Marine xylanase mutant with improved thermostability and application thereof
By truncating 109 amino acids at the C-terminus of xylanase from marine black yeast, a mutant with improved heat resistance, HWxyn11-DC109, was constructed, solving the problem of insufficient xylanase stability and achieving higher thermal stability and enzyme activity, thus expanding its application in the paper, feed, food, and textile industries.
Patent Information
- Application Number
- CN202311459414.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-03
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2043-11-03
AI Technical Summary
Existing xylanases have poor stability in industrial applications, making it difficult to meet production needs.
A heat-resistant marine xylanase mutant, HWxyn11-DC109, was constructed by truncating 109 amino acids from the C-terminus of the xylanase amino acid sequence of marine black yeast. The mutant was then expressed in Pichia pastoris using overlapping PCR and an expression vector.
The mutant HWxyn11-DC109 exhibits significantly improved thermal stability, with the optimal reaction temperature increased to 55℃. After incubation at 55℃ for 60 min, the residual enzyme activity is 58.07%, and the half-life is 4.87 times that of the wild type, thus broadening its application scope in industry.
Smart Images

Figure CN117645988B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering, in particular to a marine xylanase mutant with improved heat resistance and application thereof. BACKGROUND
[0002] Xylanase is a kind of enzyme that can hydrolyze hemicellulose xylan into oligomeric xylose and xylose with different polymerization degrees, and is found in microorganisms, marine algae, protozoa and the like. Endo-β-1,4-xylanase (Endo-β-1,4-xylanase, EC 3.2.1.8) can hydrolyze the β-1,4-linked pyranoside backbone, and is a kind of xylanase that plays the most important role in the xylanase system. According to the characteristics and differences of the amino acid sequence, it can be divided into more than 100 glycoside hydrolase (GH) families. At present, the most commonly used families are GH 5, GH 7, GH 8, GH 10, GH 11 and the like.
[0003] At present, xylanase has potential industrial application and economic value in the fields of food, feed, pulping and papermaking, textile, energy and the like, but has the problem of poor stability in actual application, which is difficult to meet the production and application requirements in industry. The xylanase produced by marine microorganisms is rich in resources and has excellent properties. Therefore, it has important practical significance to mine new xylanase from rich marine microbial resources, to modify it according to the actual application scene and requirements, and to obtain xylanase with application prospect. SUMMARY
[0004] The present application aims to overcome the shortcomings and deficiencies of the prior art, and provides a marine xylanase mutant with improved heat resistance. The mutant is obtained by cutting off 109 amino acids at the C-terminal of the marine xylanase amino acid sequence of Phanerochaete sp.
[0005] Another object of the present application is to provide the application of the marine xylanase mutant with improved heat resistance.
[0006] The object of the present application is achieved by the following technical solutions:
[0007] A marine xylanase mutant with improved heat resistance, named HWxyn11-DC109, has an amino acid sequence as shown in SEQ ID NO. 1.
[0008] A coding gene encoding the marine xylanase mutant with improved heat resistance has a nucleotide sequence as shown in SEQ ID NO. 2.
[0009] An expression vector containing the coding gene.
[0010] The preparation method of the expression vector comprises the following steps:
[0011] a. synthetizing the gene sequence of HWxyn11 artificially and cloning into pPICZαA expression vector;
[0012] b. removing 109 amino acids at the C terminal of the HWxyn11 gene by PCR amplification using overlapping PCR technology;
[0013] c. after the PCR product is digested by restriction endonuclease Dpn I and purified, the expression vector is obtained by transforming into Escherichia coli Top10 competent cells, and sequencing identification is performed.
[0014] The primer sequence used in the PCR of step b is as follows:
[0015] DC109-F: CTCTGTTACCGTCGGTTCTGCCAGCTTTCTAGAACAAAA;
[0016] DC109-R: GTTCTAGAAAGCTGGCAGAACCGACGGTAACAGAG.
[0017] An engineering bacterium, wherein the genome of the engineering bacterium contains the coding gene; preferably, the cell of the engineering bacterium contains the expression vector.
[0018] The preparation method of the engineering bacterium comprises the following steps:
[0019] d. linearizing the expression vector by using restriction endonuclease Sac I, and electrotransforming into host cells;
[0020] e. spreading the transformation liquid on a YPD plate containing Zeocin, and culturing at 30 DEG C for 3 days, and the single yeast colony grown on the plate is the engineering bacterium.
[0021] The host cell of step d is Pichia pastoris X33.
[0022] The preparation method of the marine xylanase mutant with improved heat resistance comprises the following steps:
[0023] f. inoculating the engineering bacterium into BMMY culture medium, inducing culture, centrifuging, collecting the supernatant, and obtaining the marine xylanase mutant after purification.
[0024] The marine xylanase mutant with improved heat resistance is applied to hydrolysis of xylan.
[0025] The marine xylanase mutant with improved heat resistance is applied to papermaking, feed, food and textile industries.
[0026] The application of the engineering bacteria in producing heat-resistant xylanase.
[0027] Compared with the prior art, the application has the following advantages and effects:
[0028] The marine xylanase mutant HWxyn11-DC109 obtained by the application has significantly improved thermal stability, and compared with the wild-type xylanase HWxyn11, the optimal reaction temperature of the mutant is 55 DEG C, the residual enzyme activity is 58.07% after incubation at 55 DEG C for 60 min, while the residual enzyme activity of the wild-type xylanase is only 19.34%, and the half-life of the mutant is 4.87 times that of the wild type. The truncated protein has higher enzyme activity than the full-length protein, and the thermal stability is further improved, which widens the application range of the protein in industry. BRIEF DESCRIPTION OF DRAWINGS
[0029] Figure 1 It is a SDS-PAGE electrophoresis diagram of wild-type xylanase and heat-resistant mutant purified samples of marine Exidia glandulosa EXF-12619 expressed by Pichia pastoris X-33, lane one is protein molecular weight marker, lane two is purified HWxn11, and lane three is purified HWxyn11-DC109.
[0030] Figure 2 It is a result diagram of optimal reaction temperature of wild-type xylanase and mutant of marine Exidia glandulosa EXF-12619 expressed by Pichia pastoris X-33, with temperature plotted against relative enzyme activity (%).
[0031] Figure 3 It is a result diagram of thermal stability (55 DEG C) of wild-type xylanase and mutant of marine Exidia glandulosa EXF-12619 expressed by Pichia pastoris X-33, with temperature plotted against residual enzyme activity (%).
[0032] Figure 4 It is a result diagram of optimal reaction pH of wild-type xylanase and mutant of marine Exidia glandulosa EXF-12619 expressed by Pichia pastoris X-33, with pH plotted against relative enzyme activity (%).
[0033] Figure 5 It is a result diagram of pH stability of wild-type xylanase and mutant of marine Exidia glandulosa EXF-12619 expressed by Pichia pastoris X-33, with pH plotted against residual enzyme activity (%). DETAILED DESCRIPTION
[0034] The application will be further described in conjunction with the following examples and drawings, but the embodiments of the application are not limited thereto.
[0035] In the following examples, if the specific test conditions are not specified, the general test conditions or the test conditions recommended by the reagent company are usually used. If not specified, the materials, reagents, etc. used are reagents and materials obtained from commercial channels.
[0036] Example 1 Construction of eukaryotic expression vector of marine xylanase mutant HWxyn11-DC109
[0037] (1) According to the xylanase HWxyn11 gene of black yeast EXF-12619 in Genbank (GenBank Accession No. KAI6862253.1), the Shanghai Shengong Biological Engineering Company was commissioned to use the artificial synthesis method to optimize the sequence according to the codon bias of Pichia pastoris and remove the signal peptide of the gene itself, and construct it into the pPICZαA vector preserved in the laboratory.
[0038] (2) Using the following primers, the linearized fragment of the xylanase mutant removing the C-terminal 109 amino acids was obtained by PCR amplification with pPICZαA-HWxyn11 plasmid DNA as the template;
[0039] DC109-F: CTCTGTTACCGTCGGTTCTGCCAGCTTTCTAGAACAAAA
[0040] DC109-R: GTTCTAGAAAGCTGGCAGAACCGACGGTAACAGAG
[0041] The PCR amplification conditions were: 98℃ for 3min; 98℃ for 15s, 59℃ for 30s, 72℃ for 100s, 30 cycles; 72℃ for 5min; 4℃ storage. After the PCR amplification product was digested with Dpn I restriction endonuclease at 37℃ for 60min, it was purified using the SanPrep column PCR product purification kit (Shanghai Shengong). The purified product was transformed into E. coli Top10 competent cells, and after sequencing identification by Shengong Biological Engineering (Shanghai) Co., Ltd., a recombinant plasmid containing HWxyn11-DC109 was obtained. The HWxyn11-DC109 amino acid sequence is shown in SEQ ID NO. 1, and the gene sequence is shown in SEQ ID NO. 2.
[0042] Example 2 Expression and purification of xylanase
[0043] The wild-type xylanase HWxynl l and mutant HWxynl l-DC109 expression plasmids were linearized by restriction enzyme Sac I, and the linearized DNA was respectively electroporated into Pichia pastoris X-33 (laboratory preserved) competent cells according to the Pichia pastoris expression manual. The transformation liquid was spread on YPD (containing a final concentration of 100 μg / mL Zeocin) plates, and after 3 days of culture at 30°C, single colonies on the plates were picked and transferred to 50 mL YPD medium, and cultured at 30°C, 250 rpm for 20 h; then transferred to 500 mL BMMY medium, and induced at 29°C, 250 rpm, 0.5% methanol for 108 h. The bacterial bodies were removed by centrifugation at 4°C, 8000 rpm for 25 min, and the supernatant containing xylanase was obtained.
[0044] After the supernatant was filtered through a 0.45 μm filter to remove impurities, it was concentrated to about 80 mL using a 10 kDa membrane bag (Vivaflow 200, Sartorius, Germany). The concentrated liquid was purified using a nickel metal chelate affinity chromatography column (HisTrap HP column, GE Healthcare) at a flow rate of 1 mL / min. The impure proteins were removed using a phosphate buffer containing 20 mM imidazole at pH 7.4, and finally the target protein was eluted using a phosphate buffer containing 500 mM imidazole at pH 7.4. The purified recombinant proteins of xylanase HWxynl l and mutant HWxynl l-DC109 were respectively identified for purity by SDS-PAGE electrophoresis, and the results are shown in FIG. 2. The molecular weight was consistent with the expected value, proving that the purified target protein was obtained. Figure 1
[0045] Example 3 Determination of xylanase enzyme activity
[0046] The xylanase enzyme activity was determined using the 3,5-dinitrosalicylic acid (DNS) method. The enzyme solution was diluted to an appropriate multiple, 20 μL of the diluted enzyme solution was taken, 180 μL of 1% Tsuga xylan solution was added, and the reaction was carried out under the optimal temperature and pH conditions (HWxynl l at 45°C, pH 5.0, and HWxynl l-DC109 at 55°C, pH 5.0) for 5 min. After the reaction, 200 μL of DNS solution was immediately added to a boiling water bath for 10 min, and after cooling to room temperature, 200 μL was added to an enzyme-labeled plate to determine the absorbance value at 540 nm. The standard samples of 0, 0.2, 0.4, 0.6, 0.8, and 1.0 mg / mL xylose solutions were determined for the absorbance values at 540 nm using the DNS method, and the xylose standard curve was plotted with the xylose concentration as the abscissa and the average absorbance value as the ordinate. All experiments were repeated three times.
[0047] One enzyme activity unit is defined as: the amount of enzyme required to produce 1 μmol of reducing sugar (calculated as xylose) per minute under certain reaction conditions is one enzyme activity unit, expressed as U / mL; specific enzyme activity is the ratio of enzyme activity to corresponding protein content, expressed as U / mg.
[0048] The enzyme activity calculation formula is as follows:
[0049] X = c x V1 x 1000 x N / (M x 5 x V2 x C)
[0050] Wherein, X is U, which is xylanase activity (U / mL);
[0051] C is the concentration of xylose generated by hydrolysis reaction (mg / mL), which is obtained by substituting the standard curve;
[0052] V1 is the volume of the reaction system (mL);
[0053] 1000 is a conversion factor, 1 mmol = 1000 μmol;
[0054] N is the dilution multiple of enzyme solution;
[0055] M is the molecular weight of xylose (150.13 mg / mmol);
[0056] 5 is the reaction time (min);
[0057] V2 is the actual volume of the diluted enzyme solution added in the reaction system (mL);
[0058] C is the protein concentration (mg / mL).
[0059] The results show that the specific enzyme activity of the purified wild-type xylanase HWxyn11 is 99.94 ± 2.94 U / mg, and the specific enzyme activity of HWxyn11-DC109 is 126.96 ± 2.34 U / mg.
[0060] Example 4: Determination of optimal temperature and thermal stability of xylanase
[0061] The xylanase activity was determined at 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60℃ and the optimal pH, respectively. The enzyme activity determination reaction system and specific operation refer to Example 3. The effect of temperature on HWxyn11 and HWxyn11-DC109 is expressed as relative enzyme activity, taking the highest enzyme activity as 100%, and calculating the relative enzyme activity of the rest groups. The results are shown in Table 1. Figure 2 As shown in Table 1, the optimal reaction temperature of the wild-type xylanase HWxyn11 is 45℃, and the optimal reaction temperature of the xylanase mutant HWxyn11-DC109 provided by the application is 55℃, which is increased by 10℃ compared with the wild-type xylanase HWxyn11.
[0062] The enzyme solution was incubated at 55°C. After 10, 20, 30, 40, 50, and 60 minutes, appropriate amounts of the enzyme solution were taken to determine their residual enzyme activity. The reaction system and specific procedures for enzyme activity determination are as described in Example 3. The effect of temperature on the stability of HWxyn11 and HWxyn11-DC109 is expressed as relative enzyme activity. The initial enzyme activity was taken as 100%, and the residual enzyme activity of the remaining groups was calculated. The results are as follows: Figure 3 As shown, after incubation at 55℃ for 60 min, the residual enzyme activity of HWxyn11 was only 19.34%; while HWxyn11-DC109 retained 58.07% activity after incubation at 55℃ for 1 h. The experimental results demonstrate that the optimal temperature of the modified HWxyn11-DC109 is significantly increased, and its thermal stability is significantly better than that of wild-type HWxyn11.
[0063] Example 5: Determination of the optimal pH and pH stability of xylanase
[0064] Xylanase activity was determined at pH 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, and 11.0, and at the optimal reaction temperature. The reaction system and specific procedures for the enzyme activity determination were described in Example 3. The pH buffer solutions used were: 50 mM Na₂HPO₄-citric acid (pH 3.0, pH 4.0, pH 5.0), 50 mM potassium phosphate (pH 6.0, pH 7.0), 50 mM Tris-HCl (pH 8.0, pH 9.0), and 50 mM glycine-NaOH (pH 10.0, pH 11.0). The effect of pH on HWxyn11 and HWxyn11-DC109 is expressed as relative enzyme activity, with the highest enzyme activity defined as 100%, and the relative enzyme activities of the remaining groups calculated. Results are as follows: Figure 4 As shown, the optimal pH for the mutant HWxyn11-DC109 is 5.0, consistent with the wild-type xylanase HWxyn11.
[0065] The enzyme solutions were incubated for 24 hours at pH 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, and 11.0, respectively, and their residual enzyme activity was measured. The reaction system and specific operation for enzyme activity measurement are as described in Example 3. The effect of pH on the stability of HWxyn11 and HWxyn11-DC109 is expressed as relative enzyme activity. The residual enzyme activity of the remaining groups was calculated with the initial enzyme activity as 100%. The results are as follows: Figure 5 As shown, both HWxyn11 and HWxyn11-DC109 maintained over 87% viability after 24 hours of incubation at pH 3.0–11.0. These experimental results demonstrate that the pH tolerance of the modified HWxyn11-DC109 is essentially the same as that of the wild-type HWxyn11.
[0066] Example 6 Half-life determination of xylanase
[0067] The enzyme solution was incubated at 55℃ for 60 min, and the residual enzyme activity was determined every 10 min under the optimum conditions. The enzyme activity determination reaction system and specific operation were referred to Example 3. The initial enzyme activity was taken as 100%, and the residual enzyme activity of each group was calculated. The incubation time was taken as the abscissa, and the logarithm of the residual enzyme activity was taken as the ordinate to fit the linear function. The calculation formula of the half-life is as follows:
[0068] t 1 / 2 = ln2 / (-k)
[0069] t 1 / 2 is the half-life;
[0070] k is the slope of the linear fitting function.
[0071] The results show that the half-life of HWxyn11-DC109 is 78.76 min at 55℃, which is 3.43 times that of the wild type HWxyn11, and the thermal stability is significantly improved.
[0072] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited by the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application are equivalent replacement methods, which are all included in the protection scope of the present application.
Claims
1. A marine xylanase mutant with improved thermostability, characterized in that: the name is HWxyn11-DC109, and the amino acid sequence is shown as SEQ ID NO.
1.
2. A coding gene for encoding the marine xylanase mutant with improved thermostability according to claim 1, characterized in that: the nucleotide sequence is shown as SEQ ID NO.
2.
3. An expression vector, characterized in that: containing the coding gene according to claim 2.
4. An engineered bacterium, characterized in that: containing the coding gene according to claim 2 in the genome. comprising the following steps: Sac I (2) The transformed liquid is coated on a YPD plate containing Zeocin, and after 3 days of culture at 30 ℃, the single yeast colony grown on the plate is the engineered bacterium; Pichia pastoris 5. The method of producing the engineered bacteria of claim 4, characterized in that comprising the following steps: (1) Using restriction enzymes The engineered bacterium according to claim 4 is inoculated into BMMY medium for induction culture, centrifuged, and the supernatant is collected and purified to obtain the marine xylanase mutant. linearizing the expression vector of claim 3, and electrotransforming into a host cell; 7. The marine xylanase mutant with improved thermostability according to claim 1 is applied in papermaking, feed, food and textile industries. The host cell of step (1) is Pichia pastoris X-33 8. The engineered bacterium according to claim 4 is applied in the production of thermostable xylanase. X33).
6. The method for preparing a marine xylanase mutant having improved thermostability according to claim 1, characterized in that
Citation Information
Patent Citations
Marine xylanase mutant and application thereof
CN117645989A