A dsRNA for controlling the stored-grain pest Rhizopertha dominica and its application

Abstract

The present invention provides a dsRNA for controlling the stored - grain pest Rhyzopertha dominica and its application, belonging to the technical field of prevention and control of stored - grain pests. The dsRNA for controlling the stored - grain pest Rhyzopertha dominica is prepared by a method comprising the following steps: reverse - transcribing the total RNA of Rhyzopertha dominica into cDNA, using the cDNA as a template, performing PCR amplification with the primer pair shown in SEQ ID No.1 and SEQ ID No.2, and in vitro transcribing the PCR amplification product into dsRNA, thus obtaining the dsRNA for controlling the stored - grain pest Rhyzopertha dominica. The dsRNA of the present invention is a targeted agent against the RDROP gene of Rhyzopertha dominica, and can effectively control the stored - grain pest Rhyzopertha dominica after application.

Description

Technical Field

[0001] The present invention belongs to the technical field of prevention and control of pests in grain storage, and specifically relates to a dsRNA for controlling the stored-grain pest Rhyzopertha dominica and its application. Background Art

[0002] Rhyzopertha dominica, also known as the rice borer, is a common small-sized stored-grain pest belonging to the Coleoptera order and the Bostrichidae family. Rhyzopertha dominica prefers warm temperatures and likes to survive in relatively high temperatures. With the frequent circulation of grains globally, the phenomenon of Rhyzopertha dominica infestation has currently occurred in most countries. The widespread distribution of Rhyzopertha dominica worldwide has caused serious harm to the grain industry. During the growth and development of Rhyzopertha dominica, a large amount of powder produced by its boring into grain kernels will reduce the permeability of the grain heap. At this time, the temperature inside the grain heap rises, and the grains will mildew, seriously affecting the quality of the grains and making the grains lose their edible value.

[0003] In 1983, it was first reported abroad that Rhyzopertha dominica developed resistance to phosphine, and since then, high resistance to phosphine has been found in many regions. As the resistance of Rhyzopertha dominica to phosphine increases, in order to achieve the desired insecticidal effect, only the method of increasing the concentration of phosphine can be used for fumigation. However, studies have shown that in a high-concentration phosphine environment, Rhyzopertha dominica will produce a protective coma phenomenon, which will greatly reduce the fumigation effect of phosphine. Therefore, in order to effectively prevent and control the stored-grain pest Rhyzopertha dominica, especially high-resistant Rhyzopertha dominica strains, new control agents and technologies are urgently needed to ensure food security. Summary of the Invention

[0004] The purpose of the present invention is to provide a dsRNA for controlling the stored-grain pest Rhyzopertha dominica, which is a targeted agent against the RDROP gene of Rhyzopertha dominica. After application, it can effectively control the stored-grain pest Rhyzopertha dominica.

[0005] The present invention also provides the application of the dsRNA for controlling the stored-grain pest Rhyzopertha dominica.

[0006] The purpose of the present invention is achieved by adopting the following technical solutions:

[0007] A dsRNA for controlling the stored-grain pest Rhyzopertha dominica is prepared by a method including the following steps: reverse transcribing the total RNA of Rhyzopertha dominica into cDNA, using the cDNA as a template, performing PCR amplification with the primer pair shown in SEQ ID No.1 and SEQ ID No.2, and in vitro transcribing and synthesizing the PCR amplification product into dsRNA, thus obtaining the dsRNA for controlling the stored-grain pest Rhyzopertha dominica.

[0008] In the present invention, the PCR amplification system includes: 1 μL of template, 0.45 μL each of upstream primer and downstream primer, TaKaRa Taq TM12 μL of PCR Master Mix and 11.1 μL of RNase-free water.

[0009] In the present invention, the procedure of the PCR amplification includes: pre-denaturation at 93°C for 5 min; denaturation at 94°C for 1 min, annealing at 57°C for 1 min, extension at 72°C for 3 min, for 55 cycles; and re-extension at 72°C for 8 min.

[0010] The present invention also provides the application of the dsRNA in controlling the stored-grain pest Rhyzopertha dominica.

[0011] In the present invention, the application includes the steps of slicing wheat grains and dropping the dsRNA used for controlling the stored-grain pest Rhyzopertha dominica.

[0012] In the present invention, the concentration of the dsRNA used for controlling the stored-grain pest Rhyzopertha dominica is 1400 - 1600 ng / μL, and the application dose is 1 - 2 μL / grain.

[0013] Beneficial effects: The dsRNA for controlling the stored-grain pest Rhyzopertha dominica in the present invention is a targeted agent against the RDROP gene of Rhyzopertha dominica. The stored-grain pest Rhyzopertha dominica undergoes metamorphosis, and during its growth and development process, it is regulated by related genes to complete the process of transforming from larvae to adults. After the targeted agent of the RDROP gene for controlling the stored-grain pest Rhyzopertha dominica provided by the present invention is dropped onto the sliced wheat grains and absorbed, when the stored-grain pest Rhyzopertha dominica (including sensitive and resistant populations) feeds on it, the growth and development regulation function of the RDROP gene in its body fails, thereby blocking the transformation of the larvae of the stored-grain pest Rhyzopertha dominica into adults, achieving the purpose of efficiently killing the stored-grain pest Rhyzopertha dominica. Through experimental verification, the dsRNA of the present invention can effectively control the phosphine-resistant Rhyzopertha dominica population, with a reliable method and stable effect. Description of the Drawings

[0014] Figure 1 It is an agarose gel electrophoresis diagram, where M is the DNA Marker and 1 is the amplification product of the target gene. Detailed Embodiments

[0015] The present invention does not particularly limit the method for extracting the total RNA, as long as the OD of the extracted RNA 260 / OD 280 is within the range of 1.8 - 2.2. In the examples, the total RNA was extracted according to the instructions of an insect RNA column extraction kit (purchased from Beijing Biolab Technology Co., Ltd.), but it cannot be considered as the entire protection scope of the present invention.

[0016] The present invention also does not particularly limit the method for reverse-transcribing RNA into cDNA, and conventional methods in the art can be used. For example, in the examples of the present invention, the method of The first-strand cDNA was synthesized using the II 1st Strand cDNA Synthesis Kit (+gDNA wiper).

[0017] To further illustrate the present invention, a RDROP gene-targeted agent for controlling Rhyzopertha dominica, a stored grain pest, and its application provided by the present invention will be described in detail below in conjunction with the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0018] Example 1 Determination of the resistance of test insects to phosphine

[0019] The collected Rhyzopertha dominica test insects (Table 1) were used to determine the resistance of the test insects to phosphine (PH 3 ) according to the drainage method device and method recommended by the Food and Agriculture Organization of the United Nations (hereinafter referred to as FAO) (Anonymous. Recommended Methods for the Detection and Measurement of Resistance of Agricultural Pests to Pesticides. Teantative Method for Adults of Some Major Pest Species of Stored Cereals, with Methyl Bromide and Phosphine[J]. FAO Plant Protection Bulletin, 1975, 23: 12 - 25.).

[0020] PH 3 The gas was prepared by the reaction of zinc phosphide with 10% sulfuric acid.

[0021] The method for detecting the resistance of Rhizopertha dominica to phosphine recommended by FAO is adopted, including the following steps: 50 adult insects are selected for each fumigation bottle, sealed with a high-vacuum silicone grease glass stopcock, and phosphine gas is extracted using a syringe and injected into the bottle through the rubber stopper. The bottle is placed in a constant temperature and humidity incubator at (30±1)°C, RH 75%±5%, and without light for about 20 h of sealed fumigation. Then, according to the volume of the fumigation bottle and the volume of the injected phosphine gas, the concentration of phosphine is calculated. Three replicate groups are set for each concentration, and the same volume of air is injected to form a control. After the fumigation time ends, the glass stopcock of the fumigation bottle is opened in a fume hood, and the test insects are taken out of the fumigation bottle after about 1 h for the gas to fully disperse. Then, the Rhizopertha dominica are placed in an incubator with sufficient feed and observed for 14 d. The adult insects whose limbs do not move when gently touched with a writing brush at the tail are regarded as dead test insects. The mortality rate of the test insects in each concentration group is recorded, and the resistance coefficient of Rhizopertha dominica is calculated according to the resistance calculation formula (Wang Jinglei, Wang Dianxuan, Xiao Yabin, et al. Research on the determination of phosphine resistance and countermeasures of stored grain pests in Liaoning region [J]. Grain & Feed Industry, 2014(9): 16-18+23.).

[0022] When the resistance coefficient Rf is less than 5, it is determined as a non-resistant population (sensitive population). When the resistance coefficient Rf is greater than or equal to 5, it is determined as a resistant population. Among them, when the resistance coefficient Rf is greater than or equal to 40 and less than or equal to 160, it is determined as a highly resistant population. When the resistance coefficient Rf is greater than 160, it is determined as an extremely highly resistant population.

[0023] The determination results of the tested Rhizopertha dominica population are shown in Table 1.

[0024] Table 1 Tested Rhizopertha dominica population

[0025] Serial number Source Phosphine resistance coefficient Rf Resistance level 1 Grain depot 4.00 Non-resistant 2 Processing factory 57.15 Highly resistant 3 Processing factory 1173.63 Extremely highly resistant

[0026] Example 2 Synthesis and application of dsRNA

[0027] 1. Rearing of test insects

[0028] Whole wheat flour (with the moisture content of whole wheat flour controlled at 15%±1%) and yeast powder are mixed at a mass ratio of 19:1 to obtain the feed for rearing Rhizopertha dominica. The Rhizopertha dominica populations with the resistance levels determined by the tests in Table 1 are used as the test insects for rearing respectively. The rearing environment of the test insects is a constant temperature and humidity incubator at 30°C±1°C, relative humidity 70%±5%, and without light. The adult Rhizopertha dominica after eclosion (cultured in the same batch and at the same instar) are selected for subsequent tests.

[0029] 2. Extraction of total RNA from test insects

[0030] Take 10 adults of *Rhyzopertha dominica* with no resistance, high resistance, and extremely high resistance obtained by culturing in this example, and extract total RNA according to the instructions of the Insect RNA Column Extraction Kit (purchased from Beijing Biolegend Technology Co., Ltd.). Consumables and tools such as grinding rods and forceps used in the experiment were sterilized and dried, and the laminar flow hood and pipette were wiped with 75% alcohol. The experiment was carried out under sterile conditions throughout the process. The total RNA solutions extracted from *Rhyzopertha dominica* with no resistance, high resistance, and extremely high resistance were placed in an ultra-low temperature refrigerator at -80 °C for storage and standby.

[0031] 3. Agarose gel electrophoresis detection

[0032] Perform agarose gel electrophoresis on the total RNA extracted above. The results showed that the RNA bands were clear and bright, and no smearing or degradation was found. After measuring with a nucleic acid concentration detector, the OD 260 / OD 280 of the extracted RNA was all in the range of 1.8 - 2.2, indicating that the RNA had good integrity and high purity, without degradation, and could be used as a template for synthesizing cDNA for subsequent experiments.

[0033] 4. Synthesis of the first strand of cDNA

[0034] Using the total RNA of *Rhyzopertha dominica* with no resistance, high resistance, and extremely high resistance extracted above as a template, use the II 1st Strand cDNA Synthesis Kit (+gDNA wiper) of Nanjing Vazyme Company to synthesize the first strand of cDNA. The obtained cDNA was stored in a refrigerator at -20 °C for standby.

[0035] 5. Gene sequencing and identification

[0036] Using the cDNA obtained in item 4 of this example as a template, use F and R as primers to perform PCR amplification on the RDROP gene of *Rhyzopertha dominica* to identify the cDNA.

[0037] Among them, F: GCAGGTGTTTTCATTGGATTC; R: AACCAGCAGAGGCTTCATACT.

[0038] The PCR reaction uses a 2×Taq Master Mix DNA amplification enzyme system (purchased from Nanjing Novoprotein Scientific Co., Ltd.). The reaction system is: 2 μL of cDNA, 8.5 μL of RNase-free water, 12.5 μL of Taq PCR Master Mix, 1 μL of primer F, and 1 μL of primer R. Reaction procedure: Pre-denaturation at 94 °C for 2 min; denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 2 min, 35 cycles; extension at 72 °C for 5 min.

[0039] The obtained PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for gene sequencing and compared with the RDROP gene (accession number Unigene0037305) in the Omicshare database. The results showed that they were consistent with the gene sequence of Rhyzopertha dominica.

[0040] 6. Synthesis of dsRNA

[0041] To obtain dsRNA that can kill Rhyzopertha dominica, dozens of primer pairs were designed for the RDROP gene, and only primer pair 1 achieved very good results. Twenty-five of these primer pairs are listed in Table 2.

[0042] Using the cDNA synthesized in Title 4 of this example as a template, PCR amplification reactions were carried out with each pair of primers in Table 2 to obtain PCR amplification products. Then, the obtained PCR amplification products were in vitro transcribed and synthesized into dsRNA using the T7 RiboMAX TM Express RNAi System kit from Promega Corporation.

[0043] Below, primer pair 1 will be taken as an example for illustration.

[0044] PCR amplification system: 1 μL of template (cDNA), 0.45 μL each of primers P1-F and P1-R, 12 μL of TaKaRa Taq TM PCR Master Mix, and 11.1 μL of RNase-free water. Among them, TaKaRa Taq TM PCR Master Mix was purchased from TaKaRa.

[0045] The PCR amplification procedure was as follows: pre-denaturation at 93 °C for 5 min; denaturation at 94 °C for 1 min, annealing at 57 °C for 1 min, extension at 72 °C for 3 min, for 55 cycles; and further extension at 72 °C for 8 min.

[0046] The PCR amplification products obtained using primer pair 1 were subjected to agarose gel electrophoresis. It can be seen that there was a specific target gene band at a molecular weight of 389 bp, which was clear and bright. The PCR amplification products were recovered using the DNA purification kit MiniBEST DNA Fragement Purification Kit Ver.4.0 (purchased from TaKaRa). After determination by a nucleic acid concentration meter, the OD Figure 1 / OD 260 / OD 280 of the PCR amplification products was 1.88, indicating that the amplified target gene had good integrity and high purity and could be used for subsequent experiments.

[0047] The PCR amplification products obtained using primer pair 1 were used for in vitro transcription and synthesis of dsRNA with the Promega T7 RiboMAX TM Express RNAiSystem kit. The specific method was carried out according to the operation instructions of this kit.

[0048] The dsRNA corresponding to that obtained with primer pair 1 consists of a sense strand and an antisense strand. The nucleotide sequence of the sense strand is SEQ ID NO:3, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of SEQ ID NO:3.

[0049] Table 2 Primer information for synthesizing dsRNA

[0050]

[0051]

[0052]

[0053] 7. Pesticide application and feeding test

[0054] (1) Wheat grain treatment. The dsRNAs obtained from the 25 primer pairs in Table 2 were respectively adjusted to a concentration of 1500 ng / μL with RNase-free water and dropped onto the wheat grains cut open with a sterilized scalpel. The application dose was 1.5 μL / grain.

[0055] (2) Preparation of test insects. Take 100 newly emerged adult rice weevils each with no resistance, high resistance, and extremely high resistance in Example 1 of this embodiment, place them in 250 g of the feed prepared in Example 1 of this embodiment, and lay eggs for 1 week in a constant temperature and humidity incubator at 30°C ± 1°C, relative humidity 70% ± 5%, and no light, and collect the rice weevil eggs.

[0056] (3) Pesticide application and feeding. Take 120 rice weevil eggs each with no resistance, high resistance, and extremely high resistance, and respectively mix them with 400 wheat grains treated with each dsRNA, and place them together in a sterilized feeding bottle. Cultivate them in a constant temperature and humidity incubator at 30°C ± 1°C, relative humidity 70% ± 5%, and no light for 66 days, and open it to check the number of live adult rice weevils.

[0057] The culture group of wheat grains and rice weevil eggs without dsRNA treatment was used as the control group.

[0058] Based on the mortality rate of adult rice weevils in each treatment group and the mortality rate of adult rice weevils in the control group, the mortality rate was corrected according to the Abbott formula to test the killing effect of the above synthesized dsRNA on rice weevils.

[0059]

[0060] The control effects of dsRNAs obtained from 25 primer pairs against the tested stored-grain pest Rhyzopertha dominica are shown in Table 3. Among them, the corrected mortality of the dsRNA obtained from primer pair 1 against the tested stored-grain pest Rhyzopertha dominica was 100%, which was significantly higher than that of the dsRNAs obtained from other primer pairs.

[0061] Table 3 Control effects of gene-targeted agents prepared from each primer pair against Rhyzopertha dominica

[0062]

[0063]

[0064] Sequence Listing

[0065] P1-F (SEQ ID No.1): TAATACGACTCACTATAGGGCAGGTGTTTTCATTGGATTC

[0066] P1-R (SEQ ID No.2): TAATACGACTCACTATAGGAACCAGCAGAGGCTTCATACT

[0067] dsRNA, SEQ ID No.3

[0068] GCAGGTGTTTTCATTGGATTCTCCAGAAACATTCCAATGTTTTTACGATCCTACATTTGCTTCTGCACGCACTGCAAATATGGAAAGAATGGCTGAACAGATAGCCACTTTGTGTGCAACATTAGGAGAATATCCTTCTGTTCGTTATCGATGCGATTGGCCGCATAATATTGAACTGGCCCAGCTCATTCAACAGAAATTGGATGCATACAAGGCAGATGAACCTACTATGGGAGAAGGACCAGAAAAAGCCAGATCGCAATTATTAATTTTGGATCGAGGATTTGACTGTGTTTCTCCTTTGCTACATGAATTGACTTTTCAGGCTATGGCATATGATTTACTGCCAATAGAGAATGATGTATACAAGTATGAAGCCTCTGCTGGTT.

Claims

1. A dsRNA for controlling the stored - grain pest Rhyzopertha dominica, characterized in that, it is prepared by a method comprising the following steps: reverse - transcribing the total RNA of Rhyzopertha dominica into cDNA, using the cDNA as a template, performing PCR amplification with the primer pair shown in SEQ ID No.1 and SEQ ID No.2, and in vitro transcribing the PCR amplification product into dsRNA, thus obtaining the dsRNA for controlling the stored - grain pest Rhyzopertha dominica; the dsRNA consists of a sense strand and an antisense strand, the nucleotide sequence of the sense strand is SEQ ID No.3, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of SEQ ID No.

3.

2. The dsRNA according to claim 1, characterized in that, the PCR amplification system comprises: 1 μL of template, 0.45 μL each of upstream primer and downstream primer, 12 μL of TaKaRa Taq™ PCR Master Mix, and 11.1 μL of RNase - free water.

3. The dsRNA according to claim 2, characterized in that, the PCR amplification program comprises: pre - denaturation at 93°C for 5 min; denaturation at 94°C for 1 min, annealing at 57°C for 1 min, extension at 72°C for 3 min, for 55 cycles; and further extension at 72°C for 8 min.

4. Use of the dsRNA according to any one of claims 1 - 3 in controlling the stored - grain pest Rhyzopertha dominica, wherein the stored grain is wheat.

Images