A bait containing Echinops fungus and its application in preventing and controlling red imported fire ants
By preparing bait containing Echinops fungi, the problem of preventing and controlling the invasion of red imported fire ants is solved, and a highly effective prevention and control effect is achieved by affecting the physiological functions of the red imported fire ants.
Patent Information
- Application Number
- CN202311720155.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-14
- Publication Date
- 2025-09-26
- Estimated Expiration
- 2043-12-14
AI Technical Summary
The invasion of red imported fire ants poses a serious threat to public safety and agricultural production, and existing technologies lack effective prevention and control methods.
Provided is a bait containing Echinops fungi, which consists of soybean powder, corn powder, cicada pupa powder, flour, sesame oil, honey and a preservative. Echinops fungi cakes are prepared and mixed with other ingredients to form baits of different concentrations for feeding red imported fire ants, thereby affecting their physiological functions.
The bait significantly increases the mortality rate of red imported fire ants and reduces their food intake, reduces their enzyme activity, causes a large number of deaths of red imported fire ants and reduces their food intake, and has simple and easily available materials and a preparation method.
Smart Images

Figure CN117694340B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of pest control, in particular to a bait containing Echinops fungus and application thereof in controlling red imported fire ants. Background Art
[0002] The red imported fire ant, a member of the Hymenoptera order, Formicidae family, subfamily Myrmecinae, genus Solenopsis, is a dangerous invasive species native to South America. As an invasive pest, red imported fire ants quickly attack invading organisms when their nests are attacked, stinging them and posing a public safety threat. Their bites can cause painful, pricking sensations, itching, and other allergic symptoms, and in severe cases, shock or even death. They also severely damage farmland, grazing crops in some areas, damaging seeds, fruits, sprouts, and roots, reducing yields and disrupting agricultural production. Furthermore, due to their aggressive nature, red imported fire ants can also harm local ecosystems, such as small mammals and native insects, thereby impacting local ecosystems and reducing species richness and biodiversity.
[0003] Insects host a diverse array of endophytes, a rich diversity of microorganisms that significantly influence their hosts' physiological behaviors, including feeding, digestion, and excretion. Intestinal microorganisms primarily digest and absorb nutrients, and can even influence the nutrients necessary for their growth. Studies have found that endophytes in insects can spread within and between species, with some symbiotic bacteria providing nutrients their hosts lack and regulating nutritional balance. These symbiotic bacteria are primarily found in the insect's intestines and body fluids, accompanying their hosts' growth and development. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide a bait containing Trichoderma fungus and its application in preventing and controlling red imported fire ants, which can effectively solve the problems raised in the above background technology.
[0005] To solve the above problems, the technical solution adopted by the present invention is: a bait containing the genus Echinops fungus, characterized in that the bait consists of soybean powder, corn powder, cicada pupa powder, flour, sesame oil, honey, preservatives and Echinops fungus cake.
[0006] Preferably, the weight of the components is: soybean powder 32-40g, corn flour 26-34g, cicada pupa powder 16-24g, flour 3-7g, sesame oil 2-3g, honey 0.8-1.2g, preservative 0.2-0.8g, and the mixture is prepared into 80-110g of dry powder.
[0007] Preferably, the weight of the components is: 36g soybean powder, 30g corn flour, 20g cicada pupa powder, 5g flour, 2.5g sesame oil, 1g honey, and 0.5g preservative, which are mixed into 95g dry powder.
[0008] Preferably, the steps for preparing the Cercospora fungus cake are:
[0009] Step 1: Collecting red fire ants:
[0010] After digging up the red fire ant nest, raise them indoors at 23-27°C for a week, feeding them water and ham sausage. Then, apply talcum powder around the walls of a plastic box, pick the red fire ants and place them in the box for later use.
[0011] Step 2: Colony isolation and culture:
[0012] Take 20 red imported fire ants of uniform size, place them in a refrigerator for 10 minutes, disinfect them with 3% H2O2, and wash them three times with distilled water, retaining the last wash solution. Then, separate and grind the intestinal tract of the red imported fire ants and place them in PDB medium. After shaking and incubating for 3-4 days, streak them on a plate to obtain single colonies.
[0013] Step 3: Identification of bacterial species:
[0014] The 16S rRNA method was used to identify bacteria in red imported fire ants. A single purified colony was picked from the plate, streaked onto a PDA plate, and cultured overnight at 28°C. A single colony was then picked and incubated in 5 mL of PDB liquid medium at 28°C, 180 rpm, overnight. 1 mL of the bacterial solution was placed in a sterilized 1.5 mL centrifuge tube and centrifuged at 12,000 rpm for 1 min. The supernatant was removed. DNA was extracted according to the instructions of the DNA extraction kit. The concentration and quality of the total DNA were detected by 1% agarose gel electrophoresis and a spectrophotometer. The DNA concentration was diluted to 50-100 ng / μL and PCR amplification was performed.
[0015] The amplified product was electrophoresed on a 1.5% agarose gel at 120 V for 15 min. The agarose gel was stained in EB solution for 10 min and visualized on a gel imaging system. The 16S rRNA sequence was 1200-1700 bp, and the ITS sequence was 480-520 bp. The PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for DNA sequencing. The strain was identified by comparing the 16S rRNA and ITS sequences on the NCBI website.
[0016] After identification, the fungi extracted from the body of red fire ants were found to be fungi of the genus Echinococcus.
[0017] Preferably, the size of the plastic box is 16-22 cm in length, 10-16 cm in width, and 10-14 cm in height.
[0018] Preferably, the obtained bacterial cake is punched into 5 round cakes with a 7-11 mm punch and then placed in 180-220 mL PDB liquid culture medium for 4-6 days. The bacterial solution is then diluted with 20% sugar water to concentrations of 10%, 20%, 40%, 60%, and 80% of the original solution for standby use; 3-7 mL of bacterial solution of different concentrations is taken and added to the dry powder to obtain baits with concentrations of 0.5%, 1%, 2%, 3%, and 4%. Sugar water is added to the blank control, and then the mixture is dried and crushed for standby use.
[0019] Preferably, according to the above-mentioned use of the bait containing the genus Trichoderma fungus in preventing and controlling red imported fire ants, it is characterized in that the method of application is: remove the lid of a 2mL centrifuge tube filled with bait, weigh it and put it into a box coated with talcum powder, put 100 red imported fire ants and an appropriate amount of water into each box, and set three replicates for each treatment; for the control, only sugar water is added as bait for 15 days, and the changes in bait weight and the number of dead red imported fire ants are recorded every day.
[0020] Compared with the prior art, the present invention provides a bait containing the genus Trichoderma and its use in preventing and controlling red imported fire ants, which has the following beneficial effects:
[0021] The bait containing the genus Trichoderma fungus of the present invention has a good preventive and therapeutic effect on red imported fire ants. The preparation method of the fungus and the bait is simple, and the materials are easy to obtain. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 Schematic diagram of the fungus cake of the genus Lithocarpus of the present invention;
[0023] Figure 2 This is a schematic diagram of the mortality rate of red imported fire ants under the action of baits of different concentrations of the present invention;
[0024] Figure 3 This is a schematic diagram of the consumption rate of baits of different concentrations by red imported fire ants according to the present invention. DETAILED DESCRIPTION
[0025] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.
[0026] As a specific embodiment of the present invention:
[0027] The strain was obtained by the following steps:
[0028] Collecting red fire ants: After digging up a red fire ant nest, raise the ants indoors at approximately 25°C for a week, feeding them water and ham. Then, smear talcum powder around the sides of a 19cm long, 13cm wide, and 12cm high plastic box. Place the ants inside the box and set aside.
[0029] Colony isolation and culture:
[0030] Take 20 red imported fire ants of uniform size, freeze them for 10 minutes, disinfect them with 3% H₂O₂, and rinse them three times with distilled water, reserving the last rinse. Then, isolate and grind the ant intestines, place them in PDB medium, and culture them on a shaker for 3-4 days. Afterward, streak the plates and isolate single colonies. If no colonies grow on the plates containing the rinse solution, it indicates that all the colonies were from the ants themselves.
[0031] Identification of bacterial species:
[0032] The 16S rRNA method was used to identify bacteria in the red imported fire ants. A single colony was purified from the plate, streaked onto a PDA plate, and cultured overnight at 28°C. A single colony was then cultured in 5 mL of PDB liquid medium at 28°C, 180 rpm, and overnight. One mL of the bacterial solution was transferred to a sterile 1.5 mL centrifuge tube and centrifuged at 12,000 rpm for 1 minute. The supernatant was aspirated. DNA was extracted according to the DNA extraction kit's instructions. Total DNA concentration and quality were determined by 1% agarose gel electrophoresis and spectrophotometry. The DNA was diluted to 50-100 ng / μL for PCR amplification.
[0033] The amplified product was electrophoresed on a 1.5% agarose gel at 120 V for 15 minutes. The gel was stained with EB solution for 10 minutes and visualized on a gel imaging system. The 16S rRNA sequence was approximately 1500 bp, and the ITS sequence was approximately 500 bp. The PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for DNA sequencing. The strain was identified by comparing the 16S rRNA and ITS sequences with those from NCBI.
[0034] The results of strain identification sequence are:
[0035] TTTCGGAGCTTCACTCCCAAACCCCATGTGAACATACCTGTTTCGTTCCCTCGGCGGTGTCCGGCAACGGCCCGCCAGAGGACCCAACAAACTCTTTTGAATTTTTCAGTATCTTCTGAGTGAAAAAAACAATAAAT CAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGG GCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCACCTTCGGGAGCTTGGTGTTGGGGATCGGCAGGGCGTCCTCCGGGTCGCGCCGTCCCCCAAATCTAGTGGCGGTCTCGCTGTAGCTTCCTCTGCGTAGTAAT ACACCTCGCTCTGGAGTCTCGGTGCGGCCACGCCGTTAAACCCCCAACTATTTTCTGGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAGCCGGAGGAACTACAATAGACCGTTCTTCTA
[0036] The bacteria extracted from the red imported fire ants were identified as Calonectria.
[0037] Bacterial morphology Figure 1 shown.
[0038] Bait preparation:
[0039] Prepare 95g of dry powder using 36g of soybean flour, 30g of corn flour, 20g of cicada pupa powder, 5g of flour, 2.5g of sesame oil, 1g of honey, and 0.5g of preservative. Punch the resulting cake into five round cakes using a 9mm hole punch and incubate in 200mL of PDB liquid medium for 5 days. Then, dilute the bacterial solution with 20% syrup to concentrations of 10%, 20%, 40%, 60%, and 80% of the original solution, respectively, for later use. Add 5mL of the bacterial solution at different concentrations to the dry powder, resulting in bait concentrations of 0.5%, 1%, 2%, 3%, and 4%. For a blank control, add only syrup. The mixture is then dried and crushed for later use.
[0040] Feeding rate and mortality of red imported fire ants after feeding with bacteria-containing bait:
[0041] Remove the caps from 2mL centrifuge tubes filled with bait, weigh them, and place them in boxes coated with talcum powder. Place 100 fire ants and an appropriate amount of water in each box. Set up three replicates for each treatment. For the control, use bait containing only sugar water. Record changes in bait weight and the number of dead fire ants daily for 15 days.
[0042] Mortality rate = total number of deaths / total number of ants; feeding rate = feeding amount / total amount of bait
[0043] Reference Figure 2 As can be seen from the figure, after the red fire ants were fed with the bacteria-containing bait, the mortality rate of the red fire ants at each concentration was higher than that of the control.
[0044] The 2% concentration bait had the best effect. After 9 days of treatment, the mortality rate of fire ants was the highest, at 89.33%. After 13 days of treatment, the mortality rate of fire ants was 100%.
[0045] After feeding the ants with 4% concentration bait for 9 days, the mortality rate was 83.67%, and after 13 days, it was 93.00%.
[0046] After 9 days of control treatment, the mortality rate of red imported fire ants was 33.33%, and after 13 days of treatment, it was 60.67%.
[0047] Reference Figure 3 As can be seen from the figure, after the red fire ants were fed with the bacteria-containing bait, the consumption rate of the bait at each concentration was higher than that of the control.
[0048] After 5 days of exposure to 2% concentration bait, the consumption rate of red imported fire ants was 53.33%, after 9 days, it was 66.22%, and after 13 days, it was 69.25%.
[0049] After 5 days of exposure to 4% concentration bait, the consumption rate was 36.33%, after 9 days, it was 55.66%, and after 13 days, it was 62.22%.
[0050] After 5 days of control treatment, the bait consumption rate was 4.15%, after 9 days of action, it was 9.25%, and after 13 days of action, it was 14.15%.
[0051] Combine Figure 2 、 Figure 3 It can be seen that the mortality rate of red fire ants is related to eating bacteria-containing bait. Generally speaking, the more bacteria-containing bait they eat, the higher the mortality rate of red fire ants, indicating that the bacteria has a certain promoting effect on the mortality rate of red fire ants.
[0052] Enzyme activity assay:
[0053] Reduced enzyme activity can affect insect cell function and population, potentially impacting the ants and leading to their death. Red imported fire ants fed a diet containing bacteria and water were cleaned and ground. The absorbance of pepsin, lipase, and amylase was measured using a Beijing Solebaugh kit, and the enzyme activities were calculated.
[0054] After feeding red imported fire ants with 2% bacteria-containing bait for 1 day, the pepsin activity was 18.59 U, while that of the control was 86.33 U. After feeding for 3 days, the pepsin activity was 4.18 U, while that of the control was 175.27 U.
[0055] After 1 day of feeding, the lipase activity was 85.94 U, while that of the control was 11.87 U. After 3 days of feeding, it was 44.72 U, while that of the control was 180.44 U.
[0056] After 1 day of feeding, the amylase activity was 1.98 U, while that of the control was 0.37 U. After 3 days of feeding, it was 1.20 U, while that of the control was 0.42 U.
[0057] After three days of feeding, the activities of all three enzymes decreased compared to the first day, but increased in the control group. This suggests that the bacteria-containing bait can reduce the activity of protease, lipase, and amylase in red imported fire ants, which is one of the main factors affecting their mortality.
[0058] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A bait containing Echinops fungus, characterized in that: The bait consists of soybean meal, corn meal, cicada pupa powder, flour, sesame oil, honey, preservatives and Echinops fungus cake; Prepare 80-110g of dry powder by mixing 32-40g soybean flour, 26-34g corn flour, 16-24g cicada pupa powder, 3-7g flour, 2-3g sesame oil, 0.8-1.2g honey, and 0.2-0.8g preservative. The steps for preparing the Lichia fungus cake are as follows: Step 1: Collecting red fire ants: After digging up the red fire ant nest, raise them indoors at 23-27°C for a week, feeding them water and ham sausage. Then, apply talcum powder around the walls of a plastic box, pick the red fire ants and place them in the box for later use. Step 2: Colony isolation and culture: Take 20 red imported fire ants of uniform size, place them in a refrigerator for 10 minutes, disinfect them with 3% H2O2, and wash them three times with distilled water, retaining the last wash solution. Then, separate and grind the intestinal tract of the red imported fire ants and place them in PDB medium. After shaking and incubating for 3-4 days, streak them on a plate to obtain single colonies. Step 3: Identification of bacterial species: The 16S rRNA method was used to identify bacteria in red imported fire ants. A single colony was purified from the plate, streaked onto a PDA plate, and cultured overnight at 28°C. A single colony was then cultured in 5 mL of PDB liquid medium at 28°C, 180 rpm, and overnight. One mL of the bacterial solution was placed in a sterilized 1.5 mL centrifuge tube and centrifuged at 12,000 rpm for 1 minute, after which the supernatant was removed. DNA was extracted according to the DNA extraction kit instructions. The total DNA concentration and quality were determined by 1% agarose gel electrophoresis and spectrophotometry. The DNA was diluted to 50-100 ng / μL and amplified by PCR. The amplified product was electrophoresed on a 1.5% agarose gel at 120 V for 15 min. The agarose gel was stained in EB solution for 10 min and visualized on a gel imaging system. The 16S rRNA sequence was 1200-1700 bp, and the ITS sequence was 480-520 bp. The PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for DNA sequencing. The strain was identified by comparing the 16S rRNA and ITS sequences online at NCBI. After identification, the fungi extracted from the body of red fire ants were found to be fungi of the genus Echinococcus.
2. The bait containing Echinops fungus according to claim 1, characterized in that The weight of the components is as follows: 36g soybean powder, 30g corn flour, 20g cicada pupa powder, 5g flour, 2.5g sesame oil, 1g honey, and 0.5g preservative, which are mixed into 95g dry powder.
3. The bait containing Echinops fungus according to claim 1, characterized in that The dimensions of the plastic box are 16-22 cm in length, 10-16 cm in width, and 10-14 cm in height.
4. The bait containing Echinops fungus according to claim 1, characterized in that Punch the obtained bacterial cake into 5 round cakes with a 7-11mm puncher and place them in 180-220mL PDB liquid culture medium for culture for 4-6 days. Then take the bacterial solution and dilute it with 20% sugar water to concentrations of 10%, 20%, 40%, 60%, and 80% of the original solution for use; take 3-7mL of bacterial solution of different concentrations and add it to the dry powder to obtain bait with concentrations of 0.5%, 1%, 2%, 3%, and 4%. Add sugar water to the blank control, then dry and crush it for use.
5. The use of the bait containing the genus Trichoderma for preventing and controlling red imported fire ants according to claim 4, characterized in that: The application method is as follows: remove the cap of a 2mL centrifuge tube filled with bait, weigh it and put it into a box coated with talcum powder, put 100 red fire ants and an appropriate amount of water into each box, and set three replicates for each treatment; for the control, only sugar water is added as bait for 15 days, and the changes in bait weight and the number of dead red fire ants are recorded every day.
Citation Information
Patent Citations
Compositions and methods for treating pests
CN104955336A
Poison bait for killing red imported fire ants, and preparation method thereof
CN106172456A