation factor V, coagulation factor IX, anticoagulant protein C, and plasminogen, a member of the fibrinolytic system, were significantly downregulated. The adcyap1b mutant zebrafish provided by the present invention may serve as an animal model for coagulation disorders, laying a solid foundation for studying the relationship between adcyap1b gene mutations and the pathogenesis of coagulation disorders and for screening antithrombotic drugs.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to the application of mutant zebrafish in preparing animal models of coagulation dysfunction diseases. Background Art

[0002] CRISPR-Cas gene editing technology is a technique for editing genes at specific sites. Using CRISPR-Cas technology to introduce a target gene at a specific site can restore normal function in cells with genetic defects, or introduce disease-related genes into normal cells to construct corresponding disease models. Studies have found that using multiple sgRNAs to target the same gene can maximize editing efficiency, and this method has been named CRISPANT technology. Hematologic diseases are mostly caused by gene mutations. CRISPANT technology can be used to study the genetic background of human blood diseases, correct pathogenic mutant genes, and discover more genes related to the prognosis of blood diseases, with the hope of curing blood malignancies. Furthermore, personalized blood disease models that are closer to human physiology can be constructed, which is also conducive to new drug development trials.

[0003] Pituitary adenylate cyclase-activating polypeptide (PACAP) is a multipotent neuropeptide highly conserved among vertebrates and widely distributed in the mammalian central nervous system. It plays a variety of physiological roles, including regulating neurotransmission, immunity, development, and differentiation. Studies have demonstrated the importance of PACAP as a vasoactive neuropeptide in several neurological diseases. PACAP belongs to the vasoactive intestinal peptide (VIP) / secretin / glucagon family. It is derived from alternative splicing of a precursor and is produced in two biologically active amidated forms: PACAP27 and PACAP38. The effects of PACAP are mediated through three major receptors: the PAC1 receptor (PAC1R), the VPAC1 receptor (VPAC1R), and the VPAC2 receptor (VPAC2R), all of which belong to the G protein-coupled receptor group. Expression of PACAP isoforms and their receptors has been observed in the central nervous system and is also expressed in peripheral organs, including blood vessels. One of PACAP's primary functions is to regulate vasodilation and edema in the vascular system. It affects the relaxation of vascular smooth muscle, leading to vasodilation and increased blood flow. The vasodilatory effects of PACAP have been demonstrated in a variety of animal models, including mice, rats, and humans. Furthermore, PACAP has been implicated in angiogenesis (i.e., the formation of new blood vessels). PACAP has been identified as an inhibitor of megakaryocyte production and platelet activation.

[0004] Zebrafish, with their coagulation systems highly similar to mammalian ones, are a widely used model for studying hemostasis and coagulation. In zebrafish, the PACAP gene (adcyap1) has undergone duplication, resulting in two copies: adcyap1a, encoding PACAP1, and adcyap1b, encoding PACAP2. adcyap1b mRNA is primarily expressed in the brain. However, it remains unclear whether the zebrafish adcyap1b gene affects coagulation function and whether mutations lead to altered coagulation. Summary of the Invention

[0005] The purpose of the present invention is to make up for the deficiencies of the prior art and provide an application of mutant zebrafish in preparing an animal model of coagulation dysfunction diseases.

[0006] In order to solve the above problems, the present invention provides the use of mutant zebrafish in preparing an animal model of coagulation dysfunction disease, characterized in that the mutant zebrafish is an adcyap1b mutant zebrafish.

[0007] Preferably, the adcyap1b mutant zebrafish is a zebrafish adcyap1b gene exon 2 in which bases 207 to 222 are deleted and TGGGAC is inserted;

[0008] Alternatively, bases 208 to 233 in exon 2 of the zebrafish adcyap1b gene are deleted and TAGGT is inserted.

[0009] Preferably, the adcyap1b mutant zebrafish exhibits symptoms including reduced expression of coagulation factor V, coagulation factor IX, anticoagulant protein C, and plasmin.

[0010] Preferably, the plasmin is a plasmin of the fibrinolytic system.

[0011] Preferably, the coagulation disorder is caused by abnormal expression of the adcyap1b gene.

[0012] Preferably, the adcyap1b mutant zebrafish is prepared by the following method:

[0013] The mixture of sgRNA combination and Cas9 protein is injected into zebrafish fertilized eggs, and embryos with effective knockout are selected and cultured to adult fish to obtain F0 generation mutant zebrafish;

[0014] hybridizing the F0 generation mutant zebrafish with wild-type zebrafish to obtain F1 generation embryos, screening the F1 generation embryos for mutant embryos, and culturing them to adult fish to obtain the adcyap1b mutant zebrafish;

[0015] The sgRNA combination includes sgRNA1, sgRNA2, sgRNA3 and sgRNA4; the nucleotide sequences of sgRNA1, sgRNA2, sgRNA3 and sgRNA4 are shown as SEQ ID NO.1 to SEQ ID NO.4, respectively.

[0016] Preferably, the concentration of the sgRNA combination in the mixture of sgRNA combination and Cas9 protein is 200 ng / μL, and the concentration of Cas9 protein is 400 ng / μL.

[0017] Preferably, the method for selecting an effective knockout embryo comprises the following steps:

[0018] Fertilized eggs developed to 24 hpf were taken and genomic DNA was prepared;

[0019] Using the genomic DNA as a template, PCR amplification is performed using upstream amplification primers and downstream amplification primers to obtain a PCR amplification product;

[0020] The PCR amplification product is compared with the wild-type adcyap1b gene. If the amplification results are different, the fertilized egg that develops to 24 hpf is an effective knockout embryo;

[0021] The upstream amplification primer includes the nucleotide sequence shown as SEQ ID NO.5; the downstream amplification primer includes the nucleotide sequence shown as SEQ ID NO.6.

[0022] Preferably, the PCR amplification program is: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, 35 cycles; final extension at 72°C for 10 min.

[0023] Beneficial effects

[0024] The present invention uses CRISPANT technology to construct a zebrafish model in which the adcyap1b gene (an ortholog of mammalian PACAP) is knocked out. The adcyap1b mutant zebrafish exhibits severe bleeding and coagulation disorders. Furthermore, detection of the expression of coagulation factors and genes involved in the anticoagulation and fibrinolysis systems in the adcyap1b mutant zebrafish revealed that transcripts related to coagulation factor V, coagulation factor IX, anticoagulant protein C, and plasminogen of the fibrinolysis system were significantly downregulated. The adcyap1b mutant zebrafish provided by the present invention serves as an animal model for coagulation dysfunction diseases, laying a good foundation for studying the relationship between adcyap1b gene mutation and the pathogenesis of coagulation dysfunction diseases and for screening antithrombotic drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0026] Figure 1 This is the sequencing result of the sgRNA quality prepared by in vitro synthesis in step 3 of Example 1;

[0027] Figure 2 This is the electrophoresis result of the genomic DNA fragment amplified in step 2 of Example 1;

[0028] Figure 3 This is the electrophoresis result of the genomic DNA fragment amplified in step 2 of Example 2;

[0029] Figure 4 The sequence differences between the F1 generation sibling fish and the two adcyap1b mutant lines in Example 2 are shown. The red underlined sequence indicates the CRISPR / Cas9 target site in adcyap1b, and the bold portion is the protospacer adjacent motif (PAM) sequence.

[0030] Figure 5 The morphological test results of step 2 in Example 3; wherein B is the morphological test results of adult (3-month-old) F1 generation sibling fish and two adcyap1b mutant lines; C is the morphological test results of juvenile (72 hpf) F1 generation sibling fish and two adcyap1b mutant lines;

[0031] Figure 6 The figure shows the results of OD staining of a 72 hpf zebrafish embryo in step 3 of Example 3; from left to right are a side view of the head and yolk sac region of a live embryo, a ventral view of the head and yolk sac region of a live embryo, and a side view of the tail of a live embryo. Black arrows indicate locations where abnormal accumulation of hemoglobin was detected in the head, tail, and yolk sac regions.

[0032] Figure 7 This is a quantitative graph of hemoglobin blood in zebrafish 72 hpf embryos in step 3 of Example 3;

[0033] Figure 8 The RNA-seq results of 48 hpf of the sibling fish and adcyap1b mutant in Example 3 are shown; wherein A is the number of genes expressed in the sibling fish and adcyap1b mutant at 48 hpf; B is the GO functional analysis result of DEGs expressed in adcyap1b (Δ16, +6) mutant zebrafish embryos; C is the GO functional analysis result of DEGs expressed in adcyap1b (Δ26, +5) mutant zebrafish embryos;

[0034] Figure 9This is the RT-qPCR test result of step 5 in Example 3. DETAILED DESCRIPTION

[0035] The present invention provides use of a mutant zebrafish in preparing an animal model of a coagulation disorder disease, characterized in that the mutant zebrafish is an adcyap1b mutant zebrafish.

[0036] In the present invention, the adcyap1b mutant zebrafish is preferably a zebrafish adcyap1b gene exon 2 in which bases 207 to 222 are deleted and TGGGAC is inserted, i.e., starting from 207 bp, a 16 bp fragment is knocked out and a 6 bp fragment is inserted in situ, which is recorded as an adcyap1b (Δ16, +6) mutant, and the knocked-out fragment is specifically GCACGCCTATTGGGAT (SEQ ID NO. 7);

[0037] Alternatively, preferably, bases 208 to 233 in exon 2 of the zebrafish adcyap1b gene are deleted and TAGGT is inserted, that is, starting from 208bp, a 26bp fragment is knocked out and 5bp is inserted in situ, which is recorded as the adcyap1b (Δ26, +5) mutant. The specific knocked-out fragment is CACGCCTATTGGGATGACTTTTCCCA (SEQ ID NO. 8).

[0038] In the present invention, the genomic DNA sequence of the adcyap1b gene has an NCBI accession number of 335625. The adcyap1b mutant zebrafish provided by the present invention can be stably inherited, and phenotypic observation is not limited by time, and gene screening can be performed quickly and in large quantities.

[0039] In the present invention, the adcyap1b mutant zebrafish exhibits symptoms including decreased expression of coagulation factor V, coagulation factor IX, anticoagulant protein C, and plasmin. The plasmin of the present invention is preferably a plasmin of the fibrinolytic system.

[0040] In the present invention, the coagulation dysfunction disease preferably includes diseases of abnormal coagulation and hemostasis function. The coagulation dysfunction disease of the present invention is preferably caused by abnormal expression of the adcyap1b gene.

[0041] In the present invention, the adcyap1b mutant zebrafish is prepared by the following method:

[0042] The mixture of sgRNA combination and Cas9 protein is injected into zebrafish fertilized eggs, and embryos with effective knockout are selected and cultured to adult fish to obtain F0 generation mutant zebrafish;

[0043] hybridizing the F0 generation mutant zebrafish with wild-type zebrafish to obtain F1 generation embryos, screening the F1 generation embryos for mutant embryos, and culturing them to adult fish to obtain the adcyap1b mutant zebrafish;

[0044] The sgRNA combination includes sgRNA1, sgRNA2, sgRNA3 and sgRNA4; the nucleotide sequences of sgRNA1, sgRNA2, sgRNA3 and sgRNA4 are shown as SEQ ID NO.1 to SEQ ID NO.4, respectively.

[0045] In the present invention, a mixture of a sgRNA combination and a Cas9 protein is injected into fertilized zebrafish eggs. In the present invention, the sgRNA combination includes sgRNA1, sgRNA2, sgRNA3, and sgRNA4; the nucleotide sequences of sgRNA1, sgRNA2, sgRNA3, and sgRNA4 are shown in SEQ ID NOs. 1 to 4, respectively. Specific sequence information is shown in Table 1.

[0046] The present invention analyzes the functional domain of the zebrafish adcyap1b gene, selects four sgRNA binding sites for exon 2 of the zebrafish adcyap1b gene, designs corresponding sgRNA primers, and synthesizes sgRNA, which can edit the zebrafish adcyap1b gene. The results of the embodiment show that, using the sgRNA combination, the 16bp fragment can be replaced with a 6bp fragment starting from 207bp on the second exon of the zebrafish adcyap1b gene, that is, the 16bp fragment can be knocked out, and 6bp can be inserted in situ, which is recorded as -16bp+6bp. The knocked-out fragment is shown in SEQ ID NO.7; the 26bp fragment can also be replaced with a 5bp fragment starting from 208bp on the second exon of the zebrafish adcyap1b gene, that is, the 26bp fragment can be knocked out, and 5bp can be inserted in situ, which is recorded as -26bp+5bp. The knocked-out fragment is specifically shown in SEQ ID NO.8; the 10bp fragment can also be knocked out from 200bp on the second exon of the zebrafish adcyap1b gene, which is recorded as -10bp. The knocked-out fragment is shown in SEQ ID NO. NO.9, specifically GCACGCCTAT; it is also possible to replace the 8bp fragment with a 13bp fragment starting from 199bp on the second exon of the zebrafish adcyap1b gene, that is, to knock out the 8bp fragment and insert 13bp in situ, hereinafter recorded as -8bp+13bp, the knocked-out fragment is specifically GCCTACTG, and the inserted fragment is as shown in SEQ ID NO.10, specifically ACTACAGCGCCTA.

[0047] In the present invention, the concentration of the sgRNA combination in the mixture of the sgRNA combination and the Cas9 protein is preferably 200 ng / μL, and the concentration of the Cas9 protein is preferably 400 ng / μL; the concentration ratio of sgRNA1, sgRNA2, sgRNA3 and sgRNA4 in the mixture of the sgRNA combination and the Cas9 protein is preferably 1:1:1:1.

[0048] After the injection is completed, the present invention selects embryos with effective knockout. In the present invention, the method for selecting embryos with effective knockout preferably comprises the following steps: preparing genomic DNA from fertilized eggs that have developed to 24 hpf; performing PCR amplification using the genomic DNA as a template and upstream and downstream amplification primers to obtain a PCR amplification product; and comparing the PCR amplification product with the wild-type adcyap1b gene. If the amplification results are different, the fertilized eggs that have developed to 24 hpf are embryos with effective knockout.

[0049] The present invention preferably uses a zebrafish genotyping kit to prepare genomic DNA. More preferably, 24 hpf fertilized eggs are mixed with the buffer in the zebrafish genotyping kit and reacted to obtain the genomic DNA. In the present invention, the reaction conditions are preferably 65°C for 30 minutes, 95°C for 5 minutes, 16°C for 1 minute, and storage at 4°C. The ratio of 24 hpf fertilized eggs to buffer is preferably 2 eggs: 20 μl. The zebrafish genotyping kit is preferably purchased from Nanjing Yaoshunyu Biotechnology Co., Ltd.

[0050] After obtaining the genomic DNA, the present invention preferably uses the genomic DNA as a template to perform PCR amplification using upstream and downstream amplification primers to obtain a PCR amplification product. In the present invention, the upstream amplification primer preferably includes the nucleotide sequence shown in SEQ ID NO. 5; the downstream amplification primer preferably includes the nucleotide sequence shown in SEQ ID NO. 6.

[0051] In the present invention, the PCR amplification procedure is preferably as follows: initial denaturation at 95°C for 3 minutes; 35 cycles of denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 30 seconds; and final extension at 72°C for 10 minutes. The PCR amplification system preferably comprises, in a 25 μl volume, 1 μl of upstream primer, 1 μl of downstream primer, 15 μl of 2× Mastermix, 2 μl of genomic DNA, and the remainder of ultrapure water. The concentration of both the upstream and downstream primers is preferably 5 μM.

[0052] After obtaining the PCR amplification product, the present invention compares the PCR amplification product with the wild-type adcyap1b gene. If the amplification results are different, the fertilized egg that develops to 24 hpf is an effectively knocked-out embryo.

[0053] After obtaining the effective knockout embryos, the present invention cultured the effective knockout embryos to adulthood to obtain F0 generation mutant zebrafish; the F0 generation mutant zebrafish were hybridized with wild-type zebrafish to obtain F1 generation embryos, and embryos with the mutation were screened and cultured to adulthood to obtain the adcyap1b mutant zebrafish, which were designated as the F1 generation. The method for screening embryos with the mutation in the present invention is preferably the same as the method for screening embryos with the effective knockout, and will not be described in detail here.

[0054] In the embodiment of the present invention, zebrafish with mutation types of -16bp+6bp and -26bp+5bp were used as adcyap1b mutant zebrafish to test the coagulation performance and serve as an animal model for preparing coagulation dysfunction diseases.

[0055] To further illustrate the present invention, the application of the mutant zebrafish provided by the present invention in preparing an animal model of coagulation dysfunction disease is described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0056] Unless otherwise specified, all raw materials used in the examples of the present invention can be obtained from commercial sources.

[0057] Example 1

[0058] Step 1: Crispant strategy knockdown target site design and PCR detection primers

[0059] The genomic DNA sequence of the zebrafish adcyap1b gene (accession number 335625) was searched in the NCBI database, and the functional domains were analyzed to design the target site of the zebrafish adcyap1b gene. Finally, it was determined that the target site of the knockout gene was located in exon 2 of the zebrafish adcyap1b gene. PCR amplification primers and sequencing primers were designed based on exon 2 of the adcyap1b gene, as shown in Table 1.

[0060] Table 1 Designed sgRNA and primer sequences

[0061]

[0062]

[0063] Step 2: Genotype confirmation of target gene

[0064] (1) Preparation of genomic DNA template

[0065] A 24 hpf wild-type zebrafish embryo was placed in a 200 ml PCR tube, the water was aspirated, and 10 μl of buffer (Nanjing Yaoshunyu Biotechnology Co., Ltd.) was added to the PCR tube; the reaction conditions were: 65°C for 30 min, 95°C for 5 min, 16°C for 1 min, and stored at 4°C.

[0066] (2) PCR amplification and detection

[0067] PCR reaction system (30 μl): 15 μl of 2×Mastermix, 11 μl of ultrapure water, 1 μl of adcyap1b-E2-F1 (5 μM), 1 μl of adcyap1b-E2-R1 (5 μM) and 2 μl of genomic DNA template obtained in step (1).

[0068] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s; final extension at 72°C for 10 min, and storage at 4°C.

[0069] 2 μl of PCR amplified product was subjected to agarose gel electrophoresis (1%). Figure 2 As shown. Lane 1 in the left image is a DNA marker; from bottom to top, the following sequences are: 100bp, 250bp, 500bp, 750bp, 1000bp, 2000bp, 3000bp, and 5000bp. Lane 2 is the adcyap1b-E2-F1 / R1 amplification product, with a size of 631bp. The sequences in Table 1 of the present invention can amplify complete genomic DNA sequences with single, undetectable bands.

[0070] Step 3: sgRNA in vitro synthesis and quality control

[0071] (1) In vitro synthesis of primers for sgRNA expression constructs

[0072] According to the sgRNA sequence designed in Table 1, the forward primer for synthesizing sgRNA was designed. The specific sequence is shown in Table 2.

[0073] Table 2 Forward primers for synthesizing sgRNA

[0074]

[0075] Note: The bold part is the T7 promoter part, and the lowercase letters are part of the sgRNA backbone template sequence.

[0076] The reverse primers for synthesizing adcyap1b-sgRNA1 to adcyap1b-sgRNA4 were all universal primers R-Common, with the nucleotide sequence: 5'-AAAAAAAGCACCGACTCGGTGCCAC-3' (SEQ ID NO. 17)

[0077] (2) PCR amplification and synthesis of sgRNA

[0078] Configure 4 PCR reaction systems:

[0079] PCR reaction system 1: 40 μl of 2× Mastermix, 35 μl of ultrapure water, 2 μl of adcyap1b-sgRNA1-F (5 μM), 2 μl of reverse primer R-Common (5 μM), and 1 μl of pYSY-sgRNA plasmid (10 ng / μl, pYSY-sgRNA plasmid purchased from Nanjing Yaoshunyu Biotechnology Co., Ltd., the same below);

[0080] PCR reaction system 2: 40 μl of 2× Mastermix, 35 μl of ultrapure water, 2 μl of adcyap1b-sgRNA2-F (5 μM), 2 μl of reverse primer R-Common (5 μM), and 1 μl of pYSY-sgRNA plasmid;

[0081] PCR reaction system 3: 40 μl of 2× Mastermix, 35 μl of ultrapure water, 2 μl of adcyap1b-sgRNA3-F (5 μM), 2 μl of reverse primer R-Common (5 μM), and 1 μl of pYSY-sgRNA plasmid;

[0082] PCR reaction system 4: 2×Mastermix 40 μl, 35 μl ultrapure water, 2 μl adcyap1b-sgRNA4-F (5 μM), 2 μl reverse primer R-Common (5 μM) and 1 μl pYSY-sgRNA plasmid.

[0083] The PCR reaction procedures for reaction systems 1 to 4 were: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s; final extension at 72°C for 10 min, and storage at 4°C.

[0084] (3) PCR product purification (nuclease-free treatment)

[0085] The PCR products obtained in step (2) were collected using a nuclease-free PCR clean up kit (purchased from Axygen), and the recovery solvent was ultrapure water free of nuclease contamination.

[0086] The product after PCR amplification and purification using reaction system 1 was recorded as sample 1, the product after PCR amplification and purification using reaction system 2 was recorded as sample 2, the product after PCR amplification and purification using reaction system 3 was recorded as sample 3, and the product after PCR amplification and purification using reaction system 4 was recorded as sample 4.

[0087] (4) In vitro transcription of sgRNA

[0088] Samples 1 to 4 obtained in step (3) were transcribed in vitro using T7 RNA polymerase. An RNA in vitro transcription kit (MAXIscript T7, Ambion, USA) was used. According to the kit instructions, 4 μl of 10× Transcription Buffer, 2 μl of 10 mM ATP, 2 μl of 10 mM CTP, 2 μl of 10 mM GTP, 2 μl of 10 mM UTP, 4 μl of T7 RNA polymerase mix, and 24 μl of template DNA were added in sequence. The mixture was gently flicked and centrifuged, and then incubated in a 37°C water bath for 3 h.

[0089] 1.5 μl of DNase I (Ambion, USA) was added and incubated in a 37°C water bath for 15 min to remove the template.

[0090] Then, 160 μl of DEPC water was added to expand the volume to 200 μl. 20 μl of nuclease-free 3M sodium acetate (pH 5.2) and 3 volumes of anhydrous ethanol (Sanggong) were added, and precipitation was carried out at -80°C overnight. Centrifugation was carried out at 12,000g for 20 min at 4°C. After removing the supernatant, nuclease-free 75% ethanol was added and centrifuged at 12,000g for 20 min at 4°C. After removing the supernatant, the precipitate was dried in a fume hood and then resuspended in 20 μl of nuclease-free ultrapure water to obtain sgRNA1, sgRNA2, sgRNA3, and sgRNA4, which were stored in a -80°C refrigerator for future use.

[0091] (5) sgRNA quality identification

[0092] 1 μl of sgRNA1, sgRNA2, sgRNA3, and sgRNA4 obtained in step (4) of PCR were subjected to agarose gel electrophoresis (1%). After the band size was confirmed by electrophoresis, all positive amplification products were sent to a commercial company (Beijing Ruibo Xingke Biotechnology Co., Ltd.) for sequencing. The sequencing primers were adcyap1b-E2-F2 / R2 in Table 1. The sequencing results were as follows: Figure 1As shown, the red box indicates an Indel mutation near the CRISPR. Sequencing results corresponding to the validated sgRNAs were compared with the wild-type sequence (https: / / tide.nki.nl / ), yielding relative activity values. The activities of sgRNAs 1 to sgRNA 4 were 50.1%, 39.4%, 31.5%, and 58.2%, respectively.

[0093] Example 2

[0094] Step 1: Microinjection of zebrafish fertilized eggs

[0095] Zebrafish fertilized eggs were collected according to conventional methods, and sgRNA1, sgRNA2, sgRNA3, and sgRNA4 obtained in Example 1 were mixed at equal concentrations to obtain an sgRNA combination; the sgRNA combination (final concentration of approximately 200 ng / μl) and Cas protein (final concentration of 400 ng / μl) were mixed and microinjected into zebrafish fertilized eggs at an injection volume of 1 nl per embryo.

[0096] Step 2: Confirmation of the efficiency of sgRNA-guided Cas9 targeting and cutting the target genomic DNA sequence

[0097] (1) Preparation of target genomic DNA template

[0098] When the embryos injected in step 1 developed to 24 hpf, 4 single embryos were randomly selected to prepare genomic DNA templates. Genomic DNA was prepared using a zebrafish genotyping kit (purchased from Nanjing Yaoshunyu Biotechnology Co., Ltd.);

[0099] The specific reaction conditions were: 65°C for 30 min, 95°C for 5 min, 16°C for 1 min, and storage at 4°C.

[0100] (2) PCR detection

[0101] PCR amplification was performed using the primer pair adcyap1b-E2-F1 / R1 in Table 1 and the genomic DNA obtained in step (1) as a template. The specific reaction system and reaction procedure are as follows:

[0102] PCR reaction system (30 μl): 15 μl of 2×Mastermix, 11 μl of ultrapure water, 1 μl of adcyap1b-E2-F1 (5 μM), 1 μl of adcyap1b-E2-R1 (5 μM) and 2 μl of genomic DNA template obtained in step (1).

[0103] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s; final extension at 72°C for 10 min, and storage at 4°C.

[0104] (3) Detection and sequencing of amplified products

[0105] 2 μl of the PCR amplified product in step (2) was subjected to agarose gel electrophoresis (1%). The results were as follows: Figure 3 As shown. Figure 3 It can be seen that after PCR amplification using the genomic DNA extracted from the four single embryos as a template, a single band was obtained, which was a positive amplification product;

[0106] All the positive amplification products were sent to a commercial company for sequencing. The sequencing results showed that sgRNA2 was the only active sgRNA among the four sgRNAs.

[0107] Step 3: Inheritability evaluation of the F0 generation of zebrafish adcyap1b knockdown using the Crispant strategy

[0108] After the positive embryos obtained in step 2 mature, the F0 generation zebrafish with targeted knockout of the adcyap1b gene are obtained. The male and female F0 generation zebrafish are separated and, after waiting for 1 week, mated with TU wild-type zebrafish in a one-to-one relationship. The genomic DNA of the offspring is amplified and sequenced by PCR according to steps (2) to (3) in step 2. The genotype of the offspring embryos of F0 and TU wild-type zebrafish is identified to screen out the positive heritable F0 of the adcyap1b genome editing mutant.

[0109] Step 4. Breeding and raising candidate F1 mutant zebrafish

[0110] The positive F0 zebrafish screened in step 3 were mated with the wild-type zebrafish strain Tuebingen (TU, originating from the Streisinger Lab). The F1 embryos were then raised as usual until they were over 2 months old and genotyped to screen for gene-edited mutants. The specific steps are as follows:

[0111] (1) Preparation of candidate F1 mutant genomic DNA template

[0112] a. Tissue sampling

[0113] Take 2-3 month old F1 adult fish, cut part of the tail fin tissue, put them into 200 μl PCR tubes in order, and quickly store them on ice.

[0114] b. Preparation of genomic template DNA

[0115] 10 μl of YSY buffer (Nanjing Yaoshunyu Biotechnology Co., Ltd.) was added to a 200 μl PCR tube containing the tail fin tissue. After rapid centrifugation, the PCR tube was placed in a PCR instrument and the following reaction was performed: 65°C for 30 min, 95°C for 5 min, 16°C for 1 min, and 4°C for 2 min.

[0116] (2) PCR amplification of genomic DNA fragments

[0117] PCR amplification was performed using the primers in Table 1 (adcyap1b-E2-F2 / R2) and the genomic DNA obtained in step b as a template. The specific reaction system and reaction procedure are as follows:

[0118] PCR reaction system (30 μl): 15 μl of 2×Mastermix, 11 μl of ultrapure water, 1 μl of adcyap1b-E2-F1 (5 μM), 1 μl of adcyap1b-E2-R1 (5 μM) and 2 μl of genomic DNA template obtained in step (1).

[0119] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min; 35 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s; final extension at 72°C for 10 min, and storage at 4°C.

[0120] (3) Screening and identification of F1 mutants carrying the adcyap1b mutant allele

[0121] PCR products of genomic DNA from 16 F1 zebrafish were selected and sent to a commercial company (Beijing Ruibo Xingke Biotechnology Co., Ltd.) for direct Sanger sequencing. The results screened out 9 zebrafish (F1) with adcyap1b frameshift heterozygous mutations and 4 mutants. The zebrafish numbers and mutation types are shown in Table 3, and the specific sequence sequencing results of the 4 mutation types are shown in Table 4.

[0122] Table 3 Mutation types of mutants

[0123] Zebrafish number Mutation type 1、2、13 wild 3、6、9 -10bp 4、5 -16+6bp 7、14、16 -26+5bp 15 -8+13bp (pure)

[0124] Table 4 Partial genome sequence and predicted protein sequence

[0125]

[0126]

[0127] Note: The bold part is the base sequence deleted in the mutant compared to the wild type, and the _ part is the base sequence inserted in the mutant compared to the wild type.

[0128] As shown in Table 4, compared with the wild type, the F1 generation zebrafish numbered 3, 6 and 9 had a (-10 bp) frameshift mutation starting from 220 bp of exon 2 of the zebrafish adcyap1b gene, and the resulting mutant zebrafish were recorded as adcyap1b (Δ10) mutants; the F1 generation zebrafish numbered 4 and 5 had a (-16+6 bp) frameshift mutation starting from 207 bp of exon 2 of the zebrafish adcyap1b gene, and the resulting mutant zebrafish were recorded as adcyap1b (Δ16, +6) mutants. Compared with the wild type, the F1 generation zebrafish numbered 7, 14 and 16 had a (-26+5bp) frameshift mutation starting from 208bp of the second exon of the zebrafish adcyap1b gene, and the resulting mutant zebrafish were recorded as adcyap1b(Δ26,+5) mutants; the F1 generation zebrafish numbered 15 had a (-8+13bp) frameshift mutation starting from 199bp of the second exon of the zebrafish adcyap1b gene, and the resulting mutant zebrafish were recorded as adcyap1b(Δ8,+13) mutants. Partial structures and sequences of wild-type siblings, adcyap1b(Δ16,+6) mutants and adcyap1b(Δ26,+5) mutants show the target sites of sgRNA as shown in Figure 2. Figure 4 shown.

[0129] Step 5. Breeding and raising candidate F2 mutant zebrafish

[0130] The positive F1 zebrafish adcyap1b (Δ16, +6) mutant and adcyap1b (Δ26, +5) screened in step 4 were mated separately, and then the F2 embryos were raised as usual until they were over 2 months old and genotyped to screen gene-edited mutants. The specific steps were as described in steps 4 (1) to (2).

[0131] (3) Screening and identification of F2 mutants carrying the adcyap1b mutant allele

[0132] Taking the adcyap1b(Δ21, +5) mutant as an example, PCR products from genomic DNA of 12 F2 zebrafish were sent to a commercial company (Beijing Ruibo Xingke Biotechnology Co., Ltd.) for direct Sanger sequencing. Two zebrafish (F2) with heterozygous adcyap1b frameshift mutations were identified. The zebrafish number, mutation type, and detailed sequencing results are shown in Table 5.

[0133] Table 5 Sequencing results of some genome sequences and predicted encoded protein sequences

[0134]

[0135] Note: The bold part is the base sequence deleted in the mutant compared to the wild type, and the _ part is the base sequence inserted in the mutant compared to the wild type.

[0136] It can be seen from Table 5 that the adcyap1b mutant zebrafish provided by the present invention can be stably inherited.

[0137] Example 3

[0138] 1. Materials and Methods

[0139] The wild-type zebrafish strain used was the Tuebingen strain (abbreviated as TU, originated from the Streisinger Lab), and the mutants were the adcyap1b (Δ16, +6) mutant and adcyap1b (Δ26, +5) mutant obtained in Example 2;

[0140] Since the female fish of the adcyap1b (Δ10) mutant and adcyap1b (Δ8, +13) mutant obtained in Example 2 could not survive and only male fish were present, which could not mate, the adcyap1b (Δ10) mutant and adcyap1b (Δ8, +13) mutant were not reared or functionally identified in this example.

[0141] The zebrafish were reared and bred according to the standard protocol of the Organization for Economic Cooperation and Development (OECD) guidelines and the Zebrafish breeding in the laboratory environment published by Andrzej Nasiadka et al.

[0142] 2. Morphological evaluation

[0143] The morphology of the zebrafish larvae in step 1 was observed under a stereomicroscope for daily monitoring. To quantify the growth and development of the larvae, the distance from the center of one eye to the tip of the tail bud was used as the body length. After obtaining the morphological imaging results, the body length was measured and quantitatively analyzed using ImageJ software. The results are shown in the figure below. Figure 5 and as shown in Table 6.

[0144] Table 6 Zebrafish body length (mm)

[0145]

[0146]

[0147] according to Figure 5 As can be seen from Table 6 , the body lengths of sibling fish and the two adcyap1b mutant lines ( n ≥ 12) were not statistically significant (ns), *p < 0.05.

[0148] 3. O-Dianisidine staining

[0149] Transfer the zebrafish 72hpf embryos to a 6-well cell culture plate containing 600mL of staining solution in each well, wrap with tin foil, and allow the 72hpf embryos to undergo a 30-minute staining period under ambient conditions. After staining, shake the culture plate slowly for 30 minutes to ensure sufficient interaction of the staining solution with the embryos. Finally, wash the embryos three times with PBS buffer with a pH range of 7.0-7.5 and observe the staining results. It can be seen that there is an abnormal accumulation of hemoglobin in the head, tail, and yolk sac area ( Figure 6 ), the staining area of ​​the part with abnormal accumulation of hemoglobin was quantitatively determined, and the results were as follows Figure 7 and Table 7.

[0150] Table 7 Bleeding area measurement results

[0151]

[0152]

[0153] According to Table 7 and Figure 7 It can be seen that adcyap1b mutant embryos have bleeding in the tail and yolk sac regions, indicating that loss of adcyap1b function is one of the causes of the bleeding phenotype.

[0154] 4. RNA Sequencing

[0155] 48 hpf embryos of the sibling fish and the two adcyap1b mutant lines in step 1 were collected, carefully washed, and stored in RNAlater (Sigma-Aldrich, USA) to ensure the integrity of the RNA. RNA sequencing was then performed. The results are shown in Figure 2. Figure 8 As shown, according to Figure 8 As can be seen, a total of 5742 differentially expressed genes (DEGs) were identified in the adcyap1b (△16, +6) mutant, and 5709 DEGs were identified in the adcyaps1b (△26, +5) mutant. Figure 8 A). Down-regulated genes are shown in blue relative to sibling fish, and red relative to sibling fish; functional enrichment analysis showed that DEGs were mainly involved in hemostasis, coagulation, vascular development, vascular system development, angiogenesis, vascular morphogenesis, sprouting angiogenesis, bone marrow leukocyte differentiation, blood circulation, circulatory system processes, hematopoietic or lymphoid organ development, and leukocyte differentiation ( Figure 8 This is consistent with the GO terms observed in adcyap1b(△26,+5) mutant embryos.

[0156] 5. RT-qPCR

[0157] To verify the results of RNA sequencing in step 4, quantitative PCR was performed on embryos of adcyap1b mutants and sibling fish. RNA was extracted using TRIzol (Invitrogen, Carlsbad, CA, USA). Subsequently, first-strand cDNA synthesis was performed using the M-MLV Reverse Transcriptase Kit (Promega, Madison, WI, USA). PCR was performed using the Roche LightCycler 96 system (Roche, Switzerland).

[0158] To determine the fold change of gene expression, all measurements were normalized to the expression of the β-actin transcript. The fold change of gene expression was calculated using the ΔCT comparative quantification method (see Jagadeeswaran P, Gregory M, Johnson S, Thankavel B. Haemostatic screening and identification of zebrafish mutants with coagulation pathway defects: an approach to identifying novel hemostatic genes in man. Br J Haematol. 2000; 110: 946-56.10.1046 / j.1365-2141.2000.02284.x.). PCR amplification primer sequences were designed using AlleleID 6.0 (PREMIER Biosoft, California, USA). The specific primer sequences are shown in Table 8. The detection results are shown in Table 8. Figure 9 and Table 9.

[0159] Table 8 Primer sequence information

[0160] Gene PrimerFsequence(5'–3') PrimerRsequence(5'–3') plg AGAGCGAGCAACTGAATC(SEQ ID NO.34) GCCTGTCCAACTTGAGAA(SEQ ID NO.35) f5 ATCTGACTGCCGAACTTG(SEQ ID NO.36) TCCTCTGCCGATTCTCTT(SEQ ID NO.37) f9b AACCGAATACAACACAACAG(SEQ ID NO.38) GCTTCATCTCCTCCTACAAT(SEQ ID NO.39) proca-1 ACGCCTGACATTCTACCC(SEQ ID NO.40) GCTCTGTTAAACATCATTTGGG(SEQ ID NO.41) proca-2 TTGTCCGTAGTGTATGAGTG(SEQ ID NO.42) GAATGAACCGCCAACTTATC(SEQ ID NO.43) β-actin AGGGAAATCGTGCGTGACATCA(SEQ ID NO.44) ACTCATCGTACTCCTGCTTGCTGA(SEQ ID NO.45)

[0161] Table 9 Relative expression of target proteins

[0162]

[0163] according to Figure 9 As can be seen from Table 9 , transcripts related to coagulation factors V and IX, anticoagulant protein C, and plasminogen of the fibrinolytic system were significantly downregulated in adcyap1b mutants compared with sibling fish, indicating the importance of adcyap1b in maintaining normal coagulation and hemostasis.

[0164] Based on the above, it can be seen that compared with wild-type zebrafish, the adcyap1b mutant zebrafish provided by the present invention have significantly downregulated transcripts related to coagulation factor V, coagulation factor IX, anticoagulant protein C, and plasminogen of the fibrinolytic system. The adcyap1b mutant zebrafish provided by the present invention is used as an animal model for coagulation dysfunction diseases, laying a good foundation for studying the relationship between adcyap1b gene mutation and the pathogenesis of coagulation dysfunction diseases and screening anti-thrombotic drugs.

[0165] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. Use of mutant zebrafish in preparing an animal model of coagulation dysfunction disease, characterized in that: The mutant zebrafish is an adcyap1b mutant zebrafish; The adcyap1b mutant zebrafish is a zebrafish adcyap1b gene in which bases 207 to 222 are deleted and TGGGAC is inserted in exon 2; Alternatively, bases 208 to 233 in exon 2 of the zebrafish adcyap1b gene are deleted and TAGGT is inserted.

2. The use according to claim 1, characterized in that The adcyap1b mutant zebrafish exhibits symptoms including reduced expression of coagulation factor V, coagulation factor IX, anticoagulant protein C, and plasmin.

3. The use according to claim 2, characterized in that The plasmin is a plasmin of the fibrinolytic system.

4. The use according to claim 1, characterized in that The coagulation dysfunction disease is caused by abnormal expression of the adcyap1b gene.

5. The use according to any one of claims 1 to 4, characterized in that: The adcyap1b mutant zebrafish is prepared by the following method: The mixture of sgRNA combination and Cas9 protein is injected into zebrafish fertilized eggs, and embryos with effective knockout are selected and cultured to adult fish to obtain F0 generation mutant zebrafish; hybridizing the F0 generation mutant zebrafish with wild-type zebrafish to obtain F1 generation embryos, screening the F1 generation embryos for mutant embryos, and culturing them to adult fish to obtain the adcyap1b mutant zebrafish; The sgRNA combination includes sgRNA1, sgRNA2, sgRNA3 and sgRNA4; the nucleotide sequences of sgRNA1, sgRNA2, sgRNA3 and sgRNA4 are shown as SEQ ID NO.1 to SEQ ID NO.4, respectively.

6. The use according to claim 5, characterized in that In the mixture of sgRNA combination and Cas9 protein, the concentration of sgRNA combination is 200 ng / μL, and the concentration of Cas9 protein is 400 ng / μL.

7. The use according to claim 5, characterized in that The method for selecting effective knockout embryos includes the following steps: Fertilized eggs developed to 24 hpf were taken and genomic DNA was prepared; Using the genomic DNA as a template, PCR amplification is performed using upstream amplification primers and downstream amplification primers to obtain a PCR amplification product; The PCR amplification product is compared with the wild-type adcyap1b gene. If the amplification results are different, the fertilized egg that develops to 24 hpf is an effective knockout embryo; The upstream amplification primer includes the nucleotide sequence shown as SEQ ID NO.5; the downstream amplification primer includes the nucleotide sequence shown as SEQ ID NO.

6.

8. The use according to claim 7, characterized in that The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s, for 35 cycles; and final extension at 72°C for 10 min.

Images