Nanobody against h9 subtype avian influenza virus and expression engineering strain and preparation method thereof
By screening and expressing heavy chain antibodies against H9 subtype avian influenza virus, the variable region sequence was used to construct recombinant nanobody H9-Nb011 in the Pichia pastoris system. This solved the problem of the lack of effective nanobody prevention or treatment for H9 subtype avian influenza in the existing technology, and achieved efficient and low-cost preparation and application.
Patent Information
- Application Number
- CN202311571275.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2023-03-10
- Filing Date
- 2023-11-23
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2043-11-23
AI Technical Summary
Current research on nanobody studies against H9 subtype avian influenza virus is limited, and there is a lack of effective new preventive or therapeutic agents.
By screening the variable region sequence of heavy chain antibody against H9 subtype avian influenza virus from the VHH phage library of immunized alpacas, constructing a recombinant eukaryotic expression plasmid and expressing it in the Pichia pastoris expression system, a highly efficient recombinant nanobody H9-Nb011 was prepared.
The prepared recombinant nanobody H9-Nb011 has a neutralizing titer of 4 log2 and a yield of 3.5 mg/L. It is suitable for the prevention and treatment of H9 subtype avian influenza. The preparation is simple, low-cost, and suitable for large-scale production.
Smart Images

Figure CN117720649B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a nanobody sequence against H9 subtype avian influenza virus, its expression engineered strain, and preparation method. Background Technology
[0002] Avian influenza is an infectious disease in birds caused by influenza A viruses of the Orthomyxoviridae family, resulting in a range of symptoms from respiratory illness to systemic septicemia. It is classified into low-pathogenic and highly pathogenic avian influenza. Among them, the H9 subtype of avian influenza has a wide range of transmission, serious mixed infections, and causes huge direct and indirect economic losses, posing new challenges to prevention and control.
[0003] Nanobodies are antibody fragments composed solely of the variable region (VHH) of a single heavy chain antibody, exhibiting only the smallest functional antigen-binding active region. They possess advantages such as small relative molecular mass, high stability, strong specificity, high affinity, good solubility, strong tissue penetration, ability to recognize antigen gap epitopes, ease of genetic modification, low production cost, modularity, and weak immunogenicity, demonstrating greater application value. These advantages have made nanobodies a hot topic and trend in the development of novel biotherapeutic agents.
[0004] Currently, there are limited reports on nanobodies against H9 subtype avian influenza virus. Zhao Qin et al. disclosed a nanobodies against H9N2 subtype avian influenza virus, their preparation method, and applications. They successfully prepared a fusion protein of the nanobodies and HRP, and applied this fusion protein to detect antibodies against H9N2 subtype avian influenza virus (AIV) in chicken serum. They found that the detection method constructed with this fusion protein had high sensitivity and advantages such as simple operation, no need for secondary antibodies, and short sample detection time (Zhao Qin, Sun Yani, Wang Kun et al. Nanobodies against H9N2 subtype avian influenza virus, preparation method and applications [P]. Shaanxi Province: CN111171146B, 2022-03-04.). However, existing data have not reported any research on nanobodies against H9 subtype avian influenza virus as novel preventive or therapeutic agents. Summary of the Invention
[0005] The purpose of this invention is to provide a nanobody sequence against H9 subtype avian influenza virus, its expression engineered strain, and preparation method to solve the problems existing in the prior art.
[0006] The technical solution adopted by this invention to solve the technical problem is as follows:
[0007] The present invention provides a nanobody against H9 subtype avian influenza virus, wherein the nucleotide sequence encoding the nanobody is shown in SEQ ID NO:1, and the amino acid sequence of the nanobody is shown in SEQ ID NO:2.
[0008] Furthermore, the present invention also provides a method for screening nucleotide sequences encoding the variable region of the heavy chain antibody, specifically comprising the following steps:
[0009] A variable region sequence of a heavy chain antibody against H9 subtype avian influenza virus was screened from the VHH phage library of immunized alpacas. This sequence was directionally cloned into the eukaryotic expression plasmid pPIC9K to construct a recombinant eukaryotic expression plasmid. The plasmid was then transformed into a Pichia pastoris expression system to screen for expression engineered strains. After methanol induction, supernatant collection, affinity chromatography purification, and other treatments, recombinant nanobodies were obtained.
[0010] Furthermore, based on the aforementioned heavy chain antibody variable region sequence, this invention also provides a recombinant eukaryotic expression plasmid constructed from the aforementioned heavy chain antibody variable region sequence.
[0011] Furthermore, the present invention also provides a method for constructing the recombinant eukaryotic expression plasmid, specifically including the following steps:
[0012] The selected heavy chain antibody variable region sequence and pPIC9K vector were digested with restriction endonucleases EcoRI and NotI, respectively, and recovered by 1% agarose gel electrophoresis. The target fragment was ligated with T4 ligase and transformed into E. coli DH5α competent cells. The cells were plated and cultured overnight. Single colonies were picked the next day, and the correctly identified recombinant eukaryotic expression plasmid was named pPIC9K-H9-Nb011 and stored at -20℃ for later use. The nucleotide sequence of the recombinant eukaryotic expression plasmid pPIC9K-H9-Nb011 is shown in SEQ ID NO:3.
[0013] Based on the above-described recombinant eukaryotic expression plasmid, the present invention also provides a recombinant expression engineered strain constructed from the recombinant eukaryotic expression plasmid.
[0014] Furthermore, the present invention also provides a method for constructing the recombinant expression engineered strain, specifically including the following steps:
[0015] The recombinant eukaryotic expression plasmid was linearized using the restriction endonuclease Sal I, added to Pichia pastoris X-33 competent cells, mixed well, and then transferred to a pre-cooled electroporation cuvette. After being placed on ice, the plasmid was transferred to an electroporator for electroporation. After electroporation, pre-cooled sorbitol was added, and the plasmid was transferred to a centrifuge tube and incubated at 30°C. The cells were then centrifuged at room temperature, collected, and resuspended in YPG medium. The cells were then spread onto YPG solid medium containing bleomycin and incubated at 37°C for 2-3 days. Single colonies were picked for PCR identification. If the identification was correct, the recombinant nanobody expression engineered strain was obtained.
[0016] Based on the aforementioned recombinant expression engineered strain, the present invention also provides a recombinant nanobody against H9 subtype avian influenza virus prepared from the aforementioned recombinant expression engineered strain.
[0017] Furthermore, the present invention also provides a method for preparing the recombinant nanobody against H9 subtype avian influenza virus, specifically including the following steps:
[0018] The recombinant nanobody expression strain was inoculated into YPG medium for rejuvenation. The next day, it was inoculated into a shake flask containing YPG medium and cultured overnight at 28°C and 200 r / min. The cells were collected by centrifugation and resuspended in an equal volume of BMMY liquid medium. The cells were induced at 28°C and 200 r / min for 120 hours, with methanol added at a final concentration of 0.5% every 24 hours. The supernatant was collected and purified to obtain the recombinant protein. The relative molecular mass of the recombinant protein was 14.6 kDa, consistent with the expected size. This recombinant protein is the recombinant nanobody H9-Nb011.
[0019] Finally, the present invention also provides the use of the recombinant nanobody against H9 subtype avian influenza virus in the preparation of nanobody formulations for the prevention and / or treatment of H9 subtype avian influenza.
[0020] The beneficial effects of this invention are:
[0021] This invention develops a recombinant nanobody against H9 subtype avian influenza virus. The recombinant nanobody is prepared using a Pichia pastoris expression system, with a yield of 3.5 mg / L and a neutralizing activity titer of 4 log2 against H9 subtype avian influenza virus, exhibiting significant biological activity. It can be used to prepare novel nanobody formulations for the prevention and / or treatment of H9 subtype avian influenza.
[0022] Its advantages are as follows:
[0023] 1. One of the recombinant nanobody sequences against H9 subtype avian influenza virus of the present invention was screened from an established VHH phage library of immunized alpacas. Its immunogenic antigen is the currently prevalent H9 subtype avian influenza virus strain (LY strain). The screened nanobody has a higher binding compatibility with the prevalent virus strain.
[0024] 2. The neutralizing titer of one of the recombinant nanobodies against H9 subtype avian influenza virus of the present invention is 4log2, which is the first report of its kind.
[0025] 3. The recombinant nanobody expression strain of the present invention is constructed using the Pichia pastoris expression system, and this strategy is disclosed for the first time.
[0026] 4. The method for preparing recombinant nanobodies of the present invention is simple to operate, low in cost, and can ensure the yield, activity, safety and production applicability of recombinant nanobodies, making it suitable for large-scale production. Attached Figure Description
[0027] Figure 1 The identification results of the VHH phage library for immunized alpacas.
[0028] Figure 2 The results of ELISA detection for solid-phase screening of VHH phage library of immunized alpacas.
[0029] Figure 3 A map of the recombinant eukaryotic expression plasmid pPIC9K-H9-Nb011.
[0030] Figure 4 The results are from Western blot analysis of the recombinant nanobody. Detailed Implementation
[0031] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0032] Example 1: Construction of VHH phage library for immunizing alpacas and screening of heavy chain antibody variable region (VHH) sequences.
[0033] (1) Two-year-old male alpacas (purchased from Jiangsu Dengyuanhe Biotechnology Co., Ltd.) were injected subcutaneously into the neck with a bivalent inactivated vaccine against Newcastle disease and avian influenza (H9 subtype) (La Sota strain + JY strain) (purchased from Fujian Shengwei Biotechnology Co., Ltd.). The injection volume was 3 mL / alpacia. Booster immunizations were given on days 14, 28, 42, and 56 after immunization. Serum antibody titers were measured. When the ELISA titer of serum antibodies reached 1:25600, peripheral blood was collected from the alpacas. Lymphocytes were separated using camel peripheral blood lymphocyte separation fluid (purchased from Beijing Solarbio Science & Technology Co., Ltd.). RNA was extracted and reverse transcribed into cDNA using an RNA extraction kit and a reverse transcription kit (purchased from Nanjing Novizan Biotechnology Co., Ltd.). The variable region (VHH) sequence of the heavy chain antibody was amplified by two rounds of nested PCR. The primer sequences for the first round were CALL-1 and CALL-2, and the primer sequences for the second round were Sac1-VHH-F and Spe1-VHH-R. All the primers mentioned above were synthesized by General Biotech (Anhui) Co., Ltd. The primer sequence information is as follows:
[0034] CALL-1:GTCCTGGCTGCTCTTCTACAAGG;
[0035] CALL-2:GGTACGTGCTGTTGAACTGTTCC;
[0036] Sac1-VHH-F: GAGCTCATGGATGTGCAGCTGGT;
[0037] Spe1-VHH-R:ACTAGTTGAGGAGACGGTGACCT.
[0038] (2) The amplified VHH sequence and pComb3Xss plasmid (purchased from Nanjing Yifeixue Biotechnology Co., Ltd.) were digested with restriction endonucleases Sac I and Spe I (purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.), then ligated with T4 ligase (purchased from Baoriyi Biotechnology (Beijing) Co., Ltd.) and transformed into Escherichia coli TG1 competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.). The next day, 19 single colonies were picked for bacterial PCR. The results are as follows: Figure 1 As shown, all 19 single colonies were positive, and sequencing analysis revealed that all sequences were distinct, indicating a 100% (19 / 19) positive rate (VHH phage positivity rate) and high diversity (19 / 19) for the immunized alpaca VHH phage library, demonstrating successful construction. The calculated library size (based on plate counts and dilution ratios) is 5 × 10⁻⁶. 8 indivual.
[0039] (3) The inactivated H9 subtype avian influenza virus JY strain (provided by Fujian Shengwei Biotechnology Co., Ltd.) was coated onto an ELISA plate. Antibody library solid-phase screening technology (referring to Megan A. Schladetsch, et al. Generation of Single-Chain Variable Fragment (scFv) Libraries for Use in Phage Display [J]. Current protocols, 2021, 1(7): e182.) was used to screen for VHH sequences (i.e., recombinant nanobody sequences against H9 subtype avian influenza virus) that could bind to the H9 subtype avian influenza virus. The ELISA detection results of the solid-phase screening are as follows: Figure 2 As shown, 18 VHH sequences were screened, among which Nb011 had the highest OD value. Its nucleotide sequence is SEQ ID NO:1, and the encoded amino acid sequence is SEQ ID NO:2.
[0040] Example 2 Construction and Identification of Recombinant Eukaryotic Expression Plasmids
[0041] The VHH sequence (Nb011) screened in Example 1 and the pPIC9K vector (purchased from Thermo Fisher Scientific (China) Co., Ltd.) were digested with restriction endonucleases EcoRI and Not I (both EcoRI and Not I were purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.), respectively. The fragments were recovered by 1% agarose gel electrophoresis. The target fragment was ligated with T4 ligase (purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.) and transformed into E. coli DH5α competent cells (purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.). The cells were plated and cultured overnight. The next day, single colonies were picked, and the correctly identified recombinant eukaryotic expression plasmid was named pPIC9K-H9-Nb011. Figure 3 Store at -20℃ for later use. The nucleotide sequence of pPIC9K-H9-Nb011 is shown in SEQ ID NO:3.
[0042] Example 3: Construction of engineered strains for expressing recombinant nanobodies
[0043] The recombinant eukaryotic expression plasmid pPIC9K-H9-Nb011 was linearized using the restriction endonuclease Sal I (purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.). The plasmid was then added to Pichia pastoris X-33 competent cells (purchased from Changsha Aikebo Biotechnology Co., Ltd.), gently mixed, and transferred to a pre-chilled electroporation cuvette. After incubation on ice for 5 minutes, the cells were transferred to an electroporator (purchased from Bio-Rad Biomedical Products (Shanghai) Co., Ltd.). The electroporation parameters were set as follows: voltage 1.5 kV, resistance 250 Ω, and capacitance 25 μF. Immediately after electroporation, 1 mL of pre-chilled 1 M sorbitol (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) was added. After two pipette spins, the cells were transferred to a 1.5 mL centrifuge tube and incubated statically at 30°C for 1 h. The cells were then centrifuged at 4000 r / min for 4 minutes at room temperature. The cells were collected and 100 μL of the solution was added to the centrifuge tube. The culture was resuspended in YPG medium (purchased from Beijing Solarbio Science & Technology Co., Ltd.), plated onto YPG solid medium containing 100 μg / mL bleomycin (Zeocin, purchased from Shanghai Beyotime Biotechnology Co., Ltd.), and incubated at 37°C for 3 days. Single colonies were picked for PCR identification, with a length of 381 bp. After successful identification, the engineered strain for expressing recombinant nanobodies was obtained.
[0044] Example 4: Preparation of recombinant nanobody H9-Nb011
[0045] The expression strain obtained in Example 3 was first inoculated into 20 mL of YPG medium for revitalization. The next day, 5 mL of the culture was inoculated into a 1 L shake flask (containing 250 mL of YPG medium) and cultured overnight at 28°C and 200 r / min. The cells were collected by centrifugation and resuspended in an equal volume of BMMY liquid medium (purchased from Beijing Solarbio Science & Technology Co., Ltd.). The cells were induced at 28°C and 200 r / min for 120 hours (with methanol added every 24 hours to a final concentration of 0.5%). The supernatant was collected and purified according to the affinity chromatography column (purchased from Shanghai Beyotime Biotechnology Co., Ltd.) instructions to obtain the recombinant protein. The molecular weight and purity of the recombinant protein were analyzed by SDS-PAGE and Western blot. The Western blot results are as follows: Figure 4 As shown, the relative molecular mass of the obtained recombinant protein is 14.6 kDa, which is consistent with the expected value, indicating that the recombinant protein is the recombinant nanobody H9-Nb011 with a concentration of 0.48 mg / mL and a purity of 90%.
[0046] Example 5: Detection of the neutralizing activity of recombinant nanobody H9-Nb011
[0047] Using a virus-fixation and antibody-dilution method, DF-1 cells (purchased from ATCC, USA) were digested and seeded into 96-well cell plates. Serially diluted recombinant nanobody H9-Nb011 (2-fold) was mixed with an equal volume of antibody containing 200 TCID50. 50 The H9 subtype avian influenza virus JY strain suspension was thoroughly mixed and incubated at 37°C for 1 hour. 0.1 ml of the virus-antibody suspension was then inoculated into each well of a 96-well cell plate. Virus and normal cell controls were also included. The plates were incubated at 37°C with 5% CO2, and the results were observed. The results showed that the neutralizing titer of the recombinant nanobody H9-Nb011 was 4 log2, which is a first-time report.
[0048] The recombinant nanobody H9-Nb011 prepared by this invention exhibits good biological activity and can be used to prepare novel nanobody formulations for the prevention and / or treatment of H9 subtype avian influenza. The method for preparing the recombinant nanobody H9-Nb011 by this invention is simple to operate, low in cost, and can ensure the yield, activity, safety, and practicality of the recombinant nanobody for production, making it suitable for large-scale production.
[0049] This invention discloses a recombinant nanobody against H9 subtype avian influenza virus, its engineered expression strain, and its preparation method. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The product of this invention has been described through preferred embodiments, and those skilled in the art can clearly modify or appropriately change and combine the product described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
Claims
1. A Nanobody against H9 subtype avian influenza virus, characterized in that, The nucleotide sequence encoding the nanobody is shown as SEQ ID NO: 1, and the amino acid sequence of the nanobody is shown as SEQ ID NO:
2.
2. A recombinant eukaryotic expression plasmid comprising the coding gene of the nanobody against the H9 subtype avian influenza virus according to claim 1, wherein the nucleotide sequence of the coding gene is shown as SEQ ID NO:
1.
3. A recombinant expression engineering strain comprising the recombinant eukaryotic expression plasmid according to claim 2.
4. The recombinant expression engineering strain of claim 3, characterized in that, The recombinant eukaryotic expression plasmid has the nucleotide sequence shown as SEQ ID NO:
3.
5. A method of constructing the recombinant expression engineering strain as claimed in claim 4, characterized by, The method comprises the following steps: The recombinant eukaryotic expression plasmid according to claim 4 is linearized by a restriction endonuclease Sal I, and the linearized recombinant eukaryotic expression plasmid is added to Pichia pastoris X-33 competent cells, mixed, transferred to a pre-cooled electrotransformation cup, and subjected to electrotransformation after ice bath; after electrotransformation, pre-cooled sorbitol is added, and after aspiration, the mixture is transferred to a centrifuge tube, incubated in an incubator, and then centrifuged at room temperature to collect the bacterial cells, which are resuspended in YPG medium and plated on YPG solid medium containing zeocin, and incubated at 37℃ for 3 days; single colonies are picked and subjected to PCR identification, and the correct colonies are obtained as the recombinant expression engineering strain.
6. A recombinant nanobody against the H9 subtype avian influenza virus, which is prepared from the recombinant expression engineering strain according to claim 3 or 4.
7. A method of preparing the recombinant nanobody of claim 6, characterized in that, The method comprises the following steps: The recombinant expression engineering strain according to claim 3 or 4 is inoculated into YPG culture solution for rejuvenation, inoculated into a flask containing YPG culture solution the next day, and incubated at 25-30℃ and 180-220 r / min overnight; the bacterial cells are collected by centrifugation, resuspended in an equal volume of BMMY liquid medium, and induced at 25-30℃ and 180-220 r / min for 100-140 hours with methanol added every 24 hours; the supernatant is collected, and the recombinant protein is obtained after purification, wherein the relative molecular mass of the recombinant protein is 14.6 kDa, and the recombinant protein is the recombinant nanobody H9-Nb011.
8. Use of the recombinant nanobody against the H9 subtype avian influenza virus according to claim 6 in the preparation of a nanobody preparation for preventing and / or treating H9 subtype avian influenza in chickens.
Citation Information
Patent Citations
Antibody, composite using same, detection device and method
CN110724191A
Nanobody capable of resisting H9N2 subtype avian influenza viruses, preparation method and application
CN111171146A