A long subspecies of Bifidobacterium longum YYS-BSM8 with heavy metal adsorption and benzo[a]pyrene degradation capabilities and its applications

Abstract

The present invention relates to the field of microbial technology, and provides a Bifidobacterium longum subspecies longum YYS-BSM8 having heavy metal adsorption and benzopyrene degradation functions and its application. Bifidobacterium longum subsp.Longum YYS‑BSM8 is deposited under the CGMCC No. 28611. This bacterium can utilize various oligosaccharides as its sole carbon source for growth and produces high levels of short-chain fatty acids. It exhibits excellent benzo[a]pyrene removal, heavy metal adsorption of lead and cadmium, and inhibition of Staphylococcus aureus and Escherichia coli. It also exhibits excellent coagulation with Staphylococcus aureus, high biofilm formation, and SOD enzyme production. This bacterium may provide a new probiotic source for the development of products with benzo[a]pyrene removal, heavy metal adsorption, intestinal conditioning, antibacterial properties, and SOD enzyme-enzyme-enhancing properties.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a long subspecies of Bifidobacterium longum YYS-BSM8 with heavy metal adsorption and benzo[a]pyrene degradation capabilities and its applications. Background Technology

[0002] Constipation and other functional bowel disorders, as well as inflammatory bowel disease (IBD), are common intestinal diseases. Constipation easily leads to the accumulation of toxins in the body, causing symptoms such as bad breath and fatigue, damaging the function of the five internal organs, and causing a series of complications, posing a significant threat to health. IBD has multiple causes, with common pathogens such as Staphylococcus aureus and Escherichia coli being among the factors leading to food poisoning, diarrhea, and other gastrointestinal discomfort. Prevention is key for intestinal diseases, and daily diet plays an important role in their prevention and improvement. Studies have shown that short-chain fatty acids (SCFAs) play an important role in the treatment of intestinal diseases and constipation. They can provide energy to intestinal cells, regulate the acid-base balance in the intestine, inhibit harmful intestinal bacteria, relieve inflammation, stimulate intestinal wall nerves, accelerate intestinal peristalsis, and thus improve constipation and intestinal function. SCFAs mainly come from the products of intestinal bacteria breaking down carbohydrates, and the level at which beneficial intestinal bacteria break down carbohydrates determines their production.

[0003] Lead and cadmium are recognized as significant pollutants in modern industrial development. Large quantities of lead- and cadmium-containing wastewater are generated during metal smelting, machining, battery production, metallurgy, printing, and non-ferrous metal manufacturing. Heavy metals are also emitted from vehicle exhaust, polluting soil, groundwater, and air. These heavy metals can be absorbed directly or indirectly through the food chain, accumulating chronically and causing harm. Lead, in particular, damages the nervous system, leading to neurological disorders and affecting intellectual development and cognitive function. It can also irritate the digestive, immune, and circulatory systems. Cadmium damages the digestive, urinary, musculoskeletal, and respiratory systems, and long-term exposure may increase the risk of cancer. Therefore, it is essential to remove heavy metals promptly in daily life.

[0004] Benzo[a]pyrene is a common carcinogen. Long-term inhalation or consumption of foods high in benzo[a]pyrene can easily induce various cancers, including lung cancer, liver cancer, colorectal cancer, and stomach cancer. In daily life, the main sources of benzo[a]pyrene include cigarette smoke, vehicle exhaust, smoked and grilled foods, and foods cooked at high temperatures. Stir-frying or deep-frying foods at temperatures exceeding 270°C will produce benzo[a]pyrene. Grilled foods also produce benzo[a]pyrene; the content in charred parts can be 10-20 times higher than in ordinary foods. Therefore, reducing or promptly eliminating benzo[a]pyrene is of great significance for preventing cancer and other chronic diseases.

[0005] Based on this, the purpose of this invention is to provide a probiotic that can utilize various oligosaccharide carbon sources to produce short-chain fatty acids, significantly adsorb heavy metals lead and cadmium, and significantly remove benzo[a]pyrene, in order to be applied to the development of functional products for the removal of harmful substances such as heavy metals lead and cadmium and benzo[a]pyrene, and for the conditioning of intestinal diseases. Summary of the Invention

[0006] To address the shortcomings of the prior art mentioned in the background section, this invention provides a *Bifidobacterium longum* subsp. *longum* YYS-BSM8, classified as *Bifidobacterium longum* subsp. *longum*, with the Latin scientific name: Bifidobacterium longum subsp. Longum, It was deposited on October 12, 2023, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 28611.

[0007] The present invention also provides a composition containing Bifidobacterium longum subsp. YYS-BSM8 as described above.

[0008] In one embodiment, the composition comprises a microbial preparation.

[0009] In one embodiment, the number of *Bifidobacterium longum* subsp. YYS-BSM8 in the composition is ≥1×10⁻⁶. 6 CFU / mL or ≥1×10 6 CFU / g.

[0010] Preferably, in the composition, the number of *Bifidobacterium longum* subsp. YYS-BSM8 is ≥1×10⁻⁶. 8 CFU / mL or ≥1×10 8 CFU / g.

[0011] In one embodiment, the composition comprises one or more combinations of uninactivated Bifidobacterium longum subsp. YYS-BSM8, inactivated Bifidobacterium longum subsp. YYS-BSM8, metabolites of Bifidobacterium longum subsp. YYS-BSM8 strain, and freeze-dried Bifidobacterium longum subsp. YYS-BSM8 strain.

[0012] The present invention also provides a fermentation product obtained by fermentation of Bifidobacterium longum subsp. YYS-BSM8 as described above.

[0013] The present invention also provides the use of Bifidobacterium longum subsp. YYS-BSM8 and / or its ferments as described above in the preparation of functional products.

[0014] In one embodiment, the functional product includes at least one of the following functions:

[0015] (1) It can use a variety of oligosaccharides as the sole carbon source for growth and reproduction;

[0016] (2) It can produce high levels of acetic acid, propionic acid, isobutyric acid, n-butyric acid and isovaleric acid. Stachyose can be used to further promote the production of short-chain fatty acids.

[0017] (3) It has a good removal effect on benzo[a]pyrene;

[0018] (4) It has a good adsorption effect on heavy metals lead and cadmium;

[0019] (5) Good biofilm formation ability;

[0020] (6) It has a good inhibitory effect on Staphylococcus aureus and Escherichia coli;

[0021] (7) It has a good co-aggregation ability against Staphylococcus aureus;

[0022] (8) It can produce SOD enzyme.

[0023] In one embodiment, the functional products include heavy metal detoxification, benzo[a]pyrene detoxification, intestinal conditioning, laxative, antibacterial products, and SOD enzyme products.

[0024] The present invention also provides the use of Bifidobacterium longum subsp. YYS-BSM8 or the composition described above in the preparation of fermented foods.

[0025] In one embodiment, Bifidobacterium longum subsp. YYS-BSM8 is used as a probiotic to ferment fruits and traditional Chinese medicines to prepare fermented foods.

[0026] Based on the above, compared with the prior art, the Bifidobacterium longum subspecies YYS-BSM8 provided by the present invention has the following beneficial effects:

[0027] The *Bifidobacterium longum* subspecies YYS-BSM8 provided by this invention can produce short-chain fatty acids, adsorb heavy metals lead and cadmium, remove benzo[a]pyrene, has good biofilm formation ability, good inhibition and coagulation of *Staphylococcus aureus*, good inhibitory effect on *Escherichia coli*, and can produce SOD enzyme.

[0028] This bacterium can provide a new source of probiotics for the development of functional products such as heavy metal detoxification products, benzo[a]pyrene detoxification products, intestinal conditioning products, laxative products, antibacterial products, and SOD enzyme products, and has important application value.

[0029] Other features and beneficial effects of the present invention will be described in the following description, and in part will become apparent from the description, or will be understood by practicing the present invention. The objectives and other beneficial effects of the present invention can be achieved and obtained by the structures particularly pointed out in the description, claims and drawings. Attached Figure Description

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, a brief introduction will be given below to the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work. The positional relationships described in the drawings in the following description are based on the directions of the components drawn in the diagrams, unless otherwise specified.

[0031] Figure 1 The colony morphology diagram of *Bifidobacterium longum* subsp. YYS-BSM8 provided in the embodiments of the present invention;

[0032] Figure 2 Gram staining image of Bifidobacterium longum subspecies YYS-BSM8 provided in an embodiment of the present invention;

[0033] Figure 3 Scanning electron microscope image of Bifidobacterium longum subspecies YYS-BSM8 provided in an embodiment of the present invention.

[0034] Figure 4 Agarose gel electrophoresis image of the 16S rDNA target fragment amplified from Bifidobacterium longum subsp. YYS-BSM8 provided in this embodiment of the invention.

[0035] Figure 5 Phylogenetic tree diagram of the 16S rDNA gene of *Bifidobacterium longum* subspecies YYS-BSM8 provided in this embodiment of the invention.

[0036] Figure 6 A statistical chart showing the utilization and growth of different oligosaccharides by *Bifidobacterium longum* subsp. YYS-BSM8, provided in an embodiment of the present invention.

[0037] Figure 7 A statistical chart showing the production of short-chain fatty acid acetic acid by *Bifidobacterium longum* subspecies YYS-BSM8, provided in an embodiment of the present invention.

[0038] Figure 8 A statistical chart showing the production of remaining short-chain fatty acids by *Bifidobacterium longum* subspecies YYS-BSM8, provided in an embodiment of the present invention. Detailed Implementation

[0039] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. The technical features designed in the different embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other. All other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are within the scope of protection of the present invention.

[0040] In the description of this invention, it should be noted that all terms used in this invention (including technical and scientific terms) have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains, and should not be construed as limiting the invention; it should be further understood that the terms used in this invention should be understood to have the same meaning as those in the context of this specification and in the relevant field, and should not be understood in an idealized or overly formal sense, except as expressly defined in this invention.

[0041] This invention relates to Bifidobacterium longum subsp. ( Bifidobacterium longum subsp. Longum ) YYS-BSM8 It was isolated from the feces of an 8-month-old breastfed infant and is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 28611.

[0042] The following is an example of the procedure for extracting this bacterium from the feces of an 8-month-old breastfed infant:

[0043] Example 1: Screening and Isolation of Bacteria

[0044] Take 2g of stool from an 8-month-old infant, add 5ml of physiological saline and mix well, then dilute to 100ml. -1 10 -2 10 -3 Take 0.1 mL and spread it on MRS+L cysteine ​​medium. Incubate anaerobicly at 37℃ for 48-72 h. Select several single colonies of suspected lactic acid bacteria, purify them 3 times, and test their degradation and lead adsorption effects on benzo[a]pyrene. Select strains with good degradation and lead adsorption effects on benzo[a]pyrene, preserve them and name them YYS-BSM8.

[0045] Example 2: Identification of bacterial strains

[0046] 2.1 Morphological observation of YYS-BSM8 bacteria

[0047] The colony morphology of YYS-BSM8 is as follows: Figure 1 As shown, the bacterial cell morphology is as follows Figure 2 and 3As shown. The main morphological characteristics of YYS-BSM8 are as follows: the colonies are round, with smooth convexity, and appear white and opaque on MRS+L cysteine ​​medium; Gram-positive, the cells are mostly irregular rod-shaped, some are gourd-shaped, and sometimes one end is forked; strictly anaerobic, single or in pairs, width: 0.3-2μm, length: 1-4μm.

[0048] 2.2 Physiological and biochemical analysis of YYS-BSM8 bacteria

[0049] The biochemical experiments on lactic acid bacteria were conducted according to the standard method of GB4789.35. Specifically, a basal culture medium for lactic acid bacteria was prepared, containing cellobiose, maltose, mannitol, maltose, salicin, sorbitol, sucrose, raffinose, inulin, lactose, and 1% (w / v) sodium hippurate. YYS-BSM8 bacteria were inoculated into the medium at 1%. After the culture was completed, 0.2 mL of ninhydrin solution was slowly added along the wall of the test tube without shaking. The tubes were then incubated in a water bath at 36℃±1℃ for 10 minutes before the results were interpreted. The interpretation results are detailed in Table 1.

[0050] Table 1. Major biochemical reactions of YYS-BSM8

[0051]

[0052] Note: "+" indicates a positive test result, and "-" indicates a negative test result.

[0053] Conclusion: According to the results in Table 1, YYS-BSM8 bacteria can utilize maltose, lactose, sucrose, and raffinose, but cannot utilize compounds such as mannitol, salicin, sorbitol, cellobiose, salicin, inulin, and sodium hippurate.

[0054] 2.3 Molecular biological identification of YYS-BSM8

[0055] ① Extraction of YYS-BSM8 bacterial genomic DNA: Genomic DNA was extracted using a bacterial genomic DNA extraction kit from TIANGEN.

[0056] ② PCR amplification of the 16S rDNA sequence: The primers used to amplify the 16S rDNA gene sequence are:

[0057] F 9-27: 5'-GAGTTT GAT CCT GGC TCA G-3';

[0058] R 1525-1542: 5'–AGA AAG GAG GTG ATC CAG CC-3';

[0059] Specific primers for the Bifidobacterium GroEL gene:

[0060] 308F:5'-TCC GAT TAC GAY CGY GAG AAG CT -3';

[0061] 806R: 5'-CSG CYT CGG TSG TCA GGA ACA G-3'.

[0062] PCR reaction system: 12.5 μL of 2×Mix, 1 μL each of primers and DNA, and 9.5 μL of ddH2O.

[0063] PCR amplification program: 93℃ pre-denaturation for 4 min. Then denature at 94℃ for 30 s, 55℃ (16S rDNA), 72℃ extension for 90 s, for a total of 30 cycles, and finally extend at 72℃ for 10 min, and store at 4℃.

[0064] ③ PCR product detection and sequencing analysis: 5 μL of PCR product was separated and examined by gel electrophoresis in 1.0% agarose gel containing EB. The amplified 16S rDNA target fragment was 1489 bp in length, and the GroEL gene was 465 bp in length (see agarose gel electrophoresis image of the target fragment amplification). Figure 4 ).

[0065] ④ Phylogenetic analysis: Blast alignment analysis was performed on each 16S rRNA sequence in NCBI data to obtain the sequence and... Bifidobacterium longum subsp. Longum, Bifidobacterium longum subsp. Suillum, Bifidobacterium longum subsp. infantis The sequence homology of the series of standard strains was greater than 99%, and the subspecies types could not be distinguished.

[0066] Furthermore, the Bifidobacterium GroEL gene was compared to obtain its correlation with... Bifidobacterium longum subsp. Longum The homology of the standard bacteria was 99.34%, and... Bifidobacterium longum subsp. infantis The homology of the standard bacteria was 98.03%, and... Bifidobacterium longum subsp. Suillum The homology of the standard strain was 97.13%. Simultaneously, the GroEL gene was used to construct and analyze the phylogenetic tree of MEGA 4 using the Neighbor-joining method (results are shown in...). Figure 5 ), to determine it as Bifidobacterium longum subsp. Longum .

[0067] The results of YYS-BSM8 16S rDNA sequencing are as follows:

[0068]

[0069] The YYS-BSM8 GroEL gene sequence determination results are as follows:

[0070] GGAGCTGCAGATGGCTGGCGGCGTGGCTGTCATCAAGGTCGGCGCTGCCACCGAGGTCGAGGCCAAGGAGCGCAAGCACCGCATCGAAGATGCCGTGCGTAACGCCAAGGCCGCCATCGAGGAAGGCCTGCTGCCTGGCGGTGGCGTGGCCCTCGTTCAGGCTGCTGCCAAGGCCGAGAAGACCGAGGCCGTCACCTCCCTGACCGGCGAAGAGGCTACCGGTGCCGCCATCG TGTTCCGCGCCATCGAGGCCCCGATCAAGCAGATCGCCGAGAACGCCGGCGTGTCCGGTGACGTGGTCATCAACACCGTCCGCTCCCTGCCTGATGGCGAAGGCTTCAACGCCGCCACCGACACCTACGAAGACCTGCTGGCCGCCGGTGTGACCGACCCGGTCAAGGTGACCCGCTCCGCTCTGCAGAACGCCGCCTCCATCGCTGGTCTGTTCCTGAACCCGAAGCCGAT.

[0071] Conclusion: Based on morphological observation, lactic acid bacteria biochemical identification, and homology analysis in the DNA phylogenetic tree, YYS-BSM8 was identified as a subspecies of Bifidobacterium longum. Bifidobacterium longum subsp. Longum ) bacterial strains.

[0072] The performance characterization of Bifidobacterium longum subspecies YYS-BSM8 provided by this invention is as follows:

[0073] Example 3: Analysis of the growth and short-chain fatty acid production of *Bifidobacterium longum* subsp. *YYS-BSM8* using oligosaccharides.

[0074] Various oligosaccharide media were prepared by replacing glucose with an equal amount of oligosaccharides in MRS+L cysteine ​​medium. YYS-BSM8 yeast culture was inoculated at 1% (v / v) into MRS+L cysteine ​​medium containing each oligosaccharide, and cultured at 37℃ for 48 h. The bacterial OD was then measured. 600 Values ​​and short-chain fatty acid content. Results are shown in... Figure 6The results show that strain YYS-BSM8 can grow in MRS+L cysteine ​​medium with trehalose, stachyose, inulin, galactooligosaccharides, isomaltooligosaccharides, and fructooligosaccharides replacing glucose. Its growth OD value is between 0.99 and 1.28, which is not significantly different from the OD value of glucose (1.24), indicating that it can effectively utilize the above polysaccharides as the sole carbon source for growth.

[0075] The results of the short-chain fatty acid test are shown below. Figure 7 and Figure 8 , Figure 7 and Figure 8 The results indicate that YYS-BSM8 can utilize various oligosaccharides to produce short-chain fatty acids. Its ability to produce acetic acid from oligosaccharides is higher than that of glucose, with yields ranging from 5.6 to 13.3 mmol / L. It also exhibits high production capacities for propionic acid, isobutyric acid, n-butyric acid, and isovaleric acid. Propionic acid yields range from 50.89 to 72.84 μmol / L, isobutyric acid yields from 65.49 to 109.84 μmol / L, n-butyric acid yields from 19.12 to 85.18 μmol / L, and isovaleric acid yields from 29.47 to 44.03 μmol / L. When using stachyose as a carbon source, the yields of acetic acid, propionic acid, isobutyric acid, and isovaleric acid are the highest. When using trehalose as a carbon source, the yield of n-butyric acid is the highest.

[0076] Example 4: Removal effect of Bifidobacterium longum subsp. YYS-BSM8 on benzo[a]pyrene

[0077] The mother liquor of Bifidobacterium longum subsp. YYS-BSM8 was inoculated into MRS+L cysteine ​​medium at a rate of 1% (v / v) and cultured anaerobicly at 37℃ for 48 h to obtain the fermentation broth. An appropriate amount of benzo[a]pyrene was dissolved in dimethyl sulfoxide to prepare a 1 mg / mL benzo[a]pyrene mother liquor for later use.

[0078] Take 45 mL of YYS-BSM8 fermentation broth, centrifuge at 4500 r / min for 15 min, collect the bacterial cells, add physiological saline, and adjust the total bacterial cell count to (1.0±0.1)*10 using flow cytometry. 9CFU / mL was used to obtain a bacterial suspension. 2 mL of this suspension was added to benzo[a]pyrene stock solution to a final concentration of approximately 10 μg / mL, and mixed thoroughly to obtain the treatment group. Physiological saline solution of the same concentration without YYS-BSM8 was used as the control group. Both the treatment and control groups were incubated at 37℃ in the dark for 4 hours. After centrifugation, all supernatant was collected, and 2 mL of chloroform was added. The mixture was shaken and extracted for at least 10 minutes. After standing overnight, the lower organic phase was collected and placed in a brown liquid chromatography bottle for detection by high-performance liquid chromatography (HPLC). The benzo[a]pyrene content was detected using a SunFire C18 column (4.6 × 250 mm, 5 μm), with a UV detection wavelength of 290 nm, a mobile phase of chromatographic grade ethanol, a column temperature of 39.9℃, a flow rate of 1 mL / min, and an injection volume of 20 μL. The benzo[a]pyrene elution time was approximately 4.1 min.

[0079] The removal rate of benzo[a]pyrene (%) = (CK-X) / CK*100;

[0080] Wherein, CK refers to the measured value of benzo[a]pyrene content in the control group, and X refers to the measured value of benzo[a]pyrene content in the treatment group.

[0081] The test results are shown in Table 2. Compared with the control, the concentration of benzo[a]pyrene in the medium decreased significantly after the addition of YYS-BSM8. The calculated removal rate of benzo[a]pyrene by YYS-BSM8 was 74.46±0.12%, indicating that YYS-BSM8 has a good benzo[a]pyrene removal effect.

[0082] Table 2. Removal efficiency of YYS-BSM8 for benzo[a]pyrene

[0083]

[0084] Example 5: Adsorption effect of Bifidobacterium longum subsp. YYS-BSM8 on heavy metals Pb and Cd

[0085] Fermentation broth of *Bifidobacterium longum* subsp. *YYS-BSM8*, fermented for 24-48 hours, was collected by centrifugation. PBS was added, and the total particle count in the bacterial suspension was adjusted to (1.0±0.1)*10⁻⁶ using flow cytometry. 9 CFU / mL was used to obtain a bacterial suspension. Lead acetate was added to the bacterial suspension to an initial concentration of approximately 2.0 mg / L and 5 mg / L. The suspension was allowed to stand at 37 °C for 4 h for adsorption. PBS with the same concentration of lead acetate without bacterial suspension was used as a control (CK). The supernatant was collected by centrifugation and analyzed by graphite furnace atomic absorption spectrometry according to the national standard GB5009.12-2017. The detection instrument was a PinAAcle900Z atomic absorption spectrometer.

[0086] Lead adsorption rate (%) = (lead content) 对照 - Lead content 处理组 ) / Lead content对照 *100.

[0087] Fermentation broth of *Bifidobacterium longum* subsp. *YYS-BSM8*, fermented for 24-48 hours, was collected by centrifugation. PBS was added, and the total particle count in the bacterial suspension was adjusted to (1.0±0.1)*10⁻⁶ using flow cytometry. 9 Cfu / mL was added to cadmium sulfate to an initial concentration of approximately 2.0 and 10 mg / kg. The mixture was incubated at 37 ℃ for 4 hours for adsorption. PBS containing the same concentration of cadmium sulfate without bacterial suspension was used as a control (CK). The supernatant was collected after centrifugation, and the Cd adsorption rate was determined according to the national standard GB 5009.268-2016, National Food Safety Standard, Determination of Multiple Elements in Food, Method I: Inductively Coupled Plasma Mass Spectrometry (ICP-MS). The formula for calculating the Cd adsorption rate is as follows:

[0088] Cadmium adsorption rate (%) = (Cadmium content) 对照 -Cadmium content 处理组 ) / Cadmium content 对照 *100.

[0089] The calculation results are shown in Table 3. Table 3 shows that the YYS-BSM8 bacterial suspension has a good adsorption effect on heavy metals lead and cadmium. The adsorption rate of YYS-BSM8 bacteria for lead can reach 94.94%, and the adsorption rate for Cd is greater than 65%, indicating that YYS-BSM8 has a good adsorption effect on lead and also has a certain adsorption effect on Cd.

[0090] Table 3. Adsorption capacity analysis of YYS-BSM8 for heavy metals lead and cadmium.

[0091]

[0092] Example 6: Biofilm Formation Capacity Analysis of Bifidobacterium longum subsp. YYS-BSM8

[0093] MRS+L cysteine ​​medium was prepared by adding various oligosaccharides at a concentration of 0.5 g / L and fermenting at 37°C for 24-48 h. Using different oligosaccharide-containing media as dilutions, the bacterial count in each fermentation broth was adjusted to (1.0 ± 0.1) * 10⁻⁶ using flow cytometry. 8 Take 200 μL of the adjusted fermentation dilution (cfu / mL) and place it in a 96-well plate. Incubate at 37°C for 24 h. Discard the culture medium, add 0.2 mL of 1% crystal violet and react for 30 min. Rinse with distilled water, then dissolve in 0.2 mL of 95% (v / v) ethanol. Measure the absorbance of the resulting colored solution at 590 nm. Repeat the experiment three times and record the average value as OD. X The value, with uninoculated culture medium as a control, is counted as a replicate as OD. C When ODX OD C A ratio greater than 1 indicates that the bacteria have the ability to form biofilms; the higher the ratio, the stronger the ability. The test results are shown in Table 4, which indicates the OD values ​​for each treatment. X :OD C The values ​​were all greater than 3, indicating that YYS-BSM8 has a good biofilm formation ability. The biofilm formation ability of YYS-BSM8 was significantly higher after the addition of isomaltooligosaccharide and inulin than that of fermentation on MRSL (significance level: P<0.05), indicating that inulin and isomaltooligosaccharide help to further promote the formation of its biofilm.

[0094] Table 4 Biofilm formation capacity of YYS-BSM8 in different carbon source environments

[0095]

[0096] Example 7: Antibacterial activity of Bifidobacterium longum subsp. YYS-BSM8 against pathogenic bacteria.

[0097] Fermentation broth of *Bifidobacterium longum* subsp. *YYS-BSM8* was used, and its activity against *Staphylococcus aureus* was determined using the Oxford cup method. Staphylococcus Aureus ATCC25923) and Escherichia coli ( Escherichia coli The antibacterial activity of YYS-BSM8 (ATCC35150) was demonstrated. The inhibition zone diameter of YYS-BSM8 against Staphylococcus aureus was 18.33±0.58 mm, and the inhibition zone diameter of YYS-BSM8 against Escherichia coli was 17.00±3.46 mm, indicating that YYS-BSM8 has a good antibacterial effect against the above pathogens.

[0098] Example 8: Test of autoagglutination rate (%) and agglutination rate (%) of Bifidobacterium longum subsp. YYS-BSM8

[0099] Preparation strain YYS-BSM8 and Staphylococcus aureus ( Staphylococcus Aureus 45 ml of the fermentation broth (ATCC25923) was centrifuged at 4500 r / min and 4℃ for 5 min to collect the bacterial sludge. The sludge was washed twice with sterile phosphate-buffered saline (PBS) at pH 7.0 (i.e., PBS was added to the colonies, the mixture was shaken to mix thoroughly, and then centrifuged at 4500 r / min and 4℃ for 5 min to collect the bacterial cells). A bacterial suspension with an absorbance of 0.6 ± 0.1 (A0) at 600 nm was then prepared using PBS.

[0100] Self-agglutination rate test (%): YYS-BSM8 bacterial sludge was prepared into a bacterial suspension with an absorbance of 0.6±0.1 (A0) at a wavelength of 600 nm using sterile PBS. The absorbance A was measured after standing for different time periods (2h, 4h, 24h). X ;

[0101] Self-agglutination rate (%) = (1-A) x / A0)×100;

[0102] Where x represents 2, 4, and 24; A2 represents the absorbance value measured after the bacterial suspension has stood for 2 hours; A4 represents the absorbance value measured after the bacterial suspension has stood for 4 hours; A 24 The absorbance value is the value measured after the bacterial suspension has been allowed to stand for 24 hours. The same applies below.

[0103] Its aggregation rate (%): The absorbance of YYS-BSM8 and Staphylococcus aureus suspension was adjusted to 0.6±0.1 (A0) at a wavelength of 600 nm to obtain a mixed suspension. The absorbance A was measured after standing for different time periods (2h, 4h, 24h). x ;

[0104] Its aggregation rate (%) = (1-A) x / A0)×100.

[0105] The results are shown in the table below: It can be seen that the self-agglomeration rates of YYS-BSM8 at 2h, 4h and 24h are 9.99%, 23.79% and 34.95%, respectively, indicating a certain degree of self-agglomeration ability. The self-agglomeration rates with golden glucose are 6.64%, 21.76% and 80.01%, respectively, indicating that it has extremely high copolymerization ability with golden glucose after 24h of treatment.

[0106] Table 5. Determination of autoagglutination rate and agglutination rate against Staphylococcus aureus of YYS-BSM8.

[0107]

[0108] Example 9: Assay for SOD production by *Bifidobacterium longum* subsp. *YYS-BSM8*

[0109] SOD enzyme detection was performed using a superoxide dismutase (SOD) assay kit (Nanjing Jiancheng). Specifically, the supernatant was obtained by centrifuging the YYS-BSM8 fermentation broth. The supernatant was mixed with water at a ratio of 2:3. Following the instructions of the kit, the reaction system was prepared, the mixture was thoroughly homogenized, and incubated at 37°C for 20 minutes. The OD value was read at 450 nm using a microplate reader. In this study, the amount of enzyme corresponding to a 50% SOD inhibition rate in the reaction system was defined as one unit of SOD activity (U). Wherein:

[0110]

[0111]

[0112] Among them, A 对照 A represents the OD value of the control group. 对照空白A represents the OD value of the control group. 测定 A represents the OD value of the test group. 测定空白 This indicates the OD value of the blank control group.

[0113] The test results showed that the SOD enzyme activity in the fermentation supernatant of YYS-BSM8 was 50.59±0.03 U / mL, indicating that YYS-BSM8 has a good SOD enzyme production capacity.

[0114] Example 10: Survival analysis of *Bifidobacterium longum* subsp. *YYS-BSM8* in a simulated artificial gastric fluid environment.

[0115] (1) The survival rate test process was as follows: YYS-BSM8 bacteria fermented for 24 hours were collected by centrifugation at 12000 r / min for 5 min, and the same volume of 0.85% (w / v) physiological saline was added and mixed to prepare a bacterial suspension for later use; artificial gastric fluid (125 mM NaCl, 7 mM KCl, 45 mM NaHCO3 and 3 g / L pepsin) was prepared, and the pH value was adjusted to 2.5 and 3.0, and filtered through a 0.22 μM microporous membrane for later use; 1 mL of bacterial suspension was added to 9 mL of artificial gastric fluid with pH values ​​of 2.5 and 3.0, and placed in a constant temperature culture at 37℃. Untreated (0 h) and treated x (1 h, 2 h, 3 h, 5 h) samples were taken, and 0.9 mL of each sample was added to 0.1 mL of the solution. PI was stained at 37℃ for 10 min, and 0.1 ml was taken into 0.9 mL of ultrapure water. The survival rate P2 of different treatments was detected by flow cytometry. The survival rate of untreated bacteria was used as 100% control. The gastrointestinal tolerance of each treatment was calculated.

[0116] The formula for calculating bacterial survival rate at different treatment times is as follows:

[0117] Survival rate (%) = P2 / P2 对照 *100.

[0118] (2) The survival rate of YYS-BSM8 in different gastric fluid environments is shown in Table 6 below. According to the data, the following can be seen:

[0119] When YYS-BSM8 was treated in a simulated gastric fluid environment at pH 2.5 for 1-2 hours, its survival rate was 68.46-80.04%. When treated in a simulated gastric fluid environment at pH 3.0 for 1-5 hours, its survival rate was 67.89-90.23%. This indicates that YYS-BSM8 has good tolerance to the simulated gastric fluid environment, which provides a good basis for its degradation of acrylamide in the gastric fluid environment.

[0120] Table 6. Survival rate of YYS-BSM8 in simulated gastric fluid environment (%)

[0121]

[0122] Example 11: Survival analysis of *Bifidobacterium longum* subsp. *YYS-BSM8* in a simulated artificial pancreatic juice environment.

[0123] (1) Take the YYS-BSM8 bacteria fermented for 24 h, centrifuge at 12000 r / min for 5 min to collect the bacterial cells, add the same volume of 0.85% (w / v) physiological saline and mix well to prepare a bacterial suspension for later use; prepare protein pancreatic juice [0.1% (w / v) pancreatin, 0.15% (w / v) bovine bile], adjust the pH value to 7.5 and 8.0 respectively, filter through a 0.22 μM microporous membrane for later use, take 1 mL of the treated bacterial solution into 9 mL of protein pancreatic juice with different pH values, and incubate at 37℃. Take samples at 3 h and 6 h of treatment, take 0.9 mL each time, add 0.1 mL of PI dilution solution, stain at 37℃ for 10 min, and use flow cytometry to detect the bacterial mortality rate P2 (%), and calculate the survival rate (%) at different time periods. With the mortality rate of the untreated bacterial suspension as 100% control, calculate the survival rate of YYS-BSM8 after treatment;

[0124] The formula for calculating bacterial survival rate is:

[0125] Survival rate (%) = P2 / P2 对照 *100.

[0126] (2) The bacterial survival rate of strain YYS-BSM8 is shown in Table 7. According to the data, the following can be seen:

[0127] When YYS-BSM8 was treated in pancreatic juice at pH 7.5 for 1-6 hours, the survival rate was between 97.61% and 101.84%. When treated in pancreatic juice at pH 8.0 for 1-6 hours, the survival rate was between 97.17% and 101.62%, indicating that YYS-BSM8 was not affected by the pancreatic juice environment.

[0128] Table 7 Survival rate of YYS-BSM8 in artificial pancreatic juice environment (%)

[0129]

[0130] This invention also provides the following application examples of Bifidobacterium longum subspecies YYS-BSM8:

[0131] Example 12 Preparation of probiotic agent from Bifidobacterium longum subsp. YYS-BSM8

[0132] Bifidobacterium longum subsp. YYS-BSM8 was inoculated into a culture medium, such as MRS medium, and cultured at 0-38℃ for more than 15 hours. The bacterial cells were collected by centrifugation and resuspended in, for example, physiological saline or PBS buffer to prepare a liquid bacterial preparation containing Bifidobacterium longum subsp. YYS-BSM8.

[0133] Optionally, the bacterial cells of *Bifidobacterium longum* subsp. YYS-BSM8 are resuspended in a cell protectant and a carrier, and then freeze-dried to obtain a solid bacterial powder preparation containing *Bifidobacterium longum* subsp. YYS-BSM8.

[0134] Optionally, Bifidobacterium longum subsp. YYS-BSM8 can be used as a raw material component in the degradation or adsorption of benzo[a]pyrene, the adsorption of heavy metals lead and cadmium, and the treatment of intestinal diseases. Bifidobacterium longum subsp. YYS-BSM8 can exist in the product in the form of a liquid or solid preparation.

[0135] Example 13: Preparation of fermented food from Bifidobacterium longum subsp. YYS-BSM8

[0136] To prepare a yeast culture of Bifidobacterium longum subsp. longum YYS-BSM8, various fruits, Chinese herbal medicines, grains, and various sugars were used as auxiliary materials. The culture was inoculated with Bifidobacterium longum subsp. longum YYS-BSM8 and fermented for a certain period of time under certain temperature conditions (30-38℃) to prepare a fermented product. The fermented product was either inactivated or not inactivated. After being diluted in stock or in different proportions, common beverage auxiliary materials were added to prepare a fermented food.

[0137] Based on the results of the above embodiments, the Bifidobacterium longum subspecies YYS-BSM8 provided by the present invention has the following properties and effects:

[0138] YYS-BSM8 can grow independently using trehalose, stachyose, inulin, galactooligosaccharides, isomaltooligosaccharides, and fructooligosaccharides. It can produce high levels of short-chain fatty acids under conditions where various oligosaccharides are the sole carbon source. In this case, acetic acid production ranged from 5.6 to 13.3 mmol / L, and propionic acid, isobutyric acid, n-butyric acid, and isovaleric acid production ranged from 19.12 to 109.84 μmol / L. Stachyose is beneficial for increasing short-chain fatty acid production. It can remove benzo[a]pyrene, achieving a removal rate of 74.46% in physiological saline. It can adsorb heavy metal Pb with an adsorption rate of up to 94.94% and heavy metal Cd with an adsorption rate greater than 65%. It has good biofilm formation ability, with a membrane formation level 3.572-3.825 times that of the control. Inulin and isomaltooligosaccharides are beneficial for promoting biofilm formation. It exhibits good antibacterial activity against Staphylococcus aureus and Escherichia coli, with inhibition zone diameters of 18.33±0.58 mm and 17.00±3.46 mm, respectively. The 24-hour autoagglutination rate is 34.95%, and the agglutination rate against Staphylococcus aureus is 80.01%, demonstrating good characteristics of agglutinating pathogens. It can produce SOD enzyme with an activity of 50.59±0.03 U / mL. It shows good tolerance to simulated gastric juice, surviving for 1-5 hours in a gastric juice environment at pH 2.5 with a survival rate of 31.21%-80.04%, and surviving for at least 5 hours in a simulated gastric juice environment at pH 3.0 with a survival rate between 67.89%-90.23%. After 6 hours of treatment in pancreatic juice environments at pH 7.5 and 8.0, the survival rates were 101.81% and 101.62%, respectively. Bacterium YYS-BSM8 was isolated from the feces of healthy breastfed infants, exhibiting high safety and potential for use in functional products for detoxification, intestinal conditioning, and antibacterial purposes, demonstrating broad application prospects. In summary, compared to existing technologies, the *Bifidobacterium longum* subsp. *longum* YYS-BSM8 provided by this invention has the following beneficial effects:

[0139] This *Bifidobacterium longum* subspecies YYS-BSM8 can provide a new probiotic source for the development of functional products such as heavy metal detoxification, benzo[a]pyrene detoxification products, and intestinal conditioning products, and has significant application value. This bacterium provides a new probiotic source for the development of functional products, for example:

[0140] (1) Bifidobacterium longum subsp. YYS-BSM8 can be used as a raw material component of the composition to prepare a composition with the above-mentioned functions; wherein, the composition includes, but is not limited to, microbial preparations.

[0141] The bacterial strain exists in the composition in one or more forms, including but not limited to, non-inactivated *Bifidobacterium longum* subsp. *YYS-BSM8*, inactivated *Bifidobacterium longum* subsp. *YYS-BSM8*, metabolites of *Bifidobacterium longum* subsp. *YYS-BSM8* strain, and freeze-dried *Bifidobacterium longum* subsp. *YYS-BSM8* strain.

[0142] Preferably, in the composition, the number of *Bifidobacterium longum* subsp. YYS-BSM8 is ≥1×10⁻⁶. 6 CFU / mL or ≥1×10 6 CFU / g.

[0143] More preferably, the number of *Bifidobacterium longum* subsp. YYS-BSM8 is ≥1×10⁻⁶. 8 CFU / mL or ≥1×10 8 CFU / g.

[0144] (2) Various plants (such as fruits, Chinese herbal medicines, grains, etc.) can be used as raw materials, combined with various ingredients, and inoculated with Bifidobacterium longum subsp. YYS-BSM8 for fermentation treatment to prepare fermented products. These fermented products can be used to prepare products with hangover relief, antioxidant or weight loss functions.

[0145] The fermentation raw materials can be various commonly used plant fermentation raw materials, and the auxiliary materials can also be existing conventional auxiliary materials, including but not limited to the above-mentioned scheme selection.

[0146] In summary, based on its characteristics, *Bifidobacterium longum* subsp. *YYS-BSM8* and / or its ferments can be used in functional products that include at least one of the following functions:

[0147] (1) It can use a variety of oligosaccharides as the sole carbon source for growth and reproduction;

[0148] (2) It can produce high levels of acetic acid, propionic acid, isobutyric acid, n-butyric acid and isovaleric acid. Stachyose can be used to further promote the production of short-chain fatty acids.

[0149] (3) It has a good removal effect on benzo[a]pyrene;

[0150] (4) It has a good adsorption effect on heavy metals lead and cadmium;

[0151] (5) Good biofilm formation ability;

[0152] (6) It has a good inhibitory effect on Staphylococcus aureus and Escherichia coli;

[0153] (7) It has a good co-aggregation ability against Staphylococcus aureus;

[0154] (8) It can produce SOD enzyme.

[0155] Among them, products with the above-mentioned (1)-(8) functions include, but are not limited to, detox products, SOD products and antibacterial products, which have obvious effects such as adsorbing heavy metals lead and cadmium, clearing benzo[a]pyrene, regulating the intestines, relieving constipation, producing SOD, and antibacterial; or they can be products with other obvious effects based on the functions of (1)-(8).

[0156] It should be noted that:

[0157] (1) Definition:

[0158] The term "food" as used herein is used in a broad sense, encompassing human food and drink. In some embodiments, the food product is suitable for and designed for human consumption. This application can be used to prepare solid dosage forms such as powders and tablets, as well as to disperse in liquids to prepare liquid dosage forms and other dosage forms suitable for oral administration to humans, including but not limited to powders.

[0159] The composition containing Bifidobacterium longum subsp. YYS-BSM8 can be used in other forms of products.

[0160] The presence of Bifidobacterium longum subsp. YYS-BSM8 in the composition includes, but is not limited to, non-inactivated bacteria, inactivated bacteria, metabolites, freeze-dried strains, etc. It is anticipated that Bifidobacterium longum subsp. YYS-BSM8 may also exist in the composition in other forms.

[0161] (2) The relevant prior art means or prior art terms involved in this application:

[0162] "OD" is an abbreviation for optical density, also known as absorbance. The energy difference before and after light passes through an analyte is the energy absorbed by the analyte. At a specific wavelength, there is a quantitative relationship between the concentration of the same analyte and the absorbed energy, which can be used to determine the concentration of the analyte. x "OD" is the optical density value measured when the wavelength is set to X nm. It is a standard indicator for tracking the density of microorganisms in liquid cultures and is usually used to indicate the density of bacterial cells. The method for measuring the "OD" value is existing technology, and its principle and method will not be described here.

[0163] The determination of total bacterial count P1 and dead bacterial count P2 using flow cytometry is an existing technology, and its principles and methods will not be elaborated here.

[0164] The method of using an alcohol meter to test the alcohol content and temperature of the distillate, and then calculating the actual alcohol content of each treatment using an alcohol meter temperature-concentration conversion table, is an existing technology, and its principle and method will not be elaborated here.

[0165] The biochemical experiments of lactic acid bacteria were conducted according to the standard method of GB4789.35. This is the existing technology, and its principle and method will not be described here.

[0166] (3) The formulations of the culture media used in the examples are as follows:

[0167] MRS+L-cysteine ​​medium (g / L): Casein peptone 10, beef extract 10, yeast extract 5, glucose 5, L-cysteine ​​0.5, sodium acetate 5, K2HPO4 2, diammonium citrate 2, MgSO4·7H2O 0.2, MnSO4·H2O 0.05, Tween 80 1; pH 6.2. For solid medium, add 2% agar and 2% CaCO3 to the above, and sterilize at 121℃ for 15 min.

[0168] MRS medium: Casein peptone 10, beef extract 10, yeast extract 5, glucose 5, sodium acetate 5, K2HPO4 2, diammonium citrate 2, MgSO4·7H2O 0.2, MnSO4·H2O 0.05, Tween 80 1; pH 6.2. For solid medium, add 2% agar and 2% CaCO3 to the above and sterilize at 121℃ for 15 min.

[0169] Unless otherwise specified, the experimental procedures involved in the embodiments of the present invention are conventional experimental procedures in the art, and the reagents or instruments involved can be obtained from legitimate channels.

[0170] Furthermore, those skilled in the art should understand that although many problems exist in the prior art, each embodiment or technical solution of the present invention can be improved in only one or a few aspects, without necessarily solving all the technical problems listed in the prior art or the background art simultaneously. Those skilled in the art should understand that any content not mentioned in a claim should not be construed as a limitation on that claim.

[0171] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A subspecies of Bifidobacterium longum with heavy metal adsorption and benzo[a]pyrene degradation capabilities ( Bifidobacterium longum subsp Longum YYS-BSM8, characterized in that: Its accession number is CGMCC No.28611.

2. A composition, characterized in that: It contains the long subspecies of Bifidobacterium longum YYS-BSM8 as described in claim 1.

3. The composition according to claim 2, characterized in that: The composition includes a microbial preparation.

4. The composition according to claim 2, characterized in that: The composition contains one or more of the following: non-inactivated *Bifidobacterium longum* subsp. *YYS-BSM8* and freeze-dried *Bifidobacterium longum* subsp. *YYS-BSM8*.

5. Fermentation broth, characterized in that: It was obtained by fermentation of Bifidobacterium longum subspecies YYS-BSM8 as described in claim 1.

6. The application of the *Bifidobacterium longum* subsp. YYS-BSM8 as described in claim 1 or the fermentation broth as described in claim 5 in the preparation of any one of the following functional products, characterized in that: (1) Functional products used in the production of acetic acid, propionic acid, isobutyric acid, n-butyric acid and isovaleric acid; (2) Functional products for removing benzo[a]pyrene; (3) Functional products for adsorbing heavy metals lead and cadmium; (4) Functional products used to inhibit Staphylococcus aureus and Escherichia coli; (5) Functional products used to produce SOD; (6) Functional products for intestinal conditioning and bowel movement relief.

Images