A method for preparing a gene-edited plant with altered starch component content in barley grains

Abstract

The present invention provides a method for preparing a gene-edited plant with a changed starch component content in barley grains, the method comprising using gene editing technology to edit the upstream promoter element of the barley starch branching enzyme gene to obtain the gene-edited plant with a changed starch component content in the barley grains. The present invention uses gene editing technology to find key sites that affect the starch component content in barley grains in the upstream promoter element of the barley starch branching enzyme gene, and thus provides a set of methods for preparing gene-edited plants with a changed starch component content in barley grains, providing a new means for regulating the starch components in barley grains.

Description

Technical Field

[0001] The present invention belongs to the field of biological genetic engineering technology, and in particular to a method for preparing gene-edited plants with altered starch component content in barley grains. Background Art

[0002] Barley (Hordeum vulgare L.) is the fourth largest cereal crop in the world, after wheat, rice, and corn. Starch is the largest chemical component of barley grains. Starch in barley grains can be divided into two types based on their structure: amylose and amylopectin. Cereals used for different purposes require different amounts and ratios of amylose and amylopectin. Therefore, developing crops with different starch compositions can meet diverse production and living needs.

[0003] Currently, gene editing of starch synthesis genes is commonly used to change the starch composition of crops. For example, gene editing of the SSSIIa gene (sex6 mutant) reduces the amylopectin content, while significantly increasing the synthesis of amylose (Morell, MK, Kosar-Hashemi, B., Cmiel, M., Samuel, MS, Chandler, P., Rahman, S., Buleon, A., Batey, IL, & Li, Z. (2003). Barley sex6 mutants lack starch synthase IIa activity and contain a starch with novel properties. The Plant Journal,34,173-185.Yang,Q.,Ding,J.,Feng,X.,Zhong,X.,Lan,J.,Tang,H.,Harwood,W.,Li,Z.,Guzmán,C.,Xu,Q., Zhang,Y.,Jiang,Y.,Qi,P.,Deng,M.,Ma,J.,Wang,J.,Chen,G.,Lan,X.,Wei,Y.,Zheng,Y.,&Jiang,Q.(2022).Editing of the starch synthase IIa gene led to transcriptomic and metabolomic changes and high amylose starch in barley. Carbohydrate Polymers, 285, 119238.). In maize, the amylose extender (ae-) mutant has increased amylose content in its grains (Kim, KN, Fisher, DK, Gao, M., & Guiltinan, MJ (1998). Molecular cloning and characterization of the amylose-extender gene encoding starch branching enzyme IIb in maize. Plant Molecular Biology, 38, 945-956.). However, gene editing of a single gene can only achieve unidirectional control of the phenotype.

[0004] The technology of fine-tuning gene expression has been applied to the rice Waxy gene (Zeng, D., Liu, T., Ma, X., Wang, B., Zheng, Z., Zhang, Y., Xie, X., Yang, B., Zhao, Z., Zhu, Q., & Liu, YG (2020). Quantitative regulation of Waxy expression by CRISPR / Cas9 based promoter and 5'UTR-intron editing improves grain quality in rice. Plant Biotechnology Journal, 18, 2385-2387. Huang, L., Li, Q., Zhang, C., Chu, R., Gu, Z., Tan, H., Zhao, D., Fan, X., & Liu, Q. (2020). Creating novel Wx alleles with fine-tuned amylose levels and improved grain quality in rice by promoter editing using CRISPR / Cas9 system. Plant Biotechnology Journal, 18, 2164-2166.) It does not directly edit the gene coding region, but instead precisely regulates gene expression by knocking out the gene promoter element. Gene editing promoter regions opens up new possibilities for gene editing outcomes.

[0005] The SBEIIb gene plays an important role in amylopectin biosynthesis. It is the only enzyme capable of producing branching. Its promoter region contains multiple cis-acting elements that play important roles. However, the expression and function of these elements in the SBEIIb gene remain unclear.

[0006] Based on the above requirements, the present invention provides a method for changing the starch composition of barley grains using a gene editing promoter. Summary of the Invention

[0007] The present invention provides a method for preparing gene-edited plants with altered starch component content in barley grains. This method can effectively change the starch component content in barley grains and provides a new means for regulating starch components in barley grains.

[0008] The specific technical solutions are as follows:

[0009] The present invention provides a method for preparing gene-edited plants with altered starch component content in barley grains, comprising: using gene editing technology to edit the upstream promoter element of the barley starch branching enzyme gene to obtain gene-edited plants with altered starch component content in barley grains.

[0010] Furthermore, the barley starch branching enzyme gene is the SBEIIb gene, and the gene number of the SBEIIb gene in BARLEX Morexv1Gene Models is HORVU2Hr1G077120.

[0011] Furthermore, the original nucleotide sequence of the upstream promoter is shown in SEQ ID NO.1, the upstream promoter is located before the CDS region of the SBEIIb gene, and has a length of 2.0-kb; the nucleotide sequence of the upstream promoter after gene editing is shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

[0012]

[0013] SEQ ID NO.2:GATTGTTTTTCAACCCATGTGAGAGAGATGTGTGTGATTCATATAAGAG AGAAAATGGTATAACACCAAAGAAGACACGACTATTACAAAAGCCACATAACATGGCCCAACTAAAGAAAACAAACCATTGATGATCCGCATTGGCAATTAATAAACCGACAAAACCAACCTAACTAGAGCAAGGGCACCACATAGGACACCAAAGTAAGGGAACATTTTTACTGCATAAGACTACAATAGACGATAACACCATTCAAACACGACCCACATCGATTAAAACCC

[0014] AAACAATACTTGAAGAATGCATGACATCACTGAGCAACGAGGCCACAAACCCAACAAC

[0015] GCTGGGCCAGCTGTCACCGAGGCCATAGAAGAAGGACTGAGGGGTGCATACGCATAAA

[0016] CCGAAAGGGAGTAGGAGGCACGAGAGCACCAAAGACAACGTCCACCACGACCGACA

[0017] AAGATGACATCAACCATGATCAAGTACCGCAAGCAAGGGAGGATCGAGGAAAAGGCC

[0018] GTTGGATACTCGAAATGACATTGGAGTATTTTTCTTGGATGACTCCAATTGGATGGCAAT

[0019] TGGTGGTGATGTCCATTTGGTCTTTAGTGATTCGCCCGAGATGCCAAGTTTCATAACCTC

[0020] ACACATCACACACACTCGCTAACACACTGACCCACTCGTCACTACTCTACCGTCCTACG

[0021] TGGCACCTACTGCAAGGCGACGCCGTCCGACAATGTACCCCGACCCCTCCTGCTAAGG

[0022] TTCCTTCCCCTCTCCCCGACCGCCACCGTCGGTCGCACTCACCCTGCTCCCCGCCCCCT

[0023] CCCCCACCCCTCCCCCGTTGTCGCCCCTCGCCGCGTCCCCTGGAGGTGGCCGGGGCGG

[0024] CAGCCCCCCTACTCCTCGTTGGCCTCCTCCCCCCTCCCTCCTGCTATTGCGTCCGAACG

[0025] GCTACCGTCGTTGACAATGGAGGTTGAGCCCTCCCGTGTGCCAACGGTGCTGCTGTCC

[0026] CTACTCCCGGCTCCTATTCGCCGCTATGCAGTCCTCATTTCGCGATGTCGTGGTGAGTCA

[0027] ACGTGGGGGCTTCAAGACCGTGTTGGCGCAGGGTGGTGATCGGTTTGGTGGCAGGCTC

[0028] CGGAGCGTCCAAGGTGCTGGCAGGGGCGTAGCGAGGATTATCAACCATTAGGTTCAGC

[0029] TCTACTGAAGAGTGGGTTCAGTTCTTTGCTTAGTCTTAAGCTAGTGTAAATCTATAAGGG

[0030] ACATGTCAAATTTCATTGGGTTCACTTGAACCCAATGCTAATGAGCTCGCTCCGCCCCT

[0031] GGGTGCTGGTTGGGATCGGGGGAACCCCTATCGGCATGGCTGACGCTGACGCGGTGGC

[0032] GCCTGTCGGTGCTGTCGGGCATTCCCGGAGGACGTCAGGGGCTACCCTTCCGCGTACT

[0033] GGGGGAAATCCTTGGCAACAAGGTTGTCATTGTCGTGATCCTTCTTGAAGGCGTTGATT

[0034] GGTACCGACGCTTTGGAATCTTGAAGCTTGGTGGAAGATGTTCGGTGGACGCAGCGAT

[0035] CGCGAGGCTTCTTAGTTTTTGTCAATTCGTCATTGTCAGCATTTATTTCTTTTGTACTTCA

[0036] TGTGTTGTTTTTTTTAGGCGTTGCTGTTTTCTTCACCACCTATCGTTAAATGTATTGCTTT

[0037] GTAATAAAAAAGGGGAAACCCTTTTTCAACAAGGCGACGCCGTCCTGCAGCTACGCCA

[0038] CCGCAAAACCCCAAACCTCTTCGCCCCCATGCTACCATCCATGCAGCCGTCCGCCCGCG

[0039] CGCGCGCGTTGGCCACGCCACCCGGTGGTGGCCAGGCCACCACGCCGCCACTCTCGCT

[0040] GAAGGCTCCGTCCGCTTCCTCCTAGTCCCACTCTCTGCCCGTGCTATATAGCATCCGCCC

[0041] TCCGCCCCCTACCAATCTTAGCACACCCCCCTGCGCCTCCTCATTTCGCTCGCGTGGGTT

[0042] TAAGCAGGAGACGAGGCGGGGTCAGTTGGGCGGTTGGGTTGGATCCGATCCGGCTGCG

[0043] GCGGCAGCGACGAG

[0044] SEQ ID NO.3:GATTGTTTTTCAACCCATGTGAGAGAGATGTGTGTGATTCATATAAGAG

[0045] AGAAAATGGTATAACACCAAAGAAGACACGACTATTACAAAAGCCACATAACATGGCC

[0046] CAACTAAAGAAAACAAACCATTGATGATCCGCATTGGCAATTAATAAACCGACAAAAC

[0047] CAACCTAACTAGAGCAAGGGCACCACATAGGACACCAAAGTAAGGGAACATTTTTACT

[0048] GCATAAGACTACAATAGACGATAACACCATTCAAACACGACCCACATCGATTAAAACCC

[0049] AAACAATACTTGAAGAATGCATGACATCACTGAGCAACGAGGCCACAAACCCAACAAC

[0050] GCTGGGCCAGCTGTCACCGAGGCCATAGAAGAAGGACTGAGGGGTGCATACGCATAAA

[0051] CCGAAAGGGAGTAGGAGGCACGAGAGCACCAAAGACAACGTCCACCACGACCGACA

[0052] AAGATGACATCAACCATGATCAAGTACCGCAAGCAAGGGAGGATCGAGGAAAAGGCC

[0053] GTTGGATACTCGAAATGACATTGGAGTATTTTTCTTGGATGACTCCAATTGGATGGCAAT

[0054] TGGTGGTGATGTCCATTTGGTCTTTAGTGATTCGCCCGAGATGCCAAGTTTCATAACCTC

[0055] ACACATCACACACACTCGCTAACACACTGACCCACTCGTCACTACTCTACCGTCCTACG

[0056] TGGCACCTACTGCAAGGCGACGCCGTCCGACAATGTACCCCGACCCCTCCTGCTAAGG

[0057] TTCCTTCCCCTCTCCCCGACCGCCACCGTCGGTCGCACTCACCCTGCTCCCCGCCCCCT

[0058] CCCCCACCCCTCCCCCGTTGTCGCCCCTCGCCGCGTCCCCTGGAGGTGGCCGGGGCGG

[0059] CAGCCCCCCTACTCCTCGTTGGCCTCCTCCCCCCTCCCTCCTGCTATTGCGTCCGAACG

[0060] GCTACCGTCGTTGACAATGGAGGTTGAGCCCTCCCGTGTGCCAACGGTGCTGCTGTCC

[0061] CTACTCCCGGCTCCTATTCGCCGCTATGCAGTCCTCATTTCGCGATGTCGTGGTGAGTCA

[0062] ACGTGGGGGCTTCAAGACCGTGTTGGCGCAGGGTGGTGATCGGTTTGGTGGCAGGCTC

[0063] CGGAGCGTCCAAGGTGCTGGCAGGGGCGTAGCGAGGATTATCAACCATTAGGTTCAGC

[0064] TCTACTGAAGAGTGGGTTCAGTTCTTTGCTTAGTCTTAAGCTAGTGTAAATCTATAAGGG

[0065] ACATGTCAAATTTCATTGGGTTCACTTGAACCCAATGCTAATGAGCTCGCTCCGCCCCT

[0066] GGGTGCTGGTTGGGATCGGGGGAACCCCTATCGGCATGGCTGACGCTGACGCGGTGGC

[0067] GCCTGTCGGTGCTGTCGGGCATTCCCGGAGGACGTCAGGGGCTACCCTTCCGCGTACT

[0068] GGGGGAAATCCTTGGCAACAAGGTTGTCATTGTCGTGATCCTTCTTGAAGGCGTTGATT

[0069] GGTACCGACGCTTTGGAATCTTGAAGCTTGGTGGAAGATGTTCGGTGGACGCAGCGAT

[0070] CGCGAGGCTTCTTAGTTTTTGTCAATTCGTCATTGTCAGCATTTATTTCTTTTGTACTTCA

[0071] TGTGTTGTTTTTTTTAGGCGTTGCTGTTTTCTTCACCACCTATCGTTAAATGTATTGCTTT

[0072] GTAATAAAAAAGGGGAAACCCTTTTTCAACAAGGCGACGCCGTCCTGCAGCTACGCCA

[0073] CCGCAAAACCCCAAACCTCTTCGCCCCCATGCTACCATCCATGCAGCCGTCCGCCCGCG

[0074] CGCGCGCGTTGGCCACGCCACCCGGTGGTGGCCAGGCCACCACGCCGCCACTCTCTGA

[0075] AGGCTCCGTCCGCTTCCTCCTAGTCCCACTCTCTGCCCGTGCTATATAGCATCCGCCCTC

[0076] CGCCCCCTACCAATCTTAGCACACCCCCCTGCGCCTCCTCATTTCGCTCGCGTGGGTTTA

[0077] AGCAGGAGACGAGGCGGGGTCAGTTGGGCGGTTGGGTTGGATCCGATCCGGCTGCGG

[0078] CGGCAGCGACGAG

[0079] SEQ ID NO.4:GATTGTTTTTCAACCCATGTGAGAGAGATGTGTGTGATTCATATAAGAG

[0080] AGAAAATGGTATAACACCAAAGAAGACACGACTATTACAAAAGCCACATAACATGGCC

[0081] CAACTAAAGAAAACAAACCATTGATGATCCGCATTGGCAATTAATAAACCGACAAAAC

[0082] CAACCTAACTAGAGCAAGGGCACCACATAGGACACCAAAGTAAGGGAACATTTTTACT

[0083] GCATAAGACTACAATAGACGATAACACCATTCAAACACGACCCACATCGATTAAAACCC

[0084] AAACAATACTTGAAGAATGCATGACATCACTGAGCAACGAGGCCACAAACCCAACAAC

[0085] GCTGGGCCAGCTGTCACCGAGGCCATAGAAGAAGGACTGAGGGGTGCATACGCATAAA

[0086] CCGAAAGGGAGTAGGAGGCACGAGAGCACCAAAGACAACGTCCACCACGACCGACA

[0087] AAGATGACATCAACCATGATCAAGTACCGCAAGCAAGGGAGGATCGAGGAAAAGGCC

[0088] GTTGGATACTCGAAATGACATTGGAGTATTTTTCTTGGATGACTCCAATTGGATGGCAAT

[0089] TGGTGGTGATGTCCATTTGGTCTTTAGTGATTCGCCCGAGATGCCAAGTTTCATAACCTC

[0090] ACACATCACACACACTCGCTAACACACTGACCCACTCGTCACTACTCTACCGTCCTACG

[0091] TGGCACCTACTGCAAGGCGACGCCGTCCGACAATGTACCCCGACCCCTCCTGCTAAGG

[0092] TTCCTTCCCCTCTCCCCGACCGCCACCGTCGGTCGCACTCACCCTGCTCCCCGCCCCCT

[0093] CCCCCACCCCTCCCCCGTTGTCGCCCCTCGCCGCGTCCCCTGGAGGTGGCCGGGGCGG

[0094] CAGCCCCCCTACTCCTCGTTGGCCTCCTCCCCCCTCCCTCCTGCTATTGCGTCCGAACG

[0095] GCTACCGTCGTTGACAATGGAGGTTGAGCCCTCCCGTGTGCCAACGGTGCTGCTGTCC

[0096] CTACTCCCGGCTCCTATTCGCCGCTATGCAGTCCTCATTTCGCGATGTCGTGGTGAGTCA

[0097] ACGTGGGGGCTTCAAGACCGTGTTGGCGCAGGGTGGTGATCGGTTTGGTGGCAGGCTC

[0098] CGGAGCGTCCAAGGTGCTGGCAGGGGCGTAGCGAGGATTATCAACCATTAGGTTCAGC

[0099] TCTACTGAAGAGTGGGTTCAGTTCTTTGCTTAGTCTTAAGCTAGTGTAAATCTATAAGGG

[0100] ACATGTCAAATTTCATTGGGTTCACTTGAACCCAATGCTAATGAGCTCGCTCCGCCCCT

[0101] GGGTGCTGGTTGGGATCGGGGGAACCCCTATCGGCATGGCTGACGCTGACGCGGTGGC

[0102] GCCTGTCGGTGCTGTCGGGCATTCCCGGAGGACGTCAGGGGCTACCCTTCCGCGTACT

[0103] GGGGGAAATCCTTGGCAACAAGGTTGTCATTGTCGTGATCCTTCTTGAAGGCGTTGATT

[0104] GGTACCGACGCTTTGGAATCTTGAAGCTTGGTGGAAGATGTTCGGTGGACGCAGCGAT

[0105] CGCGAGGCTTCTTAGTTTTTGTCAATTCGTCATTGTCAGCATTTATTTCTTTTGTACTTCA

[0106] TGTGTTGTTTTTTTTAGGCGTTGCTGTTTTCTTCACCACCTATCGTTAAATGTATTGCTTT

[0107] GTAATAAAAAAGGGGAAACCCTTTTTCAACAAGGCGACGCCGTCCTGCAGCTACGCCA

[0108] CCGCAAAACCCCAAACCTCTTCGCCCCCATGCTACCATCCATGCAGCCGTCCGCCCGCG

[0109] CGCGCGCGTTGGCCACGCCACCCGGTGGTGGCCAGGCCACCACGCCGCCACTCTCGCG

[0110] TGAAGGCTCCGTCCGCTTCCTCCTAGTCCCACTCTCTGCCCGTGCTATATAGCATCCGCC

[0111] CTCCGCCCCCTACAATCTTAGCACACCCCCCTGCGCCTCCTCATTTCGCTCGCGTGGGTT

[0112] TAAGCAGGAGACGAGGCGGGGTCAGTTGGGCGGTTGGGTTGGATCCGATCCGGCTGCG

[0113] GCGGCAGCGACGAG

[0114]

[0115] Furthermore, the editing target of the upstream promoter is a sequence located 2 bp to 25 bp from the 5' end of the A-box element, or a sequence containing a CAAT-box element.

[0116] Furthermore, the preparation method specifically comprises the following steps:

[0117] (1) Designing sgRNA target sites for the promoter region upstream of the CDS region of the barley starch branching enzyme gene SBEIIb;

[0118] (2) preparing a CRISPR / Cas9 gene editing vector based on the sgRNA target site designed in step (1);

[0119] (3) A genetically engineered bacterium containing a CRISPR / Cas9 gene editing vector was constructed and transformed into barley genetic transformation materials. After screening for vector marker genes, gene-edited plants with altered starch component content in barley grains that did not contain exogenous genes were obtained.

[0120] In the above method, the barley starch branching enzyme gene SBEIIb can be assembled using Geneious software, and the promoter region upstream of the CDS region can be predicted using PlantCARE (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html) online software. The sgRNA target site can be designed using the targetdesign (http: / / skl.scau.edu.cn / targetdesign / ) website, and the off-target rate of the target site can be tested using crispor (http: / / crispor.tefor.net / crispor.py).

[0121] The genetic transformation process includes embryo removal, infection, and differentiation culture. After genetic transformation, transgenic-positive seedlings are obtained. These plants are first planted continuously until the T2 generation, then screened for vector marker genes to obtain plants free of the vector marker gene. Target sequence verification is then performed to screen for transgenic-positive seedlings free of exogenous genes. These transgenic-positive seedlings can be tested for quality traits, such as amylose and amylopectin content in the grain.

[0122] Furthermore, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO.6, specifically ACGCCGCCACTCTCGCGTGAAGG; or, as shown in SEQ ID NO.7, specifically CCCTACCAATCTTAGCACACCCC.

[0123] Among them, when the sequence shown in SEQ ID NO.6 was used as sgRNA, the amylose content of the grains of the barley gene-edited plants obtained was significantly increased, and the amylopectin content was significantly reduced; and when the sequence shown in SEQ ID NO.7 was used as sgRNA, the amylopectin content of the grains of the barley gene-edited plants obtained was significantly increased, and the amylose content was significantly reduced.

[0124] The present invention also provides a gene-edited plant with altered starch component content in barley grains, prepared by the preparation method described above.

[0125] The present invention also provides an upstream promoter sequence of a starch branching enzyme gene SBEIIb, wherein the nucleotide sequence of the promoter element is shown as SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

[0126] The present invention also provides a combination gene, including a barley starch branching enzyme gene SBEIIb and an upstream promoter element thereof, wherein the gene number of the barley starch branching enzyme gene SBEIIb in the BARLEX Morex v1 Gene Models is HORVU2Hr1G077120; the upstream promoter is located before the CDS region of the SBEIIb gene and has a length of 2.0 kb; the nucleotide sequence of the upstream promoter is such as SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4 or SEQ ID NO.5.

[0127] The present invention also provides a genetically engineered bacterium comprising a CRISPR / Cas9 gene editing vector, wherein the sgRNA sequence in the gene editing vector is shown as SEQ ID NO.6 or SEQ ID NO.7; the host cell of the genetically engineered bacterium is Agrobacterium.

[0128] Compared with the prior art, the present invention has the following beneficial effects:

[0129] (1) The present invention uses gene editing technology to find key sites in the upstream promoter region of the barley starch branching enzyme gene that affect the content of starch components in barley grains, and thus provides a set of methods for preparing gene-edited plants with altered starch component content in barley grains, providing a new means for regulating starch components in barley grains.

[0130] (2) The present invention also provides corresponding upstream promoter elements, combined genes and genetically engineered bacteria based on the key sites that affect the content of starch components in barley grains, providing more means and tools for achieving changes in the starch components of barley grains. BRIEF DESCRIPTION OF THE DRAWINGS

[0131] Figure 1 It is the target situation of the SBEIIb gene promoter region and the gene editing situation of the mutant.

[0132] Figure 2 Determination of starch traits in gene-edited barley SBEIIb promoter mutants.

[0133] Figure 3 is the expression of SBEIIb in the control GP and mutant.

[0134] Figure 4 is the expression level of different starch synthesis genes in the control and mutant during grain development. DETAILED DESCRIPTION

[0135] The present invention will be further described below in conjunction with specific embodiments. The following are only specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto.

[0136] In the present invention, unless otherwise specified, the equipment and raw materials used can be purchased from the market or are commonly used in the art. The methods in the following examples, unless otherwise specified, are all conventional methods in the art.

[0137] Example 1 Construction of knockout vector and acquisition of gene-edited plants (SBEIIb promoter B3 target site)

[0138] 1) Prediction of SBEIIb gene promoter elements

[0139] The gene sequence of SBEIIb (HORVU2Hr1G077120) was assembled using Geneious software, and the first 2.0-kb of its CDS region was selected as the promoter region of the gene.

[0140] The promoter elements of this gene were predicted using online software (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html).

[0141] 2) Design of promoter knockout sgRNA

[0142] The sgRNA target site for the target SBEIIb gene was designed using the online website targetdesign (http: / / skl.scau.edu.cn / targetdesign / ). The off-target rate was then tested on the website crispor (http: / / crispor.tefor.net / crispor.py). The B3-sgRNA sequence was determined based on the knockout element and off-target detection, namely: B3-sgRNA:

[0143] CCTCATTTCGCTCGCGTGGGTTT.

[0144] 3) Construction of promoter knockout vector

[0145] ① The U6 vector was linearized using BsaIHF-V2 restriction endonuclease (R3733L, NEB, USA), and the digested product was subjected to rapid CIP dephosphorylation treatment (M0525V, NEB, USA) to prevent vector self-ligation;

[0146] ② Design target primers: B3-F: cttgAACCCACGCGAGCGAAATG; B3-R: aaacCATTTCGC

[0147] TCGCGTGGGTT;

[0148] ③ Target primers were dissolved in TE buffer to a final concentration of 100 μM / L and annealed at 90°C for 1-2 minutes using a PCR instrument;

[0149] ④ The target primer annealing product was phosphorylated by adding T4 PNK (M0201S, NEB, USA);

[0150] ⑤Use T4 ligase (M0202L, NEB, USA) to connect the U6 linearized vector and the annealed phosphorylated product to obtain the Cas9-U6-B3 knockout vector.

[0151] ⑥The above knockout vector was transformed into competent E. coli DH5a, and primers

[0152] P2-5'-GCGATTAAGTTGGGTAACGC-3' and cas9-B3-R were verified as monoclones and sequenced.

[0153] After sequencing was confirmed, the plasmid was extracted to obtain the cas9:B3 promoter editing vector.

[0154] 2) Obtaining gene-edited plants

[0155] The constructed knockout vector positive plasmids were transformed into Agrobacterium by heat shock method, and commercial Agrobacterium competent cells were used.

[0156] AGL1 (AC1020S, Weidi Biotechnology, China) was used as the recipient strain.

[0157] The nucleotide sequence of the upstream promoter after gene editing is shown in SEQ ID NO.68.

[0158] SEQ ID NO.68:GATTGTTTTTCAACCCATGTGAGAGAGATGTGTGTGATTCATATA

[0159] AGAGAGAAAATGGTATAACACCAAAGAAGACACGACTATTACAAAAGCCACATAACAT

[0160] GGCCCAACTAAAGAAAACAAACCATTGATGATCCGCATTGGCAATTAATAAACCGACA

[0161] AAACCAACCTAACTAGAGCAAGGGCACCACATAGGACACCAAAGTAAGGGAACATTTT

[0162] TACTGCATAAGACTACAATAGACGATAACACCATTCAAACACGACCCACATCGATTAAA

[0163] ACCCAAACAATACTTGAAGAATGCATGACATCACTGAGCAACGAGGCCACAAACCCAA

[0164] CAACGCTGGGCCAGCTGTCACCGAGGCCATAGAAGAAGGACTGAGGGGTGCATACGC

[0165] ATAAACCGAAAGGGAGTAGGAGGCACGAGAGCACCAAAGACAACGTCCACCACGACC

[0166] GACAAAGATGACATCAACCATGATCAAGTACCGCAAGCAAGGGAGGATCGAGGAAAA

[0167] GGCCGTTGGATACTCGAAATGACATTGGAGTATTTTTCTTGGATGACTCCAATTGGATGG

[0168] CAATTGGTGGTGATGTCCATTTGGTCTTTAGTGATTCGCCCGAGATGCCAAGTTTCATAA

[0169] CCTCACACATCACACACACTCGCTAACACACTGACCCACTCGTCACTACTCTACCGTCC

[0170] TACGTGGCACCTACTGCAAGGCGACGCCGTCCGACAATGTACCCCGACCCCTCCTGCTA

[0171] AGGTTCCTTCCCCTCTCCCCGACCGCCACCGTCGGTCGCACTCACCCTGCTCCCCGCCC

[0172] CCTCCCCCACCCCTCCCCCGTTGTCGCCCCTCGCCGCGTCCCCTGGAGGTGGCCGGGG

[0173] CGGCAGCCCCCCTACTCCTCGTTGGCCTCCTCCCCCCTCCCTCCTGCTATTGCGTCCGA

[0174] ACGGCTACCGTCGTTGACAATGGAGGTTGAGCCCTCCCGTGTGCCAACGGTGCTGCTG

[0175] TCCCTACTCCCGGCTCCTATTCGCCGCTATGCAGTCCTCATTTCGCGATGTCGTGGTGAG

[0176] TCAACGTGGGGGCTTCAAGACCGTGTTGGCGCAGGGTGGTGATCGGTTTGGTGGCAGG

[0177] CTCCGGAGCGTCCAAGGTGCTGGCAGGGGCGTAGCGAGGATTATCAACCATTAGGTTC

[0178] AGCTCTACTGAAGAGTGGGTTCAGTTCTTTGCTTAGTCTTAAGCTAGTGTAAATCTATAA

[0179] GGGACATGTCAAATTTCATTGGGTTCACTTGAACCCAATGCTAATGAGCTCGCTCCGCC

[0180] CCTGGGTGCTGGTTGGGATCGGGGGAACCCCTATCGGCATGGCTGACGCTGACGCGGT

[0181] GGCGCCTGTCGGTGCTGTCGGGCATTCCCGGAGGACGTCAGGGGCTACCCTTCCGCGT

[0182] ACTGGGGGAAATCCTTGGCAACAAGGTTGTCATTGTCGTGATCCTTCTTGAAGGCGTTG

[0183] ATTGGTACCGACGCTTTGGAATCTTGAAGCTTGGTGGAAGATGTTCGGTGGACGCAGC

[0184] GATCGCGAGGCTTCTTAGTTTTTGTCAATTCGTCATTGTCAGCATTTATTTCTTTTGTACT

[0185] TCATGTGTTGTTTTTTTTAGGCGTTGCTGTTTTCTTCACCACCTATCGTTAAATGTATTGC

[0186] TTTGTAATAAAAAAGGGGAAACCCTTTTTCAACAAGGCGACGCCGTCCTGCAGCTACG

[0187] CCACCGCAAAACCCCAAACCTCTTCGCCCCCATGCTACCATCCATGCAGCCGTCCGCCC

[0188] GCGCGCGCGCGTTGGCCACGCCACCCGGTGGTGGCCAGGCCACCACGCCGCCACTCTC

[0189] GCGTGAAGGCTCCGTCCGCTTCCTCCTAGTCCCACTCTCTGCCCGTGCTATATAGCATCC

[0190] GCCCTCCGCCCCCTACCAATCTTAGCACACCCCCCTGCGCCTCCTCATTCGCTCGCGTG

[0191] GGTTTAAGCAGGAGACGAGGCGGGGTCAGTTGGGCGGTTGGGTTGGATCCGATCCGGC

[0192] TGCGGCGGCAGCGACGAG

[0193] Genetic transformation was performed using Agrobacterium tumefaciens to infect isolated Golden Hope (GP) embryos. Gene-edited plants were obtained after hygromycin selection and culture. DNA was extracted from leaves of T0-generation gene-edited plants and wild-type plants. The target region was sequenced using primer B357 to detect the mutation type. The amplified length was 575 bp. The primers are as follows: B357-F: 5'-AGGCGTTGCTGTTTTCTT

[0194] CAC-3';B357-R:5'-ACGAGAGAATGCGAGTGAGC-3';

[0195] Gene-edited plants were continuously planted, DNA was extracted from T2 generation plants, and plants without both marker genes were screened using HYG and Cas9 screening markers. The mutation site was detected using the B357 primer, and finally gene-edited plants without exogenous genes were screened. The primers are as follows: HYG-F: 5'-TAAATAGCTGCGCCGATGGT-3'; HYG-R:

[0196] 5'-GGCGACCTCGTATTGGGAAT-3'; Cas9-F: 5'-CCTGGCCCACATGATCAAGT-3';

[0197] Cas9-R: 5'-TGTACTTCTCAGGCAGCTGC-3'; T2 generation seeds can be used for subsequent steps after positive identification. Example 2 Construction of knockout vector and acquisition of gene-edited plants (SBEIIb promoter B5 target)

[0198] 1) Prediction of promoter elements of 35SBEIIb gene

[0199] The gene sequence of SBEIIb (HORVU2Hr1G077120) was assembled using Geneious software, and the first 2.0-kb of its CDS region was selected as the promoter region of the gene.

[0200] The promoter elements of this gene were predicted using online software (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html).

[0201] 2) Design of sgRNA for 40 promoter knockout

[0202] The sgRNA target site of the target SBEIIb gene was designed using the online website targetdesign (http: / / skl.scau.edu.cn / targetdesign / ), and the off-target rate was detected on the website crispor (http: / / crispor.tefor.net / crispor.py). The B5-sgRNA sequence was determined by combining the knockout element and off-target detection, namely: B5-sgRNA: ACGCCGCCACTCTCGCGTGAAGG

[0203] 3) Construction of promoter knockout vector

[0204] ① The U6 vector was linearized using BsaIHF-V2 restriction endonuclease (R3733L, NEB, USA), and the digested product was subjected to rapid CIP dephosphorylation treatment (M0525V, NEB, USA) to prevent vector self-ligation;

[0205] ② Design target primers: B5-F: cttgCGCCGCCACTCTCGCGTGA, B5-R: aaacTCACGCGAGAGTGGCGGCG;

[0206] ③ Target primers were dissolved in TE buffer to a final concentration of 100 μM / L and annealed at 90°C for 1-2 minutes using a PCR instrument;

[0207] ④ The target primer annealing product was phosphorylated by adding T4 PNK (M0201S, NEB, USA);

[0208] ⑤Use T4 ligase (M0202L, NEB, USA) to connect the U6 linearized vector and the annealed phosphorylated product to obtain the Cas9-U6-B5 knockout vector.

[0209] ⑥The above knockout vector was transformed into competent E. coli DH5a, using primers

[0210] P2-5'-GCGATTAAGTTGGGTAACGC-3' and cas9-B5-R were verified as monoclones and sequenced.

[0211] After sequencing was confirmed, the plasmid was extracted to obtain the cas9:B5 promoter editing vector.

[0212] 4) Obtaining gene-edited plants

[0213] The constructed knockout vector-positive plasmids were transformed into Agrobacterium using the heat shock method, using commercial Agrobacterium competent cells AG L1 (AC1020S, Weidi Biotechnology, China) as the recipient strain. Genetic transformation was performed by infecting isolated Golden Hope (GP) embryos with Agrobacterium. Gene-edited plants were obtained after selection and culture with hygromycin. DNA was extracted from leaves of T0-generation gene-edited plants and wild-type plants, and the target region was sequenced using the B357 primer to detect mutation types. The amplified length was 575 bp. The primers are as follows:

[0214] B357-F: 5'-AGGCGTTGCTGTTTCTTCAC-3'; B357-R: 5'-ACGAGAGAATGCGAGTGAG C-3';

[0215] Gene-edited plants were continuously planted, DNA was extracted from T2 generation plants, and plants without both marker genes were screened using HYG and Cas9 screening markers. The mutation site was detected using the B357 primer, and finally gene-edited plants without exogenous genes were screened. The primers are as follows: HYG-F: 5'-TAAATAGCTGCGCCGATGGT-3'; HYG-R:

[0216] 5'-GGCGACCTCGTATTGGGAAT-3'; Cas9-F: 5'-CCTGGCCCACATGATCAAGT-3';

[0217] Cas9-R: 5'-TGTACTTCTCAGGCAGCTGC-3'; T2 generation seeds can be used in subsequent steps after positive identification.

[0218] Example 3 Construction of knockout vector and acquisition of gene-edited plants (SBEIIb promoter B7 target site)

[0219] 1) Prediction of SBEIIb gene promoter elements

[0220] The gene sequence of SBEIIb (HORVU2Hr1G077120) was assembled using Geneious software, and the first 2.0-kb of its CDS region was selected as the promoter region of the gene.

[0221] The promoter elements of this gene were predicted using online software (http: / / bioinformatics.psb.ugent.be / webtools / plantcare / html).

[0222] 2) Design of promoter knockout sgRNA

[0223] The sgRNA target sites for the target SBEIIb gene were designed using the online website targetdesign ( http: / / skl.scau.edu.cn / targetdesign / ), and the off-target rate was detected on the website crispor ( http: / / crispor.tefor.net / crispor.py ). The knockout element and off-target detection were combined to determine two sgRNA sequences, namely: B7-sgRNA: CCCTACCAATCTTAGCACAC CCC;

[0224] 3) Construction of promoter knockout vector

[0225] ① The U6 vector was linearized using BsaIHF-V2 restriction endonuclease (R3733L, NEB, USA), and the digested product was subjected to rapid CIP dephosphorylation treatment (M0525V, NEB, USA) to prevent vector self-ligation;

[0226] ② Design target primers: B7-F: cttgGGGTGTGCTAAGATTGGTA, B7-R: aaacTACCAATCTTAGCACACCC;

[0227] ③ Target primers were dissolved in TE buffer to a final concentration of 100 μM / L and annealed at 90°C for 1-2 minutes using a PCR instrument;

[0228] ④ The target primer annealing product was phosphorylated with T4PNK (M0201S, NEB, USA);

[0229] ⑤Use T4 ligase (M0202L, NEB, USA) to connect the U6 linearized vector and the annealed phosphorylated product to obtain the Cas9-U6-B7 knockout vector.

[0230] ⑥The above knockout vector was transformed into competent E. coli DH5a, using primers

[0231] P2-5'-GCGATTAAGTTGGGTAACGC-3' and cas9-B7-R were verified as monoclones and sequenced.

[0232] After sequencing was correct, the plasmid was extracted to obtain the cas9:B7 gene editing vector.

[0233] 4) Obtaining gene-edited plants

[0234] The constructed knockout vector positive plasmids were transformed into Agrobacterium by heat shock method, and commercial Agrobacterium competent cells were used.

[0235] AGL1 (AC1020S, Weidi Biotechnology, China) was used as the recipient strain. Genetic transformation was performed by infecting isolated GP embryos with Agrobacterium tumefaciens. Gene-edited plants were obtained after hygromycin selection and culture. DNA was extracted from leaves of T0-generation gene-edited plants and wild-type plants. The target region was sequenced using the B357 primer to detect the mutation type. The amplified length was 575 bp. The primers are as follows: B357-F:

[0236] 5'-AGGCGTTGCTGTTTCTTCAC-3'; B357-R: 5'-ACGAGAGAATGCGAGTGAGC-3';

[0237] Gene-edited plants were continuously planted, DNA was extracted from T2 generation plants, and plants without both marker genes were screened using HYG and Cas9 screening markers. The mutation site was detected using the B357 primer, and finally gene-edited plants without exogenous genes were screened. The primers are as follows: HYG-F: 5'-TAAATAGCTGCGCCGATGGT-3'; HYG-R:

[0238] 5'-GGCGACCTCGTATTGGGAAT-3'; Cas9-F: 5'-CCTGGCCCACATGATCAAGT-3';

[0239] Cas9-R: 5'-TGTACTTCTCAGGCAGCTGC-3'; After seed propagation, sufficient transgenic seeds were harvested, and T2 generation seeds could be used for subsequent steps after positive identification.

[0240] Example 4 Analysis of Starch Traits in Gene-Edited Plants

[0241] After gene knockout, the T2 generation transgenic lines obtained one mutant: B3 M1 (a 1-base deletion at the target site) by B3 target knockout; two mutants were obtained: B5 M1 (a 1-base deletion at the target site) and B5 M2

[0242] (3 bases deleted at the target site); B7 target knockout obtained 2 mutants: B7 M1 (1 base deleted at the target site) and B7 M2 (10 bases deleted at the target site) (see attached) Figure 1 ).

[0243] The starch content of mature grains of the mutant and control plants CK was then measured and analyzed, including total starch content, amylose and amylopectin content, using Megazyme K-TSTA and K-AMYL kits.

[0244] The results showed that compared with the control CK, the amylose and amylopectin contents of B3 M1 had no significant changes; the amylose contents of B5 M1 and B5 M2 increased significantly by 36.53% and 41.64%, respectively; and the amylopectin contents decreased significantly by 42.84%.

[0245] and 39.90%; the amylose content of B7 M1 and B7 M2 decreased significantly by 33.27% and 24.97%, respectively; the amylopectin content increased significantly by 40.17% and 44.95%, respectively (Appendix Figure 2 ).

[0246] Example 5 SBEIIb gene function verification

[0247] 1) Planting and sampling of 30 barley materials

[0248] The control GP and mutants B5 M1, B5 M2, B7 M1, and B7 M2 were simultaneously grown in a plant growth room with a temperature of 22°C during the day and 18°C ​​at night, a photoperiod of 14 h during the day and 10 h at night, and a light intensity of 300 μm·m -2 s -1 The planting soil consisted of a mixture of peat and vermiculite in a 9:1 ratio. Barley kernels were sampled 7, 14, 21, and 28 days after anthesis. After cutting the ears and removing the awns, the kernels were quickly placed in 15 mL centrifuge tubes pre-cooled with liquid nitrogen, snap-frozen in liquid nitrogen, and stored at -80°C. RNA contamination was avoided throughout the sampling process.

[0249] 2) RNA extraction, reverse transcription, and quantitative PCR

[0250] Total RNA was extracted using a Quick RNA extraction kit (Huayueyang Biotechnology Co., Ltd., Beijing, China), and cDNA was synthesized according to the instructions of a reverse transcription kit (Takara, Japan). The housekeeping gene 3-glyceraldehyde phosphate dehydrogenase gene was used as an internal reference, and the amplified sequences were: GAPDH-F: 5'-GTGAGGCTGGTGCTGATTACG-3'; GAPDH-R:

[0251] 5'-TGGTGCAGCTAGCATTTGAGAC-3';

[0252] The expression levels of SBEIIb and other starch synthesis-related genes were measured in controls and mutants. These genes include AGPS, AGPL, GBSSI, SSI, SSIIa, SSIIIa, SSIIIb, SSIVa, SBEI, SBEIIa, SBEIIIa, SBEIIIb, ISAI, ISAII, ISAIII, and PUL. The primers used are listed in Appendix 1.

[0253] Table 1. List of primers required for gene expression determination.

[0254]

[0255] Utilize TB Green TM PreMix Ex Taq TM qRT-PCR reactions were performed using a LightCycler 480 fluorescence quantitative PCR instrument (Roche, Switzerland) and a PCR amplification kit (Takara, Japan). The reaction procedure consisted of 40 cycles of pre-denaturation at 95°C for 90 s, denaturation at 95°C for 5 s, and annealing at 60°C for 20 s. The response Ct value for each gene was determined based on the amplification curve, and relative gene expression was calculated using the 2-ΔΔCt method (Schefe et al., 2006). Each value was determined in four biological replicates.

[0256] The results of the analysis showed that the expression level of SBEIIb was high in the early stage of grain development and decreased significantly with the development process, indicating that the gene has played a role in the early stage of grain development (Appendix Figure 3 a). Compared with GP, the expression of SBEIIb in B7 M1 and B7 M2 mutants was significantly higher 7 days after anthesis, while that in B5 M2 mutant was significantly lower. The difference in SBEIIb expression at this time was basically consistent with the difference in final AP content (Appendix Figure 2 Throughout the entire grain development period (7DAF-21DAF), the expression of SBEIIb was generally decreased in the B5 mutant, but generally increased in the B7 mutant (see Appendix). Figure 3 b), which ultimately led to a significant decrease in AP content in the B5 mutant and a significant increase in AP content in the B7 mutant (see Appendix Figure 2 ).

[0257] q-PCR was performed to verify the expression of 16 starch synthesis genes. The gene expression calorimetry showed that the genes related to starch synthesis in the mutants underwent significant changes, indicating that starch synthesis is indeed regulated by many synthesis genes (see Appendix Figure 4 These analyses revealed that knocking out the B5 target site in the SBEIIb promoter reduced SBEIIb gene expression, thereby decreasing amylopectin content; while knocking out the B7 target site in the SBEIIb promoter also reduced SBEIIb gene expression, thereby increasing amylopectin content. Therefore, knocking out either the B5 or B7 target sites altered barley grain starch composition.

[0258] The above-described embodiment is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any manner. Other variations and modifications are possible without departing from the technical solutions set forth in the claims. All nucleotide sequences encoding the gene, as well as biological materials containing any of the aforementioned genes, fall within the scope of protection of the present invention.

Claims

1. A method for preparing a gene-edited plant with altered starch component content in barley grains, characterized in that: include: Using gene editing technology, the upstream promoter element of the barley starch branching enzyme gene was edited to obtain gene-edited plants with altered starch component content in barley grains; The barley starch branching enzyme gene is BnB Gene, BnB The gene number of the gene in BARLEX Morex v1 GeneModels is HORVU2Hr1G077120 ; The original nucleotide sequence of the upstream promoter region is shown in SEQ ID NO.

1. The upstream promoter region is located at BnB before the CDS region of the gene, with a length of 2.0 kb; The nucleotide sequence of the upstream promoter after gene editing is shown in SEQ ID NO.2 and SEQ ID NO.3, and the starch component content is changed as follows: the amylose content of the grains of the barley gene-edited plants is significantly increased, and the amylopectin content is significantly reduced; Alternatively, the nucleotide sequence of the upstream promoter after gene editing is as shown in SEQ ID NO.4 or SEQ ID NO.5, and the starch component content is changed as follows: the amylopectin content of the grains of the barley gene-edited plants is significantly increased, and the amylose content is significantly decreased.

2. The method for preparing a gene-edited plant with a changed starch component content in barley grains according to claim 1, characterized in that: The editing target of the upstream promoter is a sequence at a position 2 bp to 25 bp away from the 5' end of the A-box element, or a sequence containing a CAAT-box element.

3. The method for preparing a gene-edited plant with altered starch component content in barley grains according to claim 1, characterized in that: The specific steps include: (1) Targeting barley starch branching enzyme gene BnB The promoter region upstream of the CDS region is used to design the sgRNA target site; (2) Preparing a CRISPR / Cas9 gene editing vector based on the sgRNA target site designed in step (1); (3) A genetically engineered bacterium containing a CRISPR / Cas9 gene editing vector was constructed and transformed into barley genetic transformation materials. After screening for vector marker genes, gene-edited plants with altered starch component content in barley grains that did not contain exogenous genes were obtained.

4. The method for preparing a gene-edited plant with altered starch component content in barley grains according to claim 3, characterized in that: The nucleotide sequence of the sgRNA is shown in SEQ ID NO.6 or SEQ ID NO.7.

Images