A recombinant vector facilitating screening of ecdysteroid analogs and antagonists, and construction method and application thereof

By constructing the recombinant vector pGL3-EcRE-Fluc-Ac5-Rluc/PuroR, the problem of screening ecdysterone analogs and antagonists in the prior art was solved, and an efficient and rapid screening process was achieved, and multiple shortcomings of the traditional method were overcome.

CN117701632BActive Publication Date: 2025-06-13HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311591973.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-11-27
Publication Date
2025-06-13
Estimated Expiration
2043-11-27

AI Technical Summary

Technical Problem

It is difficult for the prior art to efficiently screen ecdy hormone analogs and antagonists. Traditional methods require a large number of insect tests, with long cycles, high cost and unclear mechanism of action. The yeast system has untrue expression of exogenous proteins and low drug permeability limitations.

Method used

A recombinant vector pGL3-EcRE-Fluc-Ac5-Rluc/PuroR was constructed. By inserting 4×EcRE and hsp70 minimum promoter into the pGL3 basic plasmid, combining the pAc-Rluc-PuroR vector, the efficient expression and screening of insect EcR and USP proteins was achieved.

Benefits of technology

High-throughput rapid screening of ecdysterone analogs and antagonists was achieved, and the traditional method had fewer objects, long cycles, high costs and unclear mechanisms of action were overcome, and the problems of low exogenous protein activity and low drug permeability in the yeast system were solved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117701632B_ABST
    Figure CN117701632B_ABST
Patent Text Reader

Abstract

The present invention relates to the technical field of ecdysteroid analogs and antagonists, and specifically discloses a recombinant vector for facilitating the screening of ecdysteroid analogs and antagonists, its construction method and application. By constructing the pGL3-EcRE-Fluc-Ac5-Rluc / PuroR vector and transfecting Drosophila Kc cells with it, a stable Kc cell line is obtained. The expression vector carrying the expression of firefly luciferase driven by the ecdysteroid response element and the expression of Renilla luciferase and puromycin driven by the constitutive promoter Actin5 can be used for high-throughput screening of pesticides such as ecdysteroid analogs and antagonists, thus achieving the advantages of rapidity, high efficiency and accuracy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of ecdysteroid analogs and antagonists, and more particularly to a recombinant vector facilitating the screening of ecdysteroid analogs and antagonists, a construction method thereof and applications thereof. Background Art

[0002] The growth and development of insects are strictly regulated by ecdysteroids. The main function of ecdysteroids is to regulate the periodic molting of insects, thereby determining the changes in the body size and morphology of insects. During the larval development stage, the secretion activity of ecdysteroids shows periodic changes with the instar, resulting in continuous changes in the ecdysteroid titer in the hemolymph. Ecdysteroids, also known as ecdysterols, are the first hormones whose chemical structures have been identified in insects. Subsequently, ecdysteroids and their related analogs have been found not only in insects, but also in other crustaceans, echinoderms, mollusks and annelids. In addition, many steroids with ecdysteroid activity have been isolated from various plants.

[0003] In holometabolous insects and hemimetabolous insects, the titer of ecdysteroids rapidly increases during each larval molt. Usually, the titer reaches a peak before the epicuticle detachment. Thereafter, the new cuticle is continuously formed, and the titer continuously decreases, reaching the lowest value at the time of molting. Therefore, by using ecdysteroid analogs or anti-ecdysteroids to interfere with the growth and molting of insects, the purpose of pest control can be achieved. The third-generation insecticides, namely insect growth regulators, are developed and designed based on the regulation of insect growth and development by insect hormones. They are achieved by interfering with and inhibiting the normal growth and development of insects, inhibiting molting and metamorphosis, inhibiting reproductive and other physiological processes. This type of insecticide has the characteristics of high activity, strong specificity, low toxicity and low residue, and is an important research object for the development of non-lethal agents in the contemporary era.

[0004] Non-sterol bisacylhydrazine insecticides are new, highly efficient insect growth regulators with ecdysteroid activity developed in recent years. However, with the increasing use time and scope of this type of insecticide, the probability of pests developing resistance is also increasing. Therefore, it is urgent to reduce the use of single-type insecticides and develop a combined cyclic use of multiple insecticides. The existing methods for screening ecdysteroid analogs or antagonists mainly rely on in vivo testing. On the one hand, this method requires a large number of test insects, which is difficult to meet in practice. On the other hand, the in vivo rearing cycle is long, which is not conducive to rapid detection of drug efficacy. On the other hand, the sensitivity of insects to drugs may vary at each instar, resulting in poor experimental reproducibility. Moreover, the action targets and mechanisms of the screened drugs cannot be clearly defined. In addition to in vivo testing, yeast-based high-throughput drug screening is also a commonly used method. However, compared with drug screening using insect cells, the disadvantages of yeast screening mainly include: (1) It is necessary to heterologously express insect EcR and USP in yeast, and the expressed proteins may not truly reflect the protein structure and function in insects; (2) The low permeability of the yeast cell wall makes this system incompatible with hydrophilic compounds. Therefore, there will be certain limitations in the screening of hydrophilic ecdysteroid analogs or antagonists by this system.

[0005] Therefore, there is an urgent need for a method that is convenient for screening ecdysteroid analogs and antagonists, so as to be able to screen ecdysteroid analogs and antagonists more conveniently, efficiently, and on a large scale. Summary of the Invention

[0006] In view of this, the present invention provides a recombinant vector for facilitating the screening of ecdysteroid analogs and antagonists, its construction method and application. To achieve the above object, the present invention adopts the following technical solutions:

[0007] A recombinant vector for screening ecdysteroid analogs and antagonists, the recombinant vector is the pGL3-EcRE-Fluc-Ac5-Rluc / PuroR vector, and its nucleotide sequence is as shown in SEQ ID No.1.

[0008] The construction method of the recombinant vector includes the following steps:

[0009] S1: Construct the pGL3-EcRE-Fluc vector;

[0010] S2: Construct the pAc-Rluc-PuroR vector;

[0011] S3: Construct the pGL3-EcRE-Fluc-Ac5-Rluc / PuroR vector.

[0012] Further, the specific operation of S1 is as follows: insert 4×EcRE and hsp70 minimal promoter at SacⅠ and XhoⅠ of the vector pGL3 basic plasmid to obtain the pGL3-EcRE-Fluc vector;

[0013] The nucleotide sequence of EcRE is shown in SEQ ID No.2; the nucleotide sequence of hsp70 minimal promoter is shown in SEQ ID No.3; the nucleotide sequence of the pGL3-EcRE-Fluc vector is shown in SEQ ID No.4.

[0014] Further, the specific operation method of S2 is as follows:

[0015] 1) Using the pRL-SV40 plasmid as a template, clone the Renilla luciferase-encoding gene Rluc using the forward primer Rluc-S and the reverse primer Rluc-AS, and remove the stop codon of Rluc;

[0016] 2) Purify and recover the PCR product using the Takara Gel Extraction Kit. After digesting the purified Rluc fragment and the pAc-y1sgRNA-Cas9 plasmid with the restriction enzymes HindIII and KpnI at 37°C for 3 h, cut the gel to recover the target fragment and the vector;

[0017] 3) Use T4 DNA ligase to ligate overnight at 16°C, then perform routine transformation and sequencing to obtain the pAc-Rluc-PuroR vector.

[0018] Further, the nucleotide sequence of the forward primer Rluc-S is shown in SEQ ID No.5; the nucleotide sequence of the reverse primer Rluc-AS is shown in SEQ ID No.6; the nucleotide sequence of Rluc is shown in SEQ ID No.7; the nucleotide sequence of the pAc-Rluc-PuroR vector prepared by S2 is shown in SEQ ID No.8.

[0019] Further, the PCR system includes the following components: 5 μl of 10×PCR Buffer, 1 μl of pRL-SV40 plasmid at 4.3 ng / μl, 1 μl of forward primer at 20 μM, 1 μl of reverse primer at 20 μM, 1 μl of dNTP, 0.5 μl of rTaq (Takara), and 40.5 μl of ddH2O;

[0020] The PCR reaction conditions are as follows: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 10 min;

[0021] The plasmid digestion system comprises the following components: 3 μl of 1×M buffer, 16 μl of plasmid pAc-y1sgRNA-Cas9 at 1 μg / μl, 0.5 μl of HindIII, 0.5 μl of KpnI, and 10 μl of ddH 2 O;

[0022] The Rluc sequence digestion system contains the following components: 3 μl of 1×M buffer, 15 μl of Rluc, 0.5 μl of HindIII, 0.5 μl of KpnI, and 11 μl of ddH 2 O;

[0023] The ligation system contains the following components: 1 μl of 10×Buffer Mix, 0.5 μl of digested plasmid, 6 μl of digested fragment, 0.5 μl of T4 DNA ligase, and 2 μl of ddH 2 O.

[0024] Furthermore, the specific operation method of S3 is as follows:

[0025] 1) Using the forward primer S and the reverse primer AS, with the pAc-Rluc-PuroR vector as the template, amplify the fragment containing the Actin5 promoter, Rluc, and the puroR and SV40 sequences;

[0026] 2) Purify and recover the PCR product using the Takara gel recovery kit; after linearizing the pGL3-EcRE-Fluc 9 vector with the restriction endonucleases BamhⅠ and SalⅠ, ligate the recovered PCR fragment and the linearized vector using the Gibson Assembly Kit seamless cloning kit;

[0027] 3) Place the reaction system in a 50°C water bath. After 15 min, perform conventional transformation and sequencing to obtain the ecdysteroid analog or antagonist screening vector, denoted as pGL3-EcRE-Fluc-Ac5-Rluc / PuroR

[0028] Furthermore, the nucleotide sequence of the forward primer S is as shown in SEQ ID No.9; the nucleotide sequence of the reverse primer AS is as shown in SEQ ID No.10.

[0029] A pGL3-EcRE-Fluc-Ac5-Rluc / PuroR stable cell line is obtained by transfecting the pGL3-EcRE-Fluc-Ac5-Rluc / PuroR recombinant vector into the Drosophila Kc cell line.

[0030] Use of the recombinant vector or recombinant cell line in high-throughput screening of ecdysteroid analogs and / or antagonists.

[0031] As can be seen from the above technical solutions, compared with the prior art, the present invention discloses a recombinant vector for facilitating the screening of ecdysteroid analogs and antagonists, its construction method and application, which can rapidly screen ecdysteroid analogs or antagonists by high-throughput, overcoming the problems faced by traditional screening methods using live insects, such as few targets, long cycle, high cost, and unclear mechanism of action; at the same time, it solves the problems that the activity of exogenously introduced insect proteins in the yeast system is not high and the low permeability of the yeast cell wall to drugs, which affect the accuracy of experimental results. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only the embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained according to the provided drawings.

[0033] Figure 1 The drawing is a schematic diagram of the construction of pGL3-EcRE-Fluc-Ac5-Rluc / PuroR stable transfected Kc cells;

[0034] Figure 2 The drawing is the map of pGL3-EcRE-Fluc-Ac5-Rluc / PuroR;

[0035] Figure 3 The drawing is the result of dual-luciferase identification of pGL3-EcRE-Fluc-Ac5-Rluc / PuroR positive stable transfected Kc cell line;

[0036] CK is the control ethanol solvent, and Halofenozide is chlorantraniliprole. The ordinate represents the activity value of firefly luciferase / the activity value of Renilla luciferase. The figure shows that the addition of chlorantraniliprole can significantly promote the expression of firefly luciferase.

[0037] Figure 4 The drawing is the effect of the corresponding ecdysteroid antagonist on the stable transfected Kc cell line. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0038] The following will clearly and completely describe the technical solutions in the embodiments of the present invention with reference to the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.

[0039] Example 1 A recombinant vector for screening ecdysteroid analogs and antagonists

[0040] The pGL3-EcRE-Fluc-Ac5-Rluc / PuroR recombinant vector, whose nucleotide sequence is shown in SEQ ID No.1;

[0041]

[0042] Example 2 A method for preparing a recombinant vector for screening ecdysteroid analogs and antagonists, comprising the following steps:

[0043] S1: Construct the pGL3-EcRE-Fluc vector;

[0044] S2: Construct the pAc-Rluc-PuroR vector;

[0045] S3: Construct the pGL3-EcRE-Fluc-Ac5-Rluc / PuroR vector.

[0046] Example 3 Construction of the pGL3-EcRE-Fluc vector

[0047] According to the EcRE sequence and hsp27 minimal promoter sequence reported in the literature, the 4×EcRE-hsp27 minimal promoter sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. and inserted into the SacI and Xhol sites of the pGL3 basic (promega) plasmid to obtain the pGL3-EcRE-Fluc vector.

[0048] An EcoR I (GAATTC) recognition sequence was added between the 4×EcRE and hsp27 minimal promoter sequences.

[0049] The nucleotide sequence of the 4×EcRE is shown in SEQ ID No.2; the nucleotide sequence of the hsp70 minimal promoter is shown in SEQ ID No.3; the amino acid sequence of the pGL3-EcRE-Fluc vector is shown in SEQ ID No.4.

[0050] SEQ ID No.2: GACAAGGGTTCAATGCACTTGTC

[0051] SEQ ID No.3: GAGCGCCGGAGTATAAATAGAGGCGCTTCGTCTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAGCGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCTGCAGATTTAAATGGCGCGCC

[0052]

[0053] Example 4 Construction of pAc-Rluc-PuroR Vector

[0054] Using the pRL-SV40 plasmid as a template, the Renilla luciferase-encoding gene Rluc (933 bp) was cloned using primers Rluc-S and Rluc-AS. The stop codon of Rluc was removed so that it could be co-expressed with puroR in the subsequent pAc-y1sgRNA-Cas9 vector under the drive of the Actin5 promoter.

[0055] PCR system (50 μl): 5 μl of 10×PCR Buffer, 1 μl of pRL-SV40 plasmid (4.3 ng / μl), 1 μl each of the above forward and reverse primers (20 μM), 1 μl of dNTP, 0.5 μl of rTaq (Takara), 40.5 μl of ddH2O;

[0056] PCR reaction conditions were: 95°C for 5 min; 95°C for 30 s, 60°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 10 min.

[0057] The PCR product was purified and recovered using the Takara Gel Extraction Kit (Cat#9762).

[0058] After the purified Rluc fragment and the pAc-y1sgRNA-Cas9 plasmid were digested with the restriction enzymes HindIII and KpnI at 37°C for 3 h, the target fragments and the vector were recovered by gel extraction. After ligation overnight at 16°C using T4 DNA ligase, routine transformation and sequencing were performed to obtain the pAc-Rluc-PuroR vector.

[0059] The plasmid digestion system (30 μl) was: 3 μl of 1×M buffer (Takara), 16 μl of plasmid pAc-y1sgRNA-Cas9 (1 μg / μl), 0.5 μl of HindIII (Takara), 0.5 μl of KpnI (Takara), ddH 2 O 10 μl.

[0060] The Rluc sequence digestion system (30 μl) was: 3 μl of 1×M buffer (Takara), 15 μl of Rluc, 0.5 μl of HindIII (Takara), 0.5 μl of KpnI (Takara), ddH 2O 11 μl. The ligation system (10 μl) is as follows: 1 μl of 10×Buffer Mix (Takara), 0.5 μl of digested plasmid, 6 μl of digested fragment, 0.5 μl of T4 DNA ligase (Takara), ddH 2 O 2 μl.

[0061] The nucleotide sequence of the forward primer Rluc-S is as shown in SEQ ID No.5; the nucleotide sequence of the reverse primer Rluc-AS is as shown in SEQ ID No.6; the nucleotide sequence of Rluc is as shown in SEQ ID No.7; the nucleotide sequence of the prepared pAc-Rluc-PuroR vector is as shown in SEQ ID No.8.

[0062] SEQ ID No.5: TATGGTACCATGACTTCGAAAGTTTATGATCCA;

[0063] SEQ ID No.6: CGCAAGCTTTTGTTCATTTTTGAGAACTCGC;

[0064] SEQ ID No.7: ATGACTTCGAAAGTTTATGATCCAGAACAAAGGAAACGGATGATAACTGGTCCGCAGTGGTGGGCCAGATGTAAACAAATGAATGTTCTTGATTCATTTATTAATTATTATGATTCAGAAAAACATGCAGAAAATGCTGTTATTTTTTTACATGGTAACGCGGCCTCTTCTTATTTATGGCGACATGTTGTGCCACATATTGAGCCAGTAGCGCGGTGTATTATACCAGACCTTATTGGTATGGGCAAATCAGGCAAATCTGGTAATGGTTCTTATAGGTTACTTGATCATTACAAATATCTTACTGCATGGTTTGAACTTCTTAATTTACCAAAGAAGATCATTTTTGTCGGCCATGATTGGGGTGCTTGTTTGGCATTTCATTATAGCTATGAGCATCAAGATAAGATCAAAGCAATAGTTCACGCTGAAAGTGTAGTAGATGTGATTGAATCATGGGATGAATGGCCTGATATTGAAGAAGATATTGCGTTGATCAAATCTGAAGAAGGAGAAAAAATGGTTTTGGAGAATAACTTCTTCGTGGAAACCATGTTGCCATCAAAAATCATGAGAAAGTTAGAACCAGAAGAATTTGCAGCATATCTTGAACCATTCAAAGAGAAAGGTGAAGTTCGTCGTCCAACATTATCATGGCCTCGTGAAATCCCGTTAGTAAAAGGTGGTAAACCTGACGTTGTACAAATTGTTAGGAATTATAATGCTTATCTACGTGCAAGTGATGATTTACCAAAAATGTTTATTGAATCGGACCCAGGATTCTTTTCCAATGCTATTGTTGAAGGTGCCAAGAAGTTTCCTAATACTGAATTTGTCAAAGTAAAAGGTCTTCATTTTTCGCAAGAAGATGCACCTGATGAAATGGGAAAATATATCAAATCGTTCGTTGAGCGAGTTCTCAAAAATGAACAA

[0065]

[0066] Example 5: Construct the pGL3-EcRE-Fluc-Ac5-Rluc / PuroR vector;

[0067] Using the forward primer S and the reverse primer AS, with the above pAc-Rluc-PuroR vector as the template, amplify the fragment containing the Actin5 promoter, Rluc, and puroR and SV40 sequences.

[0068] The reaction system (50 μl) is as follows: 2× Phanta Max Buffer 25 μl, dNTP Mix (10 mM each) 1 μl, S and AS primers (20 μM) 1 μl each, Phanta Max Super-Fidelity DNA Polymerase (Novoprotein) 1 μl, pAc-Rluc-PuroR vector 0.5 μl (200 ng), ddH 2 O is supplemented to 50 μl. The PCR reaction conditions are: 95°C for 3 min; 95°C for 15 s, 65°C for 30 s, 72°C for 3 min, 30 cycles; 72°C for 10 min.

[0069] The PCR product is purified and recovered using the Takara Gel Extraction Kit (Cat#9762).

[0070] After linearizing the pGL3-EcRE-Fluc 9 vector using BamhⅠ and Sal Ⅰ restriction endonucleases, use the Gibson Assembly Kit (Cat#E2611L, NEB) seamless cloning kit to ligate the recovered PCR fragment and the linearized vector. The reaction system (20 μl): 2 X Gibson Assembly Master Mix 20 μl, fragment (200 ng) + vector (100 ng), ddH 2 O is supplemented to 50 μl. The reaction system is placed in a 50°C water bath. After 15 min, perform routine transformation and sequencing to obtain the ecdysteroid analog or antagonist screening vector, denoted as pGL3-EcRE-Fluc-Ac5-Rluc / PuroR.

[0071] The nucleotide sequence of the forward primer S is as shown in SEQ ID No.9; the nucleotide sequence of the reverse primer AS is as shown in SEQ ID No.10; the amino acid sequence of the pGL3-EcRE-Fluc-Ac5-Rluc / PuroR vector is as shown in SEQ IDNo.1.

[0072] SEQ ID No.9: ggtaaaatcgataaggatccAGATCTCGCTGCCTGTTATGTG

[0073] SEQ ID No.10: tctcaagggcatcggtcgacAACTTGTTTATTGCAGCTTATAATG

[0074] Example 6 pGL3-EcRE-Fluc-Ac5-Rluc / PuroR stable transfected cell line

[0075] (1) Transfection of Drosophila Kc cells with pGL3-EcRE-Fluc-Ac5-Rluc / PuroR plasmid

[0076] Use Effectene (Qiagen) transfection reagent to transfect Drosophila Kc cells with pGL3-EcRE-Fluc-Ac5-Rluc / PuroR plasmid. The specific steps are as follows: Before transfection, inoculate about 2.0×106 Kc cells into a 6-well plate and let them stand overnight at 27°C to allow them to adhere firmly; On the day of transfection, dilute 0.4 μg DNA (plasmid) dissolved in TE buffer, add Buffer EC until the volume reaches 100 μl, then add 3.2 μl Enhancer and vortex for 1 s, and centrifuge at low speed to remove the droplets on the tube wall; Incubate at room temperature (25°C) for 2–5 min; Pipette 10 μl Effectene Transfection Reagent into the DNA-Enhancer mixture, carefully pipette up and down 5 times to mix evenly, and let it stand at room temperature for 5–10 min; While standing, aspirate the original culture medium, rinse once with 1 ml PBS, and then add 1600 μl fresh medium; Pipette 600 μl culture medium into the transfection mixture, carefully pipette up and down twice to mix evenly, and immediately add it dropwise to the 6-well plate, and finally gently swirl to mix evenly.

[0077] (2) Screening of stable transfected cell line

[0078] After transfection for 48 h, add puromycin (final concentration 5 μg / ml) for screening. After 3 d, change to a new culture medium and continue to add puromycin (final concentration 5 μg / ml) for screening. After screening 4 - 5 rounds like this, take 1 ml of cells and plate them into a 24-well plate. After standing and culturing for 12 h, add the ecdysteroid analog chlorantraniliprole (MCE) at a final concentration of 1 μM and treat for 12 h. Then use a dual-luciferase assay kit (Yeasen Biotech) to measure the enzyme activities of firefly luciferase and Renilla luciferase to identify whether the pGL3-EcRE-Fluc-Ac5-Rluc / PuroR plasmid has been stably transfected into the cells. After passing the identification, expand the culture of the cells and cryopreserve them. Figure 3This is the result of dual luciferase identification of positive cells.

[0079] Example 7 Effect Verification Test

[0080] 1 ml of cells were plated into a 24-well plate and cultured for 12 h. Then, the ecdysone analog chlorfenapyr (MCE, Catalog No.: RH-0345) with a final concentration of 1 uM was added to the experimental group 1, and the ecdysone analog chlorfenapyr (MCE, Catalog No.: Su-4885) with a final concentration of 1 uM was added to the experimental group 2. An equal volume of solvent was added to the control group. After 12 h of treatment, the enzyme activities of firefly luciferase and Renilla luciferase were determined using a dual luciferase assay kit (Yisheng Biotechnology).

[0081] To test the pGL3-EcRE-Fluc-Ac5-Rluc / PuroR stable cell line for the screening of ecdysone antagonists, the known ecdysone antagonist metyrapone was added to the cells while the ecdysone analogs were added. Figure 4 It was observed that the activity of firefly luciferase was indeed reduced, indicating that this cell line can indeed be used to screen ecdysone antagonists.

[0082] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0083] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A recombinant vector for screening ecdysteroid analogs and antagonists, characterized in that, the recombinant vector is pGL3-EcRE-Fluc-Ac5-Rluc / PuroR vector, and the nucleotide sequence of the recombinant vector is shown in SEQ ID No.

1.

2. The method for constructing the recombinant vector according to claim 1, characterized in that, it comprises the following steps: S1: Construct pGL3-EcRE-Fluc vector; S2: Construct pAc-Rluc-PuroR vector; S3: Construct pGL3-EcRE-Fluc-Ac5-Rluc / PuroR vector; The specific operation of S1 is: Insert 4×EcRE and hsp70 minimal promoter at SacⅠ and XhoⅠ of the vector pGL3 basic plasmid to obtain pGL3-EcRE-Fluc vector; The nucleotide sequence of the EcRE is shown in SEQ ID No.2; the nucleotide sequence of the hsp70 minimal promoter is shown in SEQ ID No.3; the nucleotide sequence of the pGL3-EcRE-Fluc vector is shown in SEQ ID No.

4.

3. The construction method according to claim 2, characterized in that, the specific operation of S2 is: 1) Using pRL-SV40 plasmid as a template, clone the Renilla luciferase encoding gene Rluc using the forward primer Rluc-S and the reverse primer Rluc-AS, and remove the stop codon of Rluc; 2) Purify and recover the PCR product using the Takara gel extraction kit. After digesting the purified Rluc fragment and the pAc-y1sgRNA-Cas9 plasmid with the restriction enzymes HindIII and KpnI at 37°C for 3 h, cut the gel to recover the target fragment and the vector; 3) Use T4 DNA ligase to ligate overnight at 16°C, then perform conventional transformation and sequencing to obtain pAc-Rluc-PuroR vector.

4. The construction method according to claim 3, characterized in that, the nucleotide sequence of the forward primer Rluc-S is shown in SEQ ID No.5; the nucleotide sequence of the reverse primer Rluc-AS is shown in SEQ ID No.6; the nucleotide sequence of the Rluc is shown in SEQ ID No.7; the nucleotide sequence of the pAc-Rluc-PuroR vector is shown in SEQ ID No.

8.

5. The construction method according to claim 2, characterized in that, the specific operation of S3 is: 1) Using the forward primer S and the reverse primer AS, use the pAc-Rluc-PuroR vector as a template to amplify a fragment containing the Actin5 promoter, Rluc, and the puroR and SV40 sequences; 2) Purify and recover the PCR product using the Takara gel recovery kit; after linearizing the pGL3-EcRE-Fluc vector with BamhⅠ and SalⅠ restriction endonucleases, ligate the recovered PCR fragment and the linearized vector using the Gibson Assembly Kit seamless cloning kit; 3) Place the reaction system in a 50 °C water bath, perform conventional transformation and sequencing after 15 min to obtain the screening vector for ecdysteroid analogs or antagonists, denoted as pGL3-EcRE-Fluc-Ac5-Rluc / PuroR.

6. According to the construction method described in claim 5, characterized in that, the nucleotide sequence of the forward primer S is as shown in SEQ ID No. 9; the nucleotide sequence of the reverse primer AS is as shown in SEQ ID No.

10.

7. A pGL3-EcRE-Fluc-Ac5-Rluc / PuroR stable cell line, characterized in that, it is obtained by transfecting the recombinant vector described in claim 1 into the Drosophila Kc cell line.

8. Use of the recombinant vector described in claim 1 or the stable cell line described in claim 7 in high-throughput screening of ecdysteroid analogs and / or antagonists.