A molecular marker for screening gastric cancer and its specific primer and application

Abstract

The present invention discloses a molecular marker and specific primers for screening gastric cancer and their application, belonging to the field of detection technology. The present invention discloses a molecular marker and specific primers for screening gastric cancer, with the saliva of the patient to be tested as the detection sample, and the sensitivity and specificity are 80% and 82.5% respectively. When the detection value is greater than 1.35, it can be regarded as a high-risk group for gastric cancer, and further screening such as gastroscopy / CT should be performed.

Description

Technical Field

[0001] The present invention relates to the field of detection technology, and in particular to a molecular marker that can be used for screening gastric cancer and its specific primer and application. Background Art

[0002] my country is a country with a high incidence of gastric cancer, and its incidence and mortality rate rank third among all malignant tumors. There are about 1.2 million new cases of gastric cancer each year in the world, of which Chinese patients account for up to 40%. Gastric cancer has a good prognosis if it is discovered in the early stage, and usually more than 90% can be completely cured. However, the treatment effect is poor for larger tumors and / or metastases, and the 5-year survival rate is about 70%. Therefore, early detection of gastric cancer is important.

[0003] However, most gastric cancers are asymptomatic in the early stages, and in many cases, there will be no clear subjective symptoms unless the cancer progresses. Therefore, it is difficult to detect gastric cancer early through subjective symptoms. As subjective symptoms, soft stools, black stools, nausea, stomach discomfort, etc. can be seen as gastric cancer progresses. In addition, as systemic symptoms, fatigue, fever, weight loss, anemia, etc. can be seen. As the disease progresses further, the tumor enlarges, and you will feel a lump in the abdomen. And even after such subjective symptoms appear, patients often tend to put the disease aside, and there are many cases where they are first discovered to be in a state of progression through X-ray photography during a physical examination. Therefore, it is important to develop a detection method that can detect gastric cancer with high sensitivity and accuracy in the early stages. Early diagnosis and early treatment are crucial to improving the prognosis of gastric cancer patients, and finding convenient and reliable biomarkers is a key measure to increase the early diagnosis rate.

[0004] lncRNA ELDR (also known as EGFR long noncoding downstream RNA or Fabl) is a newly discovered lncRNA that was initially reported in a mouse model, but humans also have a corresponding homologous gene. The human ELDR gene is located on chromosome 7, just downstream of the epidermal growth factor receptor (EGFR) gene. However, there are no reports of lncRNA ELDR in gastric cancer. Summary of the invention

[0005] The purpose of the present invention is to provide a molecular marker that can be used to screen gastric cancer and its specific primers and applications, so as to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a molecular marker that can be used for screening gastric cancer. The molecular marker is lncRNA ELDR, and its nucleotide sequence is shown in SEQ ID NO.1.

[0008] The present invention also provides specific primers for detecting the molecular markers.

[0009] Preferably, it consists of an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3.

[0010] The present invention also provides the use of the molecular marker in preparing a product for predicting and / or diagnosing gastric cancer.

[0011] The present invention also provides a product for predicting and / or diagnosing gastric cancer, comprising the specific primers.

[0012] Preferably, the product comprises a reagent or a kit.

[0013] Preferably, the product uses saliva of a patient to be tested as the test sample.

[0014] Preferably, the product uses the molecular marker as the detection target.

[0015] Based on the above technical solution, the present invention has the following technical effects:

[0016] The present invention discloses a molecular marker and specific primers for screening gastric cancer. The sensitivity and specificity of the saliva of the patient to be tested are 80% and 82.5% respectively. When the test value is greater than 1.35, the patient can be regarded as a high-risk group for gastric cancer and further screening such as gastroscopy / CT should be performed. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0018] Figure 1 This is the receiver operating curve for screening suspected gastric cancer patients using salivary lncRNA ELDR. DETAILED DESCRIPTION

[0019] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0020] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0021] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0022] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0023] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0024] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or are publicly available.

[0025] Example 1

[0026] Healthy adults usually produce 500 to 1500 mL of serous and mucous saliva per day, with a basal flow rate of about 0.5 ml per minute. Due to the secretion of major and minor salivary glands, whole saliva is a mixture of oral fluids with a water content of about 99%, including inorganic compounds, organic compounds (volatile, non-protein and lipids), proteins, peptides and hormones. In the present invention, lncRNA ELDR is mainly extracted from unstimulated whole saliva, and its nucleotide sequence is shown in SEQ ID NO.1. Unstimulated whole saliva (UWS) is a mixture of secretions that enter the oral cavity without exogenous stimulation, which depends on the daily basal saliva flow rate in the oral cavity. It is usually preferred to collect unstimulated saliva because this can minimize the dilution of the analyte.

[0027] SEQ ID NO.1:

[0028] aacagagggccgttacactcacagtgtaagaacagactgacaattccagggcgctggcttttatgaaaataggaaacgccacgatgcactctaacgtggagatggggcgccgttcac actgagatgagacaggtggaaaagagagctcgcccttcttgcattgtcacacggagcggccctctccctgtgcagcgtggagtcccctgggcgcgggcgaggctcaggcgggacgcgg cggagaccgagcttgtccctgtgtggacccgggcaactgccggtgggcgaggcctggatggtggccaggccgcagccacccggacgtttgcgagcgccgaaggtgtgtaaaaatcgct ccagtggtgaattggaaactcgcagtgccaggaagtgcttccacaggcttaatgcatctctgctcctcttttttcataaaaattcaaagtgtttagacgggggatgctgagagagaa.

[0029] Sample source: A total of 70 gastric cancer patients and non-tumor patients who underwent surgical treatment in the Department of General Surgery of the General Hospital of PLA from January to October 2023, with an age range of 45-72 years, including 56 males and 14 females.

[0030] Inclusion and exclusion criteria: Inclusion criteria are: 1) patients diagnosed with gastric cancer by preoperative pathology; 2) planned for surgical resection; 3) no other concurrent tumors; Exclusion criteria are: 1) patients with severe autoimmune diseases; 2) patients with concurrent infectious diseases such as hepatitis B.

[0031] 1. Saliva Collection

[0032] Passive salivation and drainage method was used. Participants were asked to avoid eating, drinking or using saliva stimulants one hour before sampling. Participants were instructed to swallow saliva first, then tilt their heads forward and spit saliva into a centrifuge tube for five minutes without swallowing. Saliva samples were frozen at -70°C until analysis. Saliva samples were centrifuged at 4500gm for fifteen minutes. 40 saliva samples were collected from gastric cancer patients and 30 saliva samples were collected from non-tumor patients.

[0033] 2. RNA Reverse Transcription

[0034] Total RNA was isolated using TRIzol reagent (Invitrogen). cDNA was synthesized using random hexamers and Superscript III reverse transcriptase (Thermo Fisher Scientific). qRT-PCR was performed using specific primers using the SYBR green detection system (Thermo Fisher Scientific) according to standard procedures to quantify gene expression. 18SrRNA was used as an endogenous control. Relative gene expression was analyzed by using the 2-ΔΔCT formula (ΔΔCT = ΔCT of sample - ΔCT of untreated control). Each sample was loaded in triplicate.

[0035] The specific primers are:

[0036] FP(SEQ ID NO.2):ACTGAGATGAGACAGGTGGA;

[0037] RP (SEQ ID NO. 3): GAGCGATTTTTACACACCTT.

[0038] 3. Test results

[0039] The relative contents of salivary lncRNA ELDR in gastric cancer patients and control patients are shown in Table 1 .

[0040] Table 1 Relative content of salivary lncRNA ELDR in gastric cancer patients and control patients

[0041]

[0042]

[0043] Construct ROC curve Figure 1 The ROC area under the salivary lncRNA ELDR for screening gastric cancer was 0.87. When the cutoff value was 1.35, the sensitivity and specificity were 80% and 82.5%, respectively. When the detection value was greater than 1.35, it could be considered a high-risk group for gastric cancer and further screening such as gastroscopy / CT should be performed.

[0044] Obviously, the above embodiments of the present invention are merely examples for clearly explaining the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. Use of specific primers of lncRNA ELDR in the preparation of a product for predicting and / or diagnosing gastric cancer, characterized in that: The specific primers consist of an upstream primer as shown in SEQ ID NO.2 and a downstream primer as shown in SEQ ID NO.3; The nucleotide sequence of the lncRNAELDR is shown in SEQ ID NO.1.

Images