SgRNA targeting ush2a gene and method for knocking out cynomolgus monkey ush2a gene

Abstract

The present application belongs to the field of biotechnology, and discloses sgRNA targeting Ush2a gene and a method for knocking out Ush2a gene of Macaca fascicularis. The method mainly establishes a target sequence for mRNA of Ush2a gene of Macaca fascicularis and synthesizes corresponding sgRNA, then constructs a knockout vector, mixes sgRNA and Cas9 mRNA, and injects them into an embryo of Macaca fascicularis to obtain an embryo of Macaca fascicularis with Ush2a gene knocked out, and then obtains a Macaca fascicularis with USH2A gene knocked out through embryo transplantation. The present application can effectively realize gene knockout of Ush2a gene on the embryo of Macaca fascicularis and offspring Macaca fascicularis through knockout effect detection and identification, and provides a new and effective method for establishing an animal model of non-human primate retinal lesion and genetic deafness.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, more particularly, it relates to sgRNA targeting Ush2a gene and a method for knocking out cynomolgus monkey Ush2a gene. BACKGROUND

[0002] The USH2A gene is located on chromosome 1q41, and the protein Usherin encoded by the USH2A gene is expressed in both human retina and cochlea, and plays an important role in maintaining the structure and function of retinal photoreceptor cells and inner ear hair cells. USH2A mutation can cause non-syndromic retinitis pigmentosa (nRP) and Usher syndrome type II (USH II). So far, the pathogenesis of USH2A gene mutation RP / USH II is unclear, and the treatment means is limited. According to statistics, 50-75% of all Usher syndrome patients are caused by USH2A gene mutation; 12-25% of RP patients are caused by USH2A gene mutation. More than 690 pathogenic mutations of USH2A have been found so far, including splicing mutations, deletion mutations and missense mutations, but most of the mutation sites belong to complex heterozygous mutation types. Even the same mutation in the same family, the development process of clinical manifestations also has great difference, which greatly increases the complexity of analyzing the genetic rules of the disease.

[0003] Non-syndromic retinitis pigmentosa (nRP) and Usher syndrome type II (USH II) are known to be associated with Ush2a mutation. nRP is characterized by gradual decline in visual function in early adulthood, and no rod and cone response in electroretinogram, which is a progressive disease characterized by night blindness as the first symptom, and patients have difficulty in dark adaptation, walking in dark light or at night. The binocular visual field gradually shrinks centripetally, and early visual field annular defect gradually develops into tubular vision or blindness, and vision is progressively reduced. With further development of the disease, the central vision is impaired, and half of the patients become blind in middle age. USH II is characterized by not only gradual decline in visual function in early adulthood, showing retinal degeneration of nRP, but also moderate to severe sensorineural hearing loss in patients, showing a curve downward, with mild to moderate decline in low frequency and severe decline in high frequency.

[0004] Currently, only zebrafish and mouse models of animal models with mutations in the USH2A gene have been reported. However, the retinal and auditory pathologies of zebrafish and mouse gene mutation models are inconsistent with the disease progression in humans, making it difficult to accurately simulate the pathogenesis and development of USH2A mutation retinal degenerative diseases. However, there are no reports on primate models of USH2A gene editing. The use of cynomolgus monkeys as models for retinal degeneration and auditory deafness is more convincing than previous studies in zebrafish and rodents. There is no detailed report on how the inner layer neurons of the retina change at different ages after birth in mammals, and relatively little research on the morphology of Ush2a retinal lesions. SUMMARY

[0005] The technical problem to be solved by the present application is to overcome the above-mentioned problems existing in the prior art. First, a sgRNA combination targeting the Ush2a gene is provided.

[0006] A second object of the present application is to provide the use of the sgRNA combination.

[0007] A third object of the present application is a method for constructing a cynomolgus monkey animal model targeting Ush2a gene knockout.

[0008] The object of the present application is achieved by the following technical solutions:

[0009] The sgRNA combination targeting the Ush2a gene is selected from USH-1, USH-2, USH-3, and USH-4, wherein USH-1 is composed of sgRNA1-1 and sgRNA1-10, USH-2 is composed of sgRNA1-1 and sgRNA1-2, USH-3 is composed of sgRNA1-1 and sgRNA1-7, and USH-1 is composed of sgRNA1-2 and sgRNA1-7; wherein the sequences of sgRNA1-1, sgRNA1-2, sgRNA1-7, and sgRNA1-10 are shown in SEQ ID NO: 1-4, respectively.

[0010] The present application provides a sgRNA targeting the Ush2a gene and performs related cynomolgus monkey Ush2a gene knockout to construct a related model. The present application provides a new idea for modeling, early diagnosis, intervention, blocking, and treatment of Ush2a retinal lesions.

[0011] Preferably, the sgRNA combination is USH-1.

[0012] The present application also provides the use of the sgRNA combination, which at least includes one of the following aspects:

[0013] (1) Knockout of the Ush2a gene;

[0014] (2) Constructing / screening an animal model of genetic deafness-retinitis pigmentosa syndrome;

[0015] (3) Constructing / screening an animal model of sensorineural hearing loss;

[0016] (4) Constructing / screening an animal model of retinal pigment degeneration.

[0017] The application also provides a method for constructing an animal model of a cynomolgus monkey with a Ush2a gene knockout, comprising the following steps:

[0018] (1) synthesizing the sgRNA in claim 1 or 2 in vitro, mixing the sgRNA with Cas9 mRNA, and then injecting the mixture into a cynomolgus monkey embryo to obtain a cynomolgus monkey embryo with a Ush2a gene knockout;

[0019] (2) transplanting the cynomolgus monkey embryo with the Ush2a gene knockout into a surrogate female monkey in vivo to obtain a cynomolgus monkey offspring with a USH2A gene knockout.

[0020] The method is a gene knockout method for a cynomolgus monkey embryo, which knocks out the Ush2a gene of the cynomolgus monkey, and thus provides a new effective method for manufacturing a non-human primate tumor animal model.

[0021] Preferably, the operation steps for synthesizing the sgRNA in vitro are as follows:

[0022] (1) designing and synthesizing primers according to the sgRNA for knocking out the Ush2a gene in claim 1 or 2, and then performing PCR amplification with the px459 vector as a template to obtain a transcription DNA template;

[0023] (2) transcribing the transcription DNA template obtained in step (1) to obtain the sgRNA.

[0024] Preferably, the nucleotide sequence of the primers is as follows:

[0025] Ush2a gRNA 1-1F:

[0026] 5'-TAATACGACTCACTATAGATTGACAAAAGAGAGAGGATGGGTTTTAGAGCTAGAAATA GC-3';

[0027] gRNA PCRR: 5'-AGCACCGACTCGGTGCCACTT-3';

[0028] Ush2a gRNA 1-2F:

[0029] 5'-TAATACGACTCACTATAGCAGCTGATAATAGAGTGTCACGGGTTTTAGAGCTAGAAAT AGC-3';

[0030] gRNAPCRR: 5'-AGCACCGACTCGGTGCCACTT-3';

[0031] Ush2a gRNA 1-7F:

[0032] 5'-TAATACGACTCACTATAGGGGTCCACCCTTTGGCACAGCGGTTTTAGAGCTAGAA ATAGC-3';

[0033] gRNAPCRR: 5'-AGCACCGACTCGGTGCCACTT-3';

[0034] Ush2a gRNA 1-10F:

[0035] 5'-TAATACGACTCACTATAGTTATCATTGACAAAAGAGAGAGGTTTTAGAGCTAGAAATA GC-3';

[0036] gRNAPCRR: 5'-AGCACCGACTCGGTGCCACTT-3'.

[0037] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0038] (1) This invention provides four highly efficient knockout targets for the Ush2a gene in cynomolgus monkeys.

[0039] (2) The present invention has been tested and identified as being able to effectively knock out the Ush2a gene in cynomolgus monkey embryos and cynomolgus monkeys, laying a solid foundation for establishing animal models of retinal degeneration and sensorineural hearing loss in non-human primates. Attached Figure Description

[0040] Figure 1 This is a diagram showing the results of sgRNA knockout in cynomolgus monkey embryos; as shown. Figure 1 As shown, all the combined sgRNAs exhibited editing activity in cynomolgus monkey embryos. The sgRNA combinations were: USH-1: sgRNA1-1 and sgRNA1-10; USH2: sgRNA1-2 and sgRNA1-7; USH-3: sgRNA1-1 and sgRNA1-7; USH-4: sgRNA1-2 and sgRNA1-7; 1-18 were numbered as cynomolgus monkey embryos.

[0041] Figure 2USH-1 combined sgRNA mutant embryo sequencing peak chart;

[0042] Figure 3 USH-2 combined sgRNA mutant embryo sequencing peak chart;

[0043] Figure 4 USH-3 combined sgRNA mutant embryo sequencing peak chart;

[0044] Figure 5 USH-4 combined sgRNA mutant embryo sequencing peak chart;

[0045] Figure 6 USH-1 combined embryo editing efficiency column chart;

[0046] Figure 7 USH2A gene sequencing peak chart of peripheral blood of a born-offspring cynomolgus monkey edited by using sgRNA combined for USH-1;

[0047] Figure 8 USH2A gene expression and retinal current map of a born-offspring cynomolgus monkey edited by using sgRNA combined for USH-1 and the cynomolgus monkey. DETAILED DESCRIPTION

[0048] The specific embodiments of the present application are further described below. It is to be understood that the description of these embodiments is intended to help understand the present application, but does not constitute a limitation on the present application. In addition, the technical features involved in each of the embodiments of the present application described below can be combined with each other as long as they do not conflict with each other.

[0049] Example 1 Knockout of Ush2a gene in cynomolgus monkey embryo

[0050] The USH2A gene editing exon nucleotide sequence (SEQ ID NO: 7) is:

[0051] AGAGATTCTGGAAGTTTTTTCATTGACAAAAGAGAGAGGATGGGTGGTGGAGATCTTCTCAGATTGCATGCCCAATCACATTGCCGTTGCCCTGGCAGCCACCCGCGGGTCCACCCTTTGGCACAGCGGTACTGCATTCCTAACGATGCAGGAGACACAGCTGATAATAGAGTGTCACGGTTGAATCCTGAAGCCCATCCTCTCTTTTGTCAATGATAATGATGTTGGGACTTCATGGGTTTCAAATGTGTTTACAAACGTTACACAACTTAATCAAGGAGTGACTATTTCAGTTGACTTGGAAAATGGACAGTATCAG.

[0052] 1. Synthesis of sgRNA in vitro

[0053] (1) Select sgRNA 1-1, sgRNA 1-2, sgRNA 1-7, sgRNA 1-10 design primers, wherein the nucleotide sequence of the primer is as follows:

[0054] Ush2a gRNA 1-1F:

[0055] 5'-TAATACGACTCACTATAGATTGACAAAAGAGAGAGGATGGGTTTTAGAGCTAGAAATAGC-3';

[0056] gRNA PCRR: 5'-AGCACCGACTCGGTGCCACTT-3';

[0057] Ush2a gRNA 1-2F:

[0058] 5'-TAATACGACTCACTATAGCAGCTGATAATAGAGTGTCACGGGTTTTAGAGCTAGAAATAGC-3';

[0059] gRNA PCRR: 5'-AGCACCGACTCGGTGCCACTT-3';

[0060] Ush2a gRNA 1-7F:

[0061] 5'-TAATACGACTCACTATAGGGGTCCACCCTTTGGCACAGCGGTTTTAGAGCTAGAAATAGC-3';

[0062] gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3'.

[0063] Ush2a gRNA 1-10F:

[0064] 5'-TAATACGACTCACTATAGTTATCATTGACAAAAGAGAGAGGTTTTAGAGCTAGAAATA GC-3';

[0065] gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3'.

[0066] The transcription DNA template was obtained by PCR amplification using the px459 vector as a template, and T7-sgRNA-F and gRNA-PCR-R as amplification primers, and the PCR amplification system is shown in Table 1.

[0067] Table 1 PCR amplification system

[0068]

[0069] (2) The sgRNA was obtained by transcription (Beijing Weishanlide T7 transcription kit) and purification of the transcription DNA template prepared in step (1), and the transcription system is shown in Table 2.

[0070] Table 2 sgRNA in vitro transcription system

[0071]

[0072] (3) Development of embryos after injection of vectors

[0073] The sgRNA 1-1, sgRNA 1-2, sgRNA 1-7, sgRNA 1-10: 50 ng / μL (mixed final concentration) and Cas9 mRNA (purchased) 100 ng / μL (mixed final concentration) were mixed and injected into 18 cynomolgus monkey embryos, respectively, using embryonic microsurgical technology, and the development of the injected embryos was observed.

[0074] (4) Verification of embryo target site knockout

[0075] 10 μL of proteinase K lysis solution was added to the embryos, mixed and lysed, and then reacted in a PCR instrument according to the program in Table 3 (the top cover temperature was 70°C).

[0076] Table 3 Embryo lysis reaction program

[0077]

[0078]

[0079] The cleavage solution obtained from the above reaction was used as a template for PCR amplification (amplification system shown in Table 4), and the nucleotide sequences of the primers used are as follows:

[0080] Ush2a-F3: 5'-CATGAAAGCACTAAACGAGTGACA-3';

[0081] Ush2a-R3: 5'-ACACCTTATCGTTTCTCATTACCTG-3'.

[0082] Table 4 PCR amplification system

[0083]

[0084] To improve the efficiency of embryo gene editing, sgRNA was combined for embryo injection, and it was found that the combination of sgRNA1-1, sgRNA1-2, sgRNA1-7, and sgRNA1-10 was injected with a carrier. The combination forms are shown in Table 5 below.

[0085] Table 5 sgRNA combination form

[0086]

[0087] The final PCR product was sequenced, and according to the sequencing results, it can be determined that the combination of sgRNA USH-1, USH-2, USH-3, and USH-4 works in the embryo, causing the target gene to be knocked out, wherein the editing efficiency of the embryo with the combination of USH-1 is close to 100% ( Figure 6 ).

[0088] Example 2 Knockout of Ush2a gene in cynomolgus monkeys

[0089] To obtain a USH2A gene knockout cynomolgus monkey model, the embryos injected with any combination of sgRNA described above were cultured to blastocysts, and then transplanted into the uterus of a surrogate female monkey. After the offspring monkey was born, the blood of the offspring monkey was taken for knockout analysis of the USH2A gene target site fragment and characterization analysis of the offspring cynomolgus monkey retinal lesions ( Figure 7 ). From the sequencing results, it can be seen that the USH2A gene knockout monkey has a loss of 5 bases in the gene target fragment.

[0090] It can be seen from the qPCR result that the expression amount of the USH2A gene of the gene knockout cynomolgus monkey (M5) is significantly lower than that of the control group cynomolgus monkey (WT); at the same time, the retinal current determination is performed on the 5-month-old gene knockout cynomolgus monkey (M5), and the result shows that the a-wave amplitude of the retinal current is significantly lower than that of the control group, and it can be concluded that the retinal function of the USH2A gene knockout cynomolgus monkey has been obviously damaged.

[0091] The results show that the USH-1 combined sgRNA edited embryo, through embryo transplantation, obtains the offspring retinal lesion cynomolgus monkey with the USH2A gene knockout.

[0092] The above describes the embodiments of the present application in detail, but the present application is not limited to the described embodiments. For those skilled in the art, various changes, modifications, replacements and variations of the embodiments are made without departing from the principles and spirits of the present application, and still fall within the protection scope of the present application.

Claims

1. A combination of sgRNAs targeting the Ush2a gene of Macaca fascicularis, characterized in that, The sgRNA combination is USH-1, and the USH-1 is composed of sgRNA1-1 and sgRNA1-10, wherein the sequences of sgRNA1-1 and sgRNA1-10 are shown in SEQ ID NO: 1 and SEQ ID NO: 4, respectively.

2. Use of the sgRNA combination of claim 1, characterized in that, The application is at least one of the following aspects: (1) Knockout of Ush2a gene in cynomolgus monkeys; (2) Construction of a retinitis pigmentosa cynomolgus monkey animal model.

3. A method of constructing an animal model of Ush2a knockout cynomolgus monkey, characterized by, The method comprises the following steps: (1) Synthesizing the sgRNA combination in claim 1 in vitro, mixing with Cas9 mRNA, and then injecting into cynomolgus monkey embryos to obtain Ush2a gene knockout cynomolgus monkey embryos; (2) Transplanting the Ush2a gene knockout cynomolgus monkey embryos into surrogate female monkeys in vivo to obtain Ush2a gene knockout offspring cynomolgus monkeys.

4. The method of claim 3, wherein the cynomolgus animal model is constructed by, The operation steps for synthesizing the sgRNA combination in vitro are as follows: (1) According to the sgRNA combination for targeting the Ush2a gene of cynomolgus monkeys in claim 1, designing and synthesizing primers, then performing PCR amplification with the px459 vector as a template to obtain a transcription DNA template; (2) Transcribing the transcription DNA template prepared in step (1) to obtain the sgRNA combination.

5. The method of claim 4, wherein the cynomolgus animal model is constructed by, The nucleotide sequences of the primers are as follows: Ush2a gRNA 1-1 F: 5'-TAATACGACTCACTATAGATTGACAAAAGAGAGAGGATGGGTTTTAGAGCTAGAAATAGC-3'; gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3'; Ush2a gRNA 1-10 F: 5'-TAATACGACTCACTATAGTTATCATTGACAAAAGAGAGAGGTTTTAGAGCTAGAAATAGC-3'; gRNA PCR R: 5'-AGCACCGACTCGGTGCCACTT-3'.

Images