Aspergillus giganteus strain and its application in straw degradation and feed conversion

Abstract

The present invention provides a method for degrading lignocellulosic biomass by microorganisms. The method comprises the following steps: mixing Aspergillus giganteus or a culture of Aspergillus giganteus with the lignocellulosic biomass and co-culturing them so that the lignocellulosic biomass is degraded. The degradation product is further used for preparing feed. The method of the present invention significantly increases the crude protein content, improves the nutritional value of straw, and turns the straw waste into a valuable resource.

Description

Technical Field

[0001] The present invention relates to the technical fields of fungi, and the technology of fungi degrading straw and feed, in particular to Aspergillus giganteus strains, and the technology of using Aspergillus giganteus strains to process straw and further use it for feed. Background Art

[0002] The existing publicly disclosed technologies for degrading straw lignocellulose mainly include physical methods, chemical methods, and biological methods. Physical methods usually require high-temperature and high-pressure conditions and have high requirements for equipment. Common chemical methods include acid treatment and alkali treatment, which usually also require high-temperature conditions and are also high-energy-consuming treatment methods. The biological method is to use microorganisms or enzyme preparations to selectively decompose lignin, cellulose, and hemicellulose, thereby promoting the conversion of straw lignocellulose. The enzymatic hydrolysis method generally first performs physical and chemical pretreatment on straw and then adds enzymes for reaction. The disadvantage of the enzymatic method is that the enzyme cost is high and it is easy to inactivate. The microbial fermentation method is to co-culture straw with microorganisms. The microorganisms proliferate and produce enzymes to achieve the degradation of straw lignocellulose. The microbial method is relatively simple to operate, low in cost, green and sustainable, and has received increasing attention. Summary of the Invention

[0003] During the research process, the inventors of the present invention found that Aspergillus giganteus can degrade lignin, cellulose, and hemicellulose. This discovery expands new strain resources for degrading lignocellulosic biomass such as straw, and undoubtedly has important application value. Through research, the inventors also found that using Aspergillus giganteus to degrade lignocellulosic biomass such as straw containing cellulose, hemicellulose, and lignin can also produce a large amount of crude protein. This property is very beneficial for preparing feed from the degradation products, can improve the protein content of the feed, and improve the quality of the feed. Through further in-depth research, the inventors found that no other substrates need to be added during the degradation process, and only lignocellulosic biomass such as straw can be used as a single fermentation substrate, which will greatly reduce the actual production cost.

[0004] The inventors of the present invention also self-isolated a new strain of Aspergillus giganteus, which was isolated from rotten wheat straw and soil samples in the experimental field of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Zaojunmiao Road, Haidian District, Beijing. This strain has a high degradation efficiency for straw and can also produce a large amount of crude protein. This strain has been deposited in the Patent Procedure, and is deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms (Datun Road, Chaoyang District, Beijing), and the deposit number is CGMCC No. 40911.

[0005] Based on the above, the present invention further invented the following technical solutions and requests protection.

[0006] On the one hand, the present invention provides a method for degrading lignocellulosic biomass by microorganisms, comprising the following steps: mixing Aspergillus giganteus or a culture of Aspergillus giganteus with the lignocellulosic biomass and co-culturing them so that the lignocellulosic biomass is degraded.

[0007] Among them, the lignocellulosic biomass refers to any biomass containing lignin, cellulose and / or hemicellulose, including but not limited to herbaceous materials, agricultural residues, forestry residues, municipal solid waste, waste paper, and pulp and paper mill residues. When it is a herbaceous material or an agricultural and forestry residue, it can be branches, stems, leaves, husks, barks, or rachis of plants, etc. As a preferred embodiment, the lignocellulosic biomass refers to crop straw. Further preferably, the crop straw can be wheat straw, corn straw, or rice straw, etc.

[0008] Among them, the degradation of the lignocellulosic biomass can be the degradation of any substance in the lignocellulosic biomass, preferably the degradation of lignin, cellulose and / or hemicellulose.

[0009] The degradation of the lignin means the cleavage of the ester bonds and ether bonds between lignin macromolecules and the depolymerization of lignin. The degradation of the hemicellulose means the destruction of the glycosidic bonds, ester bonds and ether bonds in the hemicellulose. The degradation of the cellulose means the hydrolysis cleavage of the glucosidic bonds in the cellulose.

[0010] Among them, the culture of Aspergillus giganteus refers to the product obtained by fermenting and culturing Aspergillus giganteus. This product can be the direct product without any treatment, or the substance obtained by removing the thalli from the direct product, or the liquid substance obtained by solid-liquid separation of the direct product, or the enzyme isolated from the direct product.

[0011] Among them, the conditions for co-culturing (such as temperature, etc.) can be any conditions suitable for the proliferation or metabolic enzyme production of Aspergillus giganteus. The specific culture conditions of Aspergillus giganteus have been disclosed in the prior art.

[0012] As a preferred embodiment, in the method of the present invention, no other substrates need to be added during co-culturing, only the fungus or the culture of the fungus, the lignocellulosic biomass and the fermentation culture solution are required, which reduces the complexity of the operation and also greatly reduces the production cost.

[0013] Among them, the fermentation culture medium refers to any solution suitable for the proliferation and / or metabolic enzyme production of Aspergillus giganteus. Specific fermentation culture media are disclosed in the prior art. In one example of the present invention, the following solution is used: 2% urea, 2% glucose, 0.5% KH2PO4, 0.5% MgSO4, all in mass percentages.

[0014] Of course, those skilled in the art can also add other substrates to the system during co-culture according to actual needs. The selection of other substrates is disclosed in the prior art. Such technical solutions including the addition of other substrates are also within the protection scope of the present invention. The method of the present invention without adding other substrates (i.e., only adding Aspergillus giganteus or its culture, fermentation culture medium, and lignocellulosic biomass) is a preferred solution.

[0015] Through further exploration and research, the inventors of the present application found that the above method of degrading lignocellulosic biomass with microorganisms combined with a pretreatment step, that is, pretreating the lignocellulosic biomass before co-culture, will greatly improve the degradation efficiency.

[0016] The so-called pretreatment can be to treat the lignocellulosic biomass by methods such as acid treatment, alkali treatment, enzyme treatment, etc. For example, soaking the lignocellulosic biomass with an alkali solution. Among them, the types and dosages of acids, alkalis, or enzymes used can be in the manner disclosed in the prior art. For example, the alkali solution used in alkali treatment can be calcium hydroxide (Ca(OH)2), calcium oxide (CaO), ammonia (NH3), sodium hydroxide (NaOH), sodium carbonate (NaCO3), potassium hydroxide (KOH), urea, and / or any combination thereof.

[0017] Through further exploration and research, the inventors of the present application found that alkali treatment can be carried out at room temperature. This discovery is very valuable, which will greatly reduce the operation cost and is very beneficial to the scale-up of the process.

[0018] Room temperature generally refers to 20°C - 28°C, or refers to 25°C.

[0019] In the method of the present invention, after soaking with the alkali solution, the pH value is generally adjusted to neutral, then dried, and the obtained product is mixed with the bacteria.

[0020] In the above method of the present invention, it can be any strain within the species Aspergillus giganteus. As a preferred solution, the strain Aspergillus giganteus ZQJ202301 isolated by the present invention is adopted.

[0021] The present invention also claims protection for the strain Aspergillus giganteus ZQJ202301.

[0022] The product obtained by any of the above methods also falls within the protection scope of the present invention.

[0023] The present invention also creatively uses the above degradation products for feed. Because the inventors of the present invention found that Aspergillus giganteus can efficiently degrade cellulose, hemicellulose and lignin, and can also produce a large amount of crude protein. When lignocellulosic biomass such as herbaceous materials or agricultural and forestry residues (preferably crop straw) is degraded by Aspergillus giganteus, the contents of the degradation products cellulose, hemicellulose and lignin are greatly reduced, the crude protein content increases, it can be easily absorbed by animals, and the palatability, energy value, protein content and nutritional value are improved. This invention undoubtedly provides a new resource for preparing animal feed, and can turn waste into treasure to achieve full utilization of resources.

[0024] Therefore, the present invention claims protection for using the above degradation products for feed. The feed containing the above degradation products falls within the protection scope of the present invention.

[0025] The application of the product obtained by the method for degrading lignocellulosic biomass with microorganisms as described above in the preparation of animal feed also falls within the protection scope of the present invention. Wherein the lignocellulosic biomass is herbaceous materials or agricultural and forestry residues, etc., preferably crop straw.

[0026] The present invention also provides a method for preparing feed, comprising: (1) treating lignocellulosic biomass such as herbaceous materials or agricultural and forestry residues according to the method for degrading lignocellulosic biomass with microorganisms as described above; (2) using the product obtained in step (1) as a component of the feed.

[0027] In this method for preparing feed, the crop straw is preferably wheat straw, corn straw or rice straw.

[0028] The present invention has discovered another strain of bacteria capable of degrading straw, namely Aspergillus giganteus, which broadens the sources of strains for straw degradation and has a higher degradation efficiency than the prior art. This application provides a new strain of filamentous fungus that is non-toxic and can efficiently degrade cellulose, hemicellulose, and lignin in straw, significantly increasing the crude protein content, improving the nutritional value of straw, and turning straw waste into a valuable resource. Moreover, in the fungal fermentation system of straw, pure straw is used for fermentation without adding additional nutrients, reducing the operating cost and facilitating application in production. Additionally, this application has also invented a method for pretreating straw with NaOH at room temperature, avoiding high-temperature conditions, reducing costs, and significantly improving the quality of subsequent fungal-fermented straw. Description of the Drawings

[0029] Figure 1 Front (left) and back (right) growth states of Aspergillus giganteus on a PDA plate.

[0030] Figure 2 Results of the BLAST alignment of the ITS sequence of the strain with known sequences in the GenBank database.

[0031] Figure 3 Cellulose specific surface areas of untreated and NaOH-treated wheat straw.

[0032] Depository Information

[0033] Strain Name: Aspergillus giganteus ZQJ202301

[0034] Depository Institution: China General Microbiological Culture Collection Center (CGMCC)

[0035] Depository Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing 100101

[0036] Depository Number: CGMCC No. 40911

[0037] Depository Date and Viability Detection Date: November 8, 2023 Detailed Description of the Invention

[0038] The reagents and methods used in the examples are all conventional methods in the art, specifically as follows:

[0039] Potato Dextrose Agar Medium (PDA): 5 g of potato powder, 20 g of glucose, 14.0 g of agar, add distilled water to 1000 ml. Autoclave at 115 °C for 20 min.

[0040] Potato Dextrose Broth (PDB): 5 g of potato powder, 15 g of glucose, 10 g of peptone, 5 g of sodium chloride, add distilled water to 1000 mL. Autoclave at 115 °C for 20 min.

[0041] Sodium carboxymethyl cellulose medium: 1 g of Na&N, 0.9 g of KH2PO4, 0.5 g of KCl, 1.2 g of Na2HPO4, 0.5 g of MgSO4, 0.5 g of yeast extract, 0.5 g of acid-hydrolyzed casein, 5 g of microcrystalline cellulose, 0.2 g of congo red, 15.0 g of agar, add distilled water to 1000 ml. Autoclave at 115 °C for 20 min.

[0042] Ampicillin: Weigh 0.5 g of sodium carbenicillin solid, dissolve it in 10 ml of sterilized water, filter and sterilize, and store at -20 °C after aliquoting. The working concentration is 50 μg / mL, and it is added to the fungal culture medium to inhibit bacterial contaminants.

[0043] Fungal genomic DNA rapid extraction buffer: 100 ml of 1 M Tris-HCl (pH = 8.0), 20 ml of 500 mM EDTA (pH = 8.0), add distilled water to 1000 ml. Autoclave at 121 °C for 15 min.

[0044] Wheat straw powder: Wheat straw is crushed, passed through a 40-mesh sieve and then dried.

[0045] Measurement of cellulose specific surface area: The methylene blue adsorption method is adopted. When the content of methylene blue is controlled at 0 - 5 μg / mL, its content is linearly correlated with the absorbance value of methylene blue at 660 nm. Wheat straw passes through a 40-mesh sieve, and 0.2 g of straw powder is suspended in 25 ml of 4 μg / mL methylene blue solution. Incubate at a constant temperature of 25 °C on a shaker at a rotation speed of 75 r / min for 12 h. Take it out and let it stand for 15 min, centrifuge at 10000 r / min for 15 min, take the supernatant and perform colorimetry at a wavelength of 660 nm to measure the content of methylene blue in the solution. The mass of methylene blue adsorbed by the straw adsorbent per unit mass can be calculated according to formula ① below, and the specific surface area can be calculated according to formula ②:

[0046] ① ②S = q * a

[0047] In the formula: q—the mass of methylene blue adsorbed by the straw sample per unit mass (mg / g); C0—the initial concentration of methylene blue (mg / L); C t —the concentration of methylene blue at time t (mg / L); V—the volume of methylene blue solution (L); m—the mass of the straw sample (g); S—the specific surface area (m 2 / g); a—the area covered by 1 mg of methylene blue on the solid, which is 2.45 m for straw 2 .

[0048] Fungal straw fermentation broth: by weight, 2% urea, 2% glucose, 0.5% KH2PO4, 0.5% MgSO4.

[0049] Fungal PDA plate culture: Inoculate the fungus into a PDA agar plate medium and place it in an incubator at 30°C for 7 days.

[0050] Preparation of fungal fermentation seed liquid: Scrape the mycelium and spores on the PDA plate and inoculate them into 20 mL of PDB liquid medium, and culture them in a constant temperature shaker at 30°C and 200 rpm for 5 days.

[0051] Crude protein content of straw: Weigh 50 mg of the sample in tin foil and place it in a Dumas nitrogen analyzer for determination.

[0052] Determination of cellulose, hemicellulose and lignin in wheat straw: Use the Van Soest fiber analysis method. The straw is boiled with a neutral detergent, and the insoluble residue is neutral detergent fiber (NDF), which mainly includes hemicellulose, cellulose, lignin and silicate. Then it is treated with an acidic detergent, and the remaining residue mainly includes cellulose, lignin and silicate (ADF). The residue after treatment with 72% sulfuric acid is lignin and silicate, and the residue is ashed, and the part escaping during the ashing process is the content of acid detergent lignin (ADL). Cellulose = ADF - ADL, hemicellulose = NDF - ADF.

[0053] Neutral detergent solution: Weigh 30.0 g of sodium dodecyl sulfate, 18.61 g of disodium ethylenediaminetetraacetate, 6.81 g of sodium tetraborate decahydrate, 4.56 g of disodium hydrogen phosphate, and 10.0 mL of triethylene glycol, stir and heat to dissolve in 1 L of water.

[0054] Acidic detergent solution: Weigh 20 g of cetyltrimethylammonium bromide, take 1 mol of H2SO4 solution (30 mL) / 1 L of distilled water, and proper stirring and heating help dissolve.

[0055] Specific operation process:

[0056] Determination of NDF: Number the filter bags with a marker pen, weigh the filter bags and tare (W1). Weigh 0.45 - 0.55 g of the sample (W2) and put it into the filter bag, then seal the bag with a sealer. Place the sample filter bag in a 250 mL beaker, add enough acetone to cover the filter bag, shake and soak for 10 minutes, pour out the acetone, and place the filter bag in the fume hood to air dry. Put it into the ANKOM DELTA fiber analyzer, select NDF, press START. When the neutral solution is injected into the container and starts to stir, manually add 20 g of sodium sulfite Na2SO3 and 4.0 mL of Alpha - amylase. After the washing process is completed, open the lid and take out the sample. Put the filter bag into a 250 mL beaker, add enough acetone to cover the filter bag and soak for 3 - 5 minutes. Take it out of the acetone and place the filter bag in the fume hood to air dry. Dry and weigh (W3). NDF (%) = (W3 - W1) x 100 / W2.

[0057] Determination of ADF: Put the filter bag into the ANKOM DELTA fiber analyzer again, select ADF, press START. After the washing is completed, open the lid and take out the sample. Put the filter bag into a 250 mL beaker, add enough acetone to cover the filter bag and soak for 3 - 5 minutes. Take it out of the acetone and place the filter bag in the fume hood to air dry. Dry and weigh (W4). ADF (%) = (W4 - W1) x 100 / W2.

[0058] Determination of ADL: Put the dried filter bag into a 3 L beaker, add enough 72% sulfuric acid to submerge the filter bag. After 3 hours, pour out the sulfuric acid, and then rinse with water until the pH is neutral. Rinse with 250 mL of acetone for 3 min to remove the water. Dry and weigh (W5). Put the filter bag into a crucible with a known weight (W6), ash it at 600 °C ± 15 °C for 2 hours, cool, and weigh (W7). ADL (%) = [(W5 - W1) - (W7 - W6)] x 100 / W2.

[0059] The calculation formula for the degradation rates of cellulose, hemicellulose, and lignin is: Degradation rate % = (Percentage before fermentation - Percentage before fermentation) / Percentage before fermentation × 100%.

[0060] Example 1, Isolation, Purification, and Identification of Strains

[0061] In October 2022, collect rotten wheat straw and soil from the experimental field of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, Zaojunmiao Road, Haidian District, Beijing. Use shake - flask enrichment culture. Weigh 5 g and inoculate it into a 200 ml PDB conical flask, add antibiotics ampicillin with a final concentration of 100 μg / ml for fungal enrichment, and culture at a constant temperature of 30 °C and 150 rpm. Every 3 days, inoculate it into another 200 ml PDB conical flask with ampicillin added at an inoculation amount of 10% for further enrichment culture. Dilute the supernatant by 10, 10 2 、103 、10 4 times, coat each dilution on a CMC Congo red screening plate and culture at 30 °C. Observe whether single colonies grow on the plate, and select the strains with clear zones around the single colonies for further streak isolation to obtain pure strains. A filamentous fungus was isolated and named ZQJ202301. It is velvety in texture on a PDA plate, with white mycelia, blue-gray or smoky-gray conidia, and white on the back of the plate.

[0062] Sequence the ITS sequence of the strain ZQJ202301, and perform PCR amplification using the fungal universal primers ITS1 and ITS4 primer pair. First, perform rapid extraction of fungal DNA: Pick the mycelia into a test tube, add 50 μl of rapid extraction buffer, boil in a water bath for 10 min, ice bath for 2 min, centrifuge at 12000 rpm for 10 min, and use the supernatant as the PCR template. PCR reaction system (50 μL): PCR mix (25 μL), primer ITS1 (10 μmol / L, 2 μL), primer ITS4 (10 μmol / L, 2 μL), fungal DNA (10 μL), ddH2O (11 μL). Reaction program: 94 °C for 5 min; 94 °C for 30 s, 58 °C for 30 s, 72 °C for 30 s, 30 cycles; 72 °C for 8 min; hold at 4 °C. Take 5 μL of the PCR product and detect it on a 1% agarose gel electrophoresis. After the electrophoresis, observe the results with a gel imaging system. Send the PCR product with the correct band size to a biological company for sequencing, and the sequence is shown as SEQ ID NO: 1. Compare the returned sequence with the known sequences in the GenBank database by BLAST, and it has 100% homology with the ITS sequence of Aspergillus giganteus.

[0063] Observation under the microscope: Place a drop of lactic acid phenol solution on a glass slide, pick a small piece of fungal culture with an inoculation hook and place it in the lactic acid-phenol solution, gently tear the culture into small pieces with two separating needles, then cover with a cover slip and observe the morphological characteristics of the mycelia and spores under the microscope. The mycelia have septa, the conidiophores are long rod-shaped, the top expands to form a spherical shape, and small branches grow radially on the surface. Elliptical conidia are strung on the top of the small branches. Combining the morphological characteristics of the mycelia with the molecular identification results, it is determined that the strain is Aspergillus giganteus. This strain has been deposited in the Patent Procedure, deposited in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms (No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing), and the deposit number is CGMCC No. 40911.

[0064] Sequencing sequence (SEQ ID NO: 1)

[0065] CCGGCCGGGCCTACAAGAGCGGGTGACAAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGG

[0066] CCCGTCCCCGCGGTGAGGCGGGGACGGGGGCCCAACACACAAGCCGTGCTTGAGGGCAGCAATGACGCTCGGACAGG

[0067] CATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTT

[0068] ATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTGATTATGATAATCAAC

[0069] TCAGACTGCAAAACTTCAGAACAGAGTTCATGTTGTGGTCTTCGGCGGGCGCGGGCCCGGGGGCGCGGAGGCCTCCCC

[0070] GGCGGCCGTCCGAAGACGGCGGGCCCGCCGAAGCAACAAGGTACAATAGACACGGGTGGGAGGTTGGACCCAGAG

[0071] Example 2, Treatment of Wheat Straw with NaOH

[0072] Alkali treatment of straw: Weigh the wheat straw that has passed through a 40-mesh sieve into a large beaker, measure 5% sodium hydroxide with a mass 10 times that of the straw and mix it with the straw, stir well to completely immerse the straw in the sodium hydroxide solution, and let it stand at room temperature for 24 h. Then use phosphoric acid solution to adjust the pH of the wheat straw solution soaked in sodium hydroxide to neutral. Pour out the water and dry it to obtain alkali-treated wheat straw for subsequent fungal fermentation. The treatment temperature in this method is room temperature, the conditions are mild, and the energy consumption is low. The amount of alkali used in alkali treatment is small, which is beneficial to reducing costs, protecting the environment, and large-scale production.

[0073] After wheat straw is treated with NaOH, the ester bonds between lignin macromolecules are broken, lignin depolymerizes, and its content decreases; NaOH also breaks the ester bonds and ether bonds in hemicellulose, causing hemicellulose to degrade and its content to decrease; the decrease in the contents of lignin and hemicellulose results in a relatively increased proportion of cellulose (Table 1). Generally, specific surface area is used as a characteristic value to characterize the size of the contact area between cellulose microfibrils and cellulase molecules for degradation. After NaOH treatment, the specific surface area of cellulose in wheat straw increases, enabling more enzyme molecules to act on cellulose degradation, facilitating the subsequent enzymatic hydrolysis and fermentation processes, improving the palatability of straw, and making it easier for animals to digest.

[0074] Table 1 Effects of NaOH treatment on the composition of wheat straw

[0075] Cellulose Hemicellulose Lignin Untreated 43.87±0.51 22.39±0.47 15.58±0.23 NaOH-treated 60.15±0.76 17.81±0.32 13.98±0.30

[0076] Example 3 Application of bacteria in the biological fermentation of wheat straw

[0077] 20 g of wheat straw powder or NaOH-treated straw powder, with the ratio of wheat straw powder to fungal straw fermentation broth being 1:2. Filter the cultured fungal fermentation seed broth to remove the liquid, and thoroughly stir and mix the mycelium with the wheat straw powder and fungal straw fermentation broth. Place it in an incubator at a constant temperature of 30 °C for 20 days, then take out the straw and dry it to a constant weight. Using the straw powder without inoculation as a control, measure the degradation rates of cellulose, hemicellulose, and lignin in the straw and the crude protein content.

[0078] The results show that the treatment with Aspergillus giganteus ZQJ202301 can degrade cellulose, hemicellulose, and lignin in wheat straw to varying degrees, with degradation rates of 25.85%, 16.48%, and 9.69% respectively; the crude protein content increases from 3.47% to 4.36%, an increase of 25.65%. If wheat straw powder is pretreated with NaOH and then inoculated with Aspergillus giganteus for fermentation, the degradation rates of cellulose, hemicellulose, and lignin in the straw can be further increased, reaching 31.24%, 22.12%, and 13.30% respectively; the protein content increases from 3.05% to 5.89%, an increase of 69.774%, achieving further improvement.

[0079] Table 2 Degradation rates of cellulose, hemicellulose, and lignin in different treatment groups (%)

[0080] Cellulose Hemicellulose Lignin Fungal fermentation of wheat straw 25.85 16.48 9.69 Fungal fermentation of NaOH-treated wheat straw 31.24 22.12 13.30

Claims

1. A method for degrading lignocellulosic biomass with microorganisms, comprising the following steps: mixing a culture of Aspergillus giganteus ( Aspergillus giganteus ), or Aspergillus giganteus ( Aspergillus giganteus ) with lignocellulosic biomass and co-culturing to degrade the lignocellulosic biomass; the Aspergillus giganteus ( Aspergillus giganteus ) is Aspergillus giganteus ( Aspergillus giganteus ) ZQJ202301, and its preservation number in the patent procedure is CGMCC No. 40911.

2. The method according to claim 1, wherein: Before mixing the Aspergillus giganteus ( Aspergillus giganteus ), with lignocellulosic biomass, the following steps are included: soaking the lignocellulosic biomass with an alkali solution.

3. The method according to claim 2, wherein: The soaking is carried out at room temperature.

4. The method according to any one of claims 1 to 3, characterized in that: The method includes the step of adding a fermentation broth before co-cultivation, and the fermentation broth refers to a solution suitable for the proliferation and / or enzyme production by Aspergillus giganteus.

5. The method according to claim 4, characterized in that: The co-culture system consists of the Aspergillus giganteus ( Aspergillus giganteus ) or its culture, lignocellulosic biomass, and fermentation broth.

6. The method according to any one of claims 1 to 3, characterized in that: The degradation of the lignocellulosic biomass includes the degradation of cellulose, hemicellulose, and / or lignin in the lignocellulosic biomass.

7. The method according to claim 6, characterized in that: The lignocellulosic biomass is straw.

8. A strain of Aspergillus giganteus, which is Aspergillus giganteus ( Aspergillus giganteus ) ZQJ202301, and its deposit number for deposit in the patent procedure is CGMCC No. 40911.

9. A method for preparing feed, comprising: (1) Treat the lignocellulosic biomass with a microorganism according to the method described in any one of claims 1-7; (2) Use the product obtained in step (1) as a component of the feed.

10. The method according to claim 9, wherein: The lignocellulosic biomass is herbaceous material or agricultural and forestry residues.

11. The method according to claim 10, characterized in that: The lignocellulosic biomass is crop straw.

12. The method according to claim 11, characterized in that: The crop straw is wheat straw, corn straw, or rice straw.

13. Use of the product obtained by the method described in any one of claims 1-7 in the preparation of feed.

Images