A wheat plasma membrane H + Application of the ATPase TaHA1 gene in the regulation of wheat stripe rust
By silencing or overexpressing the wheat plasma membrane H+-ATPase TaHA1 gene, a recombinant vector was constructed and transformed into wheat immature embryos. This solved the problem of slow progress in wheat stripe rust control, achieved gene regulation, enhanced or weakened wheat resistance to stripe rust fungus, and increased or decreased susceptibility.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-06
- Publication Date
- 2026-04-14
AI Technical Summary
Current technologies for controlling wheat stripe rust are progressing slowly, few genes capable of regulating wheat susceptibility have been discovered, and chemical control poses environmental safety risks. Therefore, it is necessary to develop disease-resistant gene breeding to improve wheat resistance.
By silencing or overexpressing the wheat plasma membrane H+-ATPase TaHA1 gene, and constructing recombinant vectors using RNAi-TaHA1 silencing fragments or OE-TaHA1 fragments, wheat immature embryos can be transformed to enhance or weaken wheat's resistance to stripe rust, thereby achieving gene regulation.
Silencing the TaHA1 gene enhances wheat resistance to stripe rust, while overexpressing the TaHA1 gene weakens wheat resistance to stripe rust and significantly increases or decreases wheat susceptibility to stripe rust.
Smart Images

Figure CN117737098B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of genetic engineering and agricultural biotechnology, specifically relating to a wheat plasma membrane H + Application of the ATPaseTaHA1 gene in the regulation of wheat stripe rust. Background Technology
[0002] Wheat (Triticum aestivum L.) is a widely cultivated cereal crop worldwide. Stripe rust, caused by the wheat-specific strain of Triticum aestivum, is a significant fungal disease affecting wheat production. Its rapid spread and wide-ranging impact make its control an urgent priority.
[0003] While chemical agents can effectively control economic losses caused by wheat diseases, for environmental safety and human health reasons, breeding and promoting disease-resistant varieties remains the most fundamental, economical, and safest approach. The cloning and functional study of disease-resistant genes is of great significance for understanding the molecular mechanisms of wheat disease resistance and for conducting molecular disease-resistant breeding.
[0004] Currently, genetic research on wheat-striped rust interactions is progressing slowly, and few genes that can regulate wheat susceptibility have been discovered. Summary of the Invention
[0005] To address the shortcomings of existing technologies, the present invention aims to provide a wheat plasma membrane H + - The application of the ATPase TaHA1 gene in the regulation of wheat stripe rust: Silencing the TaHA1 gene can enhance the resistance of wheat plants to stripe rust fungus and reduce the susceptibility of wheat to the disease; overexpression of the TaHA1 gene will weaken the resistance of wheat to stripe rust fungus.
[0006] The objective of this invention is achieved through the following technical solution:
[0007] This invention provides a wheat plasma membrane H + Application of the ATPase TaHA1 gene in the regulation of wheat stripe rust, wherein the nucleotide sequence of the TaHA1 gene is shown in SEQ ID NO.1.
[0008] This invention provides the application of silencing TaHA1 gene expression in improving wheat stripe rust resistance and / or reducing stripe rust susceptibility, wherein the nucleotide sequence of the TaHA1 gene is shown in SEQ ID NO.1.
[0009] This invention provides the application of overexpressing the TaHA1 gene in reducing wheat resistance to stripe rust and / or enhancing wheat susceptibility to stripe rust, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0010] This invention provides a recombinant vector for silencing TaHA1 gene expression, the recombinant vector comprising an RNAi-TaHA1 silencing fragment, the nucleotide sequence of which is shown in SEQ ID NO.4.
[0011] This invention provides a method for constructing a recombinant vector for silencing TaHA1 gene expression as described in the above technical solution, comprising the following steps:
[0012] The RNAi silencing fragment that silences TaHA1 gene expression was constructed into an intermediate vector using a BP reaction to obtain a recombinant entry vector;
[0013] The RNAi silencing fragment in the recombinant introductory vector was constructed into the final vector using the LR reaction to obtain the recombinant vector.
[0014] Preferably, the intermediate carrier includes pDONR 221; the final carrier includes PC336.
[0015] The present invention provides a recombinant vector for overexpressing the TaHA1 gene, the recombinant vector comprising an OE-TaHA1 fragment, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0016] This invention provides a method for constructing a recombinant vector overexpressing the TaHA1 gene as described in the above technical solution, comprising the following steps:
[0017] The OE-TaHA1 fragment overexpressing the TaHA1 gene was constructed into an intermediate vector using a BP reaction to obtain the recombinant entry vector.
[0018] The OE-TaHA1 fragment in the recombinant initiation vector was constructed into the final vector using the LR reaction to obtain the recombinant vector.
[0019] Preferably, the intermediate carrier includes pDONR 221; the final carrier includes pANIC6E.
[0020] This invention provides a method for obtaining stripe rust-resistant wheat, comprising the following steps:
[0021] The recombinant strain containing the recombinant vector described in the above technical solution was transferred into wheat embryos by genetic transformation to obtain TaHA1 transgenic wheat.
[0022] This invention provides a wheat plasma membrane H +The application of the ATPase TaHA1 gene in the regulation of wheat stripe rust, the nucleotide sequence of which is shown in SEQ ID NO.1. The TaHA1 gene provided by this invention was prepared by homologous cloning. The full-length TaHA1 gene is 2856 bp. Subcellular localization in tobacco showed that it is specifically located on the cell membrane. Functional verification showed that silencing the TaHA1 gene enhanced the resistance of wheat plants to stripe rust infection, overexpression of the TaHA1 gene promoted wheat susceptibility to stripe rust, and reduced wheat plant resistance to the stripe rust fungus. The TaHA1 gene plays a susceptibility role in the interaction between wheat and stripe rust. In the embodiments of this invention, the second true leaf of RNAi-TaHA1 positive plants and WT plants was inoculated with stripe rust fungus CYR31 (affinity). 14 days after inoculation, the number of urediniospores on the leaves of RNAi-TaHA1 wheat was significantly less than that of wild-type plants, indicating that silencing the TaHA1 gene reduced wheat susceptibility. Silencing the TaHA1 gene in wheat plants enhances their resistance to stripe rust. Furthermore, in this invention, TaHA1 overexpressing transgenic plants were also created. When the second true leaf of OE-TaHA1 positive plants and WT plants was inoculated with the stripe rust fungus CYR23 (incompatible), 14 days after inoculation, a small number of spores were produced on the leaves of OE-TaHA1 plants, while WT plants only showed obvious necrotic spots and no obvious sporulation. Compared with wild-type WT, the T1 generation OE-TaHA1 lines OE4, OE5, and OE7 showed significantly upregulated stripe rust biomass expression. These results indicate that overexpression of the TaHA1 gene provided by this invention significantly weakens the resistance of wheat plants to stripe rust infection and increases wheat susceptibility to stripe rust. Therefore, the TaHA1 gene provided by this invention has the function of promoting wheat susceptibility to stripe rust. Attached Figure Description
[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0024] Figure 1 Image showing the subcellular localization results of TaHA1 in tobacco;
[0025] Figure 2 Figure showing the alignment results of the three copies of the TaHA1 gene with the TaHA1-1as sequence;
[0026] Figure 3Figure 1 shows the growth and sporulation of TaHA1 gene-silenced wheat plants and non-silenced wheat plants after inoculation with CYR31 stripe rust fungus. Figure 2 shows the results of PCR verification of RNAi-TaHA1 positive plants; Figure 3 shows the bar chart of the silencing efficiency of RNAi-TaHA1 positive plants; Figure 4 shows the sporulation of wheat leaves 14 days after inoculation with CYR31 stripe rust fungus following TaHA1 gene silencing using RNAi transgenic technology, compared to the sporulation of non-silenced wheat plants inoculated with CYR31 stripe rust fungus; Figure 5 shows the sporulation of leaves at 3 cm depth. 2 Bar graph of spore counts 14 days after inoculation of wheat leaves with stripe rust fungus in wild-type (WT) and RNAi-TaHA1 strains.
[0027] Figure 4 Figure 1 shows the growth of stripe rust fungus in wheat plants overexpressing the TaHA1 gene and WT wheat plants after inoculation with CYR23. Figure 2 shows the results of PCR verification of OE-TaHA1 positive plants; Figure 3 shows the bar chart of OE-TaHA1 positive plant expression level; Figure 4 shows the phenotypic observation of wheat plants overexpressing the TaHA1 gene and WT wheat plants after inoculation with CYR23; Figure 5 shows the biomass of stripe rust fungus in wheat plants overexpressing the TaHA1 gene and WT wheat plants after inoculation with CYR23. Detailed Implementation
[0028] This invention provides a wheat plasma membrane H + The application of the ATPase TaHA1 gene in the regulation of wheat stripe rust, wherein the nucleotide sequence of the TaHA1 gene is shown in SEQ ID NO.1, as follows:
[0029] 5'-ATGGGCGGGCTCGAGGAGATCAGGAACGAGGCCGTCGATCTGGAG AACATCCCCATCGAGGAGGTGTTCGAGCAGCTGAAATGCACACGCCAGGGGCTCACCTCCGATGAGGGGGCGCAGCGTGTTGAAATCTTCGGCCTCAACAAGCTCGAAGAGAAGAAGGAGAGCAAAGTCCTCAAGTCCTGGGATTCATGTGGAACCCACTCTCCTGGGTCATGGAGATGGCCGCCATCATGGCCATCGCGCTGGCCAACGGTGGTGGGAAGCCCCCGGATTGGCAGGATTTCGTTGGAAT
[0030] CATTGTTCTCCTGGTCATCAACTCCACCATTCTCCTTCATTGAAGAGAACAA
[0031] CGCCGGCAACGCAGCTGCTGCGCTCATGGCCAACCTTGCGCCCAAGACAA
[0032] AGGTGCTTAGGGATGGTCGATGGGGCGAGCAGGAGGCATCAATCTTGGTT
[0033] CCTGGTGACATTGTCAGCATCAAGCTCGGTGACATCGTCCCTGCTGATGCT
[0034] CGTCTCCTCGAGGGTGATCCTTTGAAGATTGATCAGTCTGGACTTACAGGA
[0035] GAGTCTCTCCCGGTGACCAAGAACCCTGGGGATGAGGTCTTTTCTGGATC
[0036] AACATGCAAGCAGGGTGAGATTGAGGCTGTGGTCATTGCCACTGGAGTAC
[0037] ACACTTTCTTTGGCAAGGCTGCTCATCTTGTTGACAGCACCAACCAAGTCG
[0038] GGCACTTCCAGCAGGTCCTCACTGCCATCGGAAACTTCTGCATCGTCTCGA
[0039] TTGCAGTGGGAATTGTCATTGAGATCATCGTCATGTTCCCGATCCAGCGCC
[0040] GCAAGTACCGTGCCGGTATTGAGAACCTGTTGGTCCTCTTGATCGGTGGTA
[0041] TTCCGATTGCCATGCCTACAGTTTTGTCGGTCACCATGGCTATTGGTTCCCA
[0042] CAAGTTGTCCCAGCAGGGTGCTATCACCAAGAGGATGACTGCCATTGAAG
[0043] AGTTGGCTGGCATGGATGTGCTTTGCAGTGATAAGACTGGCACACTCACCC
[0044] TTAACAAGCTCAGTGTTGACAAGAACCTGGTTGAGGTGTTTGCGAAAGGT
[0045] GTCGACAAAGAACATGTGCTGTTGTTGGCTGCAAGGGCTTCAAGGGTTGA
[0046] AAACCAGGATGCAATTGATGCTTGCATGGTTGGTATGCTTGCTGATCCTAA
[0047] GGAGGCAAGAGCTGGCATCAGGGAAGTGCACTTCTTGCCATTCAACCCTA
[0048] CTGACAAGAGGACTGCTCTGACTTACATCGATGCTGAGGGTAACTGGCAC
[0049] CGTGCCAGCAAGGGTGCTCCTGAGCAGATTATTACCCTCTGCAACTGCAAG
[0050] GAGGATGTGAAGAGAAAGGTGCACTCTGTGATTGAGAAGTATGCTGAGCG
[0051] TGGGCTTCGTTCGCTTGCTGTTGCGAGACAGGAAGTACCCGAGAAATCCA
[0052] AGGATTCTCCTGGTGGACCATGGCAATTCATTGGTCTGTTGCCCCTGTTTG
[0053] ACCCCCCAAGGCATGACAGTGCTGAGACCATCCGCAAGGCACTTGTTCTT
[0054] GGTGTCAACGTCAAGATGATCACAGGTGACCAACTTGCTATTGGAAAGGA
[0055] GACTGGTAGGAGGCTTGGGATGGGCACAAACATGTATCCTTCTTCTGCATT
[0056] GCTTGGCCAAAGCAAGGACGGTTCACTTGAGTCACTTCCTGTTGATGAGC
[0057] TGATTGAGAAGGCTGATGGATTTGCCGGAGTCTTCCCTGAGCACAAGTATG
[0058] AGATTGTGAAGAGGCTGCAAGAGAAAAGCACATTGTTGGTATGACTGGC
[0059] GATGGTGTCAATGATGCTCCTGCTCTTAAGAAGGCCGACATTGGTATTGCT
[0060] GTCGATGATGCTACAGATGCTGCTCGAAGTGCTTCAGACATTGTGCTTACC
[0061] GAGCCAGGTCTCAGTGTCATTATCAGTGCTGTCCTGACCAGCAGGTGCATT
[0062] TTTCAGAGGATGAAGAACTACACGATCTATGCAGTTTCCATCACCATCCGTA
[0063] TTGTGCTTGGCTTTATGCTTATTGCCCTGATCTGGAAATTTGATTTCGCTCCC
[0064] TTCATGGTCCTTATCATTGCCCATTCTCAATGATGTACTATCATGACAATATC
[0065] CAAGGACAGAGTTAAGCCATCTCCCTTGCCCGACAGCTGGAAGCTCAATG
[0066] AAATCTTCGCCACTGGTGTTGTGCTGGGAACCTACCTTGCTCTGGTGACTG
[0067] TCGTCTTCTTCTGGCTCATCCACAAGACAGACTTCTTCACAACAAATTCG
[0068] GTGTCGAGTCAATCAGGAACACCGATTTAAGGAGATGTCTGCACTGTACC
[0069] TCCAAGTCAGTATTGTGAGCCAGGCTCTTATCTTTGTGACTCGTTCCCGTAG
[0070] CTGGTCCTTTGTTGAGCGCCCAGGTTTCCTCTTGGTTACCGCCTTCCTCCTC
[0071] GCACAATTGGTTGCAACACTCATCGCTGTCTATGCCAACTGGGACTTCGCA
[0072] AGGATCAAGGGAATCGGGTGGGGCTGGGCTGGTGTTATCTGGCTGTTCAG
[0073] CATTGTGTTCTACTTCCCACTCGACATTTTCAAGTTCTTCATCCGATTTGTG
[0074] CTGAGTGGAAGGGCCTGGGACAACCTCCTGCAGAACAAGACTGCTTTCAC
[0075] CACCAAAGAGAACTACGGCAAAGGGGAGAGGGAAGCACAATGGGCTACC
[0076] GCACAGAGAACACTCCATGGCCTTCAAGCACCGGAGCCGGCCTCCCACAC
[0077] ACTGTTCAACGACAAGAGCAGCTACCGTGAGCTCTCTGAGATCGCTGAGC
[0078] AAGCAAAGAGAAGAGCTGAGATTGCAAGGTTGAGGGAGCTCAACACACT
[0079] CAAGGCCACGTTGAATCCGTGGTGAAGCTCAAGGCCTTGACATCGACACCATCAACCAGAACTACACCGTGTGA-3'.
[0080] In this invention, the full-length TaHA1 gene is 2856 bp. This invention performs spatial specificity analysis on the TaHA1 gene, revealing that the protein expressed by the TaHA1 gene is specifically located on the cell membrane. This invention employs a tobacco subcellular localization method to analyze the spatial expression characteristics of the wheat TaHA1 gene.
[0081] In this invention, the primer pair for amplifying the TaHA1 gene includes an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is preferably as shown in SEQ ID NO.2, specifically: 5'-ATGGGCGGGCTCGAGGAG-3'; the nucleotide sequence of the downstream primer is preferably as shown in SEQ ID NO.3, specifically: 5'-TCACACGGTGTAGTTCTG-3'.
[0082] This invention provides the application of silencing the TaHA1 gene expression described in the above-mentioned technical solutions in improving wheat stripe rust resistance and / or reducing wheat susceptibility to stripe rust.
[0083] In this invention, silencing the TaHA1 gene significantly enhances wheat's resistance to stripe rust fungi. Furthermore, silencing the TaHA1 gene significantly reduces wheat's susceptibility to stripe rust fungi. Preferably, the stripe rust fungi include one or both of CYR31 and CYR23. This invention, by silencing the TaHA1 gene in wheat, significantly reduces the infectivity of wheat by stripe rust fungi and enhances wheat's resistance to stripe rust fungi.
[0084] This invention provides the application of overexpressing the TaHA1 gene described in the above technical solution in weakening wheat resistance to stripe rust and / or enhancing wheat susceptibility to stripe rust.
[0085] In this invention, overexpression of the TaHA1 gene can significantly enhance wheat’s susceptibility to stripe rust and reduce wheat’s resistance to stripe rust.
[0086] The results of this invention, through examples, show that: when RNAi-TaHA1 positive plants and WT plants were inoculated with stripe rust fungus CYR31 on the second true leaf, 14 days after inoculation, the number of urediniospores on the leaves of RNAi-TaHA1 wheat plants was significantly less than that of wild-type plants, indicating that silencing the TaHA1 gene reduced wheat susceptibility and enhanced resistance to stripe rust fungus. When OE-TaHA1 positive plants and WT plants were inoculated with stripe rust fungus CYR23 on the second true leaf, 14 days after inoculation, obvious sporulation occurred on the leaves of OE-TaHA1 wheat plants, and compared with wild-type WT plants, the biomass of stripe rust fungus was significantly upregulated in OE-TaHA1 plants, indicating that overexpression of the TaHA1 gene significantly reduced wheat plant resistance to stripe rust infection and increased wheat susceptibility to stripe rust fungus.
[0087] This invention provides a recombinant vector for silencing TaHA1 gene expression, the recombinant vector comprising an RNAi-TaHA1 silencing fragment, the nucleotide sequence of which is shown in SEQ ID NO.4, as detailed below:
[0088] 5'-CCCGATCCAGCGCCGCAAGTACCGTGCCGGTATTGAGAACCTGTTG GTCCTCTTGATCGGTGGTATTCCGATTGCCATGCCTACAGTTTTGTCGGTCACCATGGCTATTGGTTCCCACAAGTTGTCCCAGCAGGGTGCTATCACCAAGAGGATGACTGCCATTGAAGAGTTGGCTGGCATGGATGTGCTTTGCAGTGATAAGACTGGCACACTCACCCTTAACAAGCTCAGTGTTGACAAGAACCTGGTTGAGGTGTTTGCGAAAGGTGTC-3'.
[0089] In this invention, the RNAi-TaHA1 silencing fragment preferably comprises a conserved region sequence of the wheat TaHA1 gene. This invention uses BLASTN analysis of the TaHA1 gene in the NCBI database to determine the conserved sequence. Further, this invention selects a conserved segment from the conserved regions of three copies of TaHA1-2A, TaHA1-2B, and TaHA1-2D. Preferably, this invention selects a 271 bp segment from the conserved regions of the three copies of TaHA1-2A, TaHA1-2B, and TaHA1-2D as the RNAi-TaHA1 silencing fragment. In this invention, the RNAi-TaHA1 silencing fragment is also referred to as the TaHA1-1as sequence.
[0090] The present invention provides a recombinant vector for overexpressing the TaHA1 gene, the recombinant vector comprising an OE-TaHA1 fragment, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0091] The present invention does not have any particular limitation on the recombinant vector; any vector capable of silencing the TaHA1 gene is acceptable.
[0092] In this invention, the primer pair for amplifying the RNAi-TaHA1 silencing fragment in the recombinant vector preferably includes primer F and primer R. In this invention, the nucleotide sequence of primer F is shown in SEQ ID NO.5, specifically:
[0093] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCCGATCCAGCGCCGCAAG TACCG-3'; The nucleotide sequence of primer R is shown in SEQ ID NO.6, specifically: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTGACACCTTTCGCAAACACC TCAAC-3'.
[0094] The present invention provides a recombinant vector for overexpressing the TaHA1 gene, the recombinant vector comprising an OE-TaHA1 fragment, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0095] The present invention does not have any particular limitation on the recombinant vector; any vector capable of achieving TaHA1 gene overexpression is acceptable.
[0096] In this invention, the primer pair for amplifying the OE-TaHA1 fragment in the recombinant vector preferably includes primer F and primer R. In this invention, the nucleotide sequence of primer F is shown in SEQ ID NO.7, specifically:
[0097] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTCTATGGGCGGGCTCGAGGA G-3'; The nucleotide sequence of primer R is shown in SEQ ID NO.8, specifically: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTCACACGGTGTAGTTCTG G-3'.
[0098] In this invention, the recombinant vector is preferably constructed using the gateway principle.
[0099] This invention provides a method for constructing the recombinant vector described in the above technical solution, comprising the following steps:
[0100] The RNAi-TaHA1 silencing fragment that silences TaHA1 gene expression or the OE-TaHA1 fragment that overexpresses TaHA1 gene expression were constructed into intermediate vectors using the BP reaction to obtain recombinant entry vectors.
[0101] The RNAi-TaHA1 silencing fragment or the OE-TaHA1 fragment in the recombinant initiation vector was used to construct the final vector using the LR reaction to obtain the recombinant vector.
[0102] In this invention, the RNAi-TaHA1 silencing fragment that silences TaHA1 gene expression or the OE-TaHA1 fragment that overexpresses TaHA1 gene is constructed into intermediate vectors using the BP reaction to obtain recombinant entry vectors.
[0103] This invention constructs an RNAi-TaHA1 silencing fragment, representing the expression of the TaHA1 gene, into an intermediate vector using a BP reaction, thus obtaining an RNAi-TaHA1 fragment recombination entry vector. This invention also constructs an OE-TaHA1 fragment, representing the overexpression of the TaHA1 gene, into an intermediate vector using a BP reaction, thus obtaining an OE-TaHA1 fragment recombination entry vector.
[0104] In this invention, the intermediate vector preferably includes pDONR 221. After determining the intermediate vector, this invention preferably designs specific primers based on the attB1 and attB2 sites corresponding to the intermediate vector. In this invention, the specific primers preferably include forward primers and reverse primers. The nucleotide sequence of the forward primer used to amplify the RNAi-TaHA1 fragment in this invention is preferably shown in SEQ ID NO.5, and the nucleotide sequence of the reverse primer used is shown in SEQ ID NO.6. The nucleotide sequence of the forward primer used to amplify the OE-TaHA1 fragment in this invention is preferably shown in SEQ ID NO.7, and the nucleotide sequence of the reverse primer used is shown in SEQ ID NO.8. This invention preferably uses wheat cDNA as a template and performs PCR amplification using the above-mentioned forward and reverse primers to obtain RNAi-TaHA1 fragments and OE-TaHA1 fragments containing the attB site, respectively. In this invention, the RNAi-TaHA1 fragments and OE-TaHA1 fragments containing the attB site are collectively referred to as attB-PCR products. After obtaining RNAi-TaHA1 and OE-TaHA1 fragments containing the attB site, the present invention preferably performs a BP reaction. In this invention, the BP reaction system preferably comprises 20–60 ng / μL of attB-PCR product containing the attB site, 2210.5 μL of pDONR, and BP Clonase. TMII 0.5 μL, TE buffer to 5 μL. In this invention, the temperature of the BP reaction is preferably 25℃; the time of the BP reaction is preferably 16-24 h, more preferably 16 h. After the BP reaction is completed, this invention preferably transforms the BP reaction product into DH5α strain. This invention does not have a specific limitation on the transformation method, and any conventional transformation method in the art can be used. After transformation, this invention preferably culturees the transformed DH5α strain. In this invention, the culture temperature is preferably 37℃, and the culture time is preferably 24-36 h. After culture, this invention preferably picks single colonies of the transformed DH5α strain for colony PCR to identify positive colonies. In this invention, the nucleotide sequence of the forward primer used for colony PCR verification is shown in SEQ ID NO.9, specifically: 5'-TGTAAAACGACGGCCAGT-3', and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.10, specifically: 5'-CAGGAAACAGCTATGACC-3'. In this invention, the colony PCR system is preferably 15 μL, and the preferred composition includes: 7.5 μL Premix ExTaq, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, and 6.5 μL ddH2O. Preferably, the positive colonies obtained from colony PCR are further extracted with plasmids and sequenced to determine the recombinant entry vector. In this invention, the recombinant entry vector preferably includes pDONR 221-TaHA1-RNAi and pDONR 221-TaHA1-OE. In this invention, pDONR 221-TaHA1-RNAi and pDONR 221-TaHA1-OE are collectively referred to as recombinant entry vectors.
[0105] After obtaining the recombinant initiation vector, the present invention uses the RNAi-TaHA1 silencing fragment or the OE-TaHA1 fragment in the recombinant initiation vector to construct the final vector using the LR reaction, respectively, to obtain the recombinant vector.
[0106] In this invention, the final vector for the RNAi-TaHA1 silencing fragment that silences TaHA1 gene expression preferably includes PC336; the final vector for the OE-TaHA1 fragment that overexpresses the TaHA1 gene preferably includes pANIC6E. In this invention, PC336 and pANIC6E are collectively referred to as the final vector.
[0107] After obtaining the recombinant entry vector, the present invention preferably digests the recombinant entry vector with an enzyme to obtain the digested recombinant entry vector, and then performs the LR reaction. In the present invention, the enzyme digestion is preferably performed using the restriction endonuclease Nru I. The enzyme digestion temperature is preferably 37°C, and the enzyme digestion time is preferably 3-4 hours.
[0108] In this invention, the LR reaction system preferably comprises 1–3 μL of recombinant initiation vector, 0.5 μL of final vector, and LRClonase. TM II. Add 1 μL of TE Buffer, pH 8.0, to a final volume of 5 μL. In this invention, the preferred temperature for the LR reaction is 25°C; the preferred reaction time is 16–24 h, more preferably 16 h. After the LR reaction is complete, the product is preferably transformed into the DH5α strain. This invention does not specifically limit the transformation method; any conventional transformation method in the art can be used. After transformation, the transformed DH5α strain is preferably cultured. In this invention, the culture conditions are preferably 37°C for 24–36 h. After culture, single colonies of the transformed DH5α strain are preferably picked for colony PCR to identify positive colonies.
[0109] In this invention, the forward primer nucleotide sequence used for colony PCR verification of DH5α strains containing the RNAi-TaHA1 fragment vector is shown in SEQ ID NO.11, specifically: 5'-TCAGCGCCGTCGTCGGTGAA-3', and the reverse primer nucleotide sequence is shown in SEQ ID NO.12, specifically: 5'-CCAAATGTTTGAACGATCGG-3'. In this invention, the forward primer nucleotide sequence used for colony PCR verification of DH5α strains containing the OE-TaHA1 fragment vector is shown in SEQ ID NO.13, specifically: 5'-GGGGACAAGTTTGTACAA-3', and the reverse primer nucleotide sequence is shown in SEQ ID NO.14, specifically: 5'-GGGGACCACTTTGTACAA-3'. In this invention, the colony PCR system is preferably 15 μL, and the preferred composition includes: 7.5 μL Premix ExTaq, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, and 6.5 μL ddH2O. Preferably, the positive colonies obtained from colony PCR are further extracted with plasmids and sequenced to determine the recombinant vector. In this invention, the recombinant vector preferably includes a recombinant vector that silences TaHA1 gene expression and a recombinant vector that overexpresses TaHA1 gene expression. In this invention, the recombinant vector that silences TaHA1 gene expression preferably includes the RNAi-TaHA1-PC336 vector; the recombinant vector that overexpresses TaHA1 gene expression preferably includes the OE-TaHA1-pANIC6E vector.
[0110] This invention provides a recombinant bacterial strain containing the recombinant vector described in the above-described technical solution. The present invention transforms bacteria with the recombinant vector that silences TaHA1 gene expression as described in the above-described technical solution to obtain a recombinant bacterial strain that silences TaHA1 gene expression. The present invention also transforms bacteria with the recombinant vector that overexpresses TaHA1 gene expression as described in the above-described technical solution to obtain a recombinant bacterial strain that overexpresses the TaHA1 gene. In this invention, the bacteria preferably include *Escherichia coli*, more preferably a *Escherichia coli* clone strain DH5α. The present invention does not specifically limit the transformation method; any conventional transformation method in the art can be used.
[0111] This invention provides a method for obtaining stripe rust-resistant wheat, comprising the following steps:
[0112] The recombinant strain that silences the TaHA1 gene expression described in the above technical solution is transferred into wheat embryos using genetic transformation to obtain wheat resistant to stripe rust.
[0113] This invention does not impose any particular limitation on the method of genetic transformation; any conventional genetic transformation method in the field may be used.
[0114] This invention obtains wheat embryos containing the recombinant strain by transferring the recombinant strain described in the above-mentioned technical solution into wheat embryos. By culturing wheat embryos containing the recombinant strain, this invention can obtain wheat plants with silenced TaHA1 expression, and the traits of these plants can be stably inherited. In this invention, the wheat plants with silenced TaHA1 expression exhibit reduced susceptibility to stripe rust. In this invention, the wheat plants with silenced TaHA1 expression exhibit enhanced resistance to stripe rust fungi. In this invention, the wheat stripe rust fungi preferably include stripe rust fungi CYR31 and / or stripe rust fungi CYR23.
[0115] This invention provides a method for obtaining wheat susceptible to stripe rust, comprising the following steps:
[0116] The recombinant strain overexpressing the TaHA1 gene described in the above technical solution was transferred into wheat embryos using genetic transformation to obtain wheat susceptible to stripe rust.
[0117] This invention does not impose any particular limitation on the method of genetic transformation; any conventional genetic transformation method in the field may be used.
[0118] This invention obtains wheat embryos containing the recombinant strain by transferring the recombinant strain described in the above-mentioned technical solution into wheat embryos. By culturing wheat embryos containing the recombinant strain, this invention can obtain wheat plants overexpressing TaHA1, and the traits of these overexpressing TaHA1 wheat plants can be stably inherited. In this invention, the wheat plants overexpressing the TaHA1 gene exhibit enhanced susceptibility to stripe rust and reduced resistance to stripe rust fungi. In this invention, the wheat stripe rust fungi preferably include stripe rust fungi CYR31 and / or stripe rust fungi CYR23.
[0119] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0120] In this invention, the stripe rust fungus CYR31 and CYR23 are strains preserved by the Plant Immunology Team of the National Key Laboratory of Crop Stress Resistance and High-Efficiency Production at Northwest A&F University, and have been reported in published literature.
[0121] Example 1
[0122] The wheat variety used in the experiment was Shuiyuan 11.
[0123] Take 0.5g of fresh wheat leaves, extract total RNA from wheat cells using the RNA miniprep kit from Nanjing Novizan, and then synthesize cDNA using the cDNA reverse transcription kit from Novizan.
[0124] Primer pairs for amplifying the wheat TaHA1 gene were designed using Primer 5.0 software and manually optimized. The primers consist of a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.2, specifically 5'-ATGGGCGGGCTCGAGGAG-3'. The nucleotide sequence of the reverse primer is shown in SEQ ID NO.3, 5'-TCACACGGTGTAGTTCTG-3'.
[0125] Using the primer pairs described above, PCR amplification was performed using the synthesized cDNA as a template. The PCR amplification system was a 20 μL system, including 10 μL of Premix ExTaq, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, 2 μL of wheat cDNA template, and 7 μL of ddH2O. The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s; 56℃ annealing for 30 s; and 72℃ extension for 1 min. Denaturation, annealing, and extension together constituted one cycle, and a total of 37 cycles were performed.
[0126] After PCR amplification, the target fragment was purified using a DNA purification kit to obtain the purified target fragment.
[0127] The purified target fragment was ligated with the pMDTM 19-T vector at 16°C for 12 hours to obtain the ligation product. The obtained ligation product was transformed into Escherichia coli DH5α competent cells to obtain transformed Escherichia coli DH5α. The transformed Escherichia coli DH5α was inoculated onto LB plates coated with ampicillin for screening culture to obtain positive clones.
[0128] After obtaining positive clones, colony PCR was used to verify them. The nucleotide sequence of the forward primer used for colony PCR verification is shown in SEQ ID NO.9, specifically: 5'-TGTAAAACGACGGCCAGT-3', and the nucleotide sequence of the reverse primer used for colony PCR verification is shown in SEQ ID NO.10, specifically: 5'-CAGGAAACAGCTATGACC-3'. The colony PCR system was 15 μL, and the specific composition was: 7.5 μL Premix ExTaq, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, and 6.5 μL ddH2O. The colony PCR reaction products were detected by electrophoresis.
[0129] Select single colonies that test positive by electrophoresis and place them on LB medium (containing 100 μg / mL). -1 The plasmid was incubated overnight at 37°C on a shaker. The next day, the plasmid was extracted according to the instructions of the Megan plasmid miniprep kit. After extraction, 8 μL of plasmid and colony PCR detection primers were placed in 200 μL centrifuge tubes and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with SEQ ID NO.1 using DNAMAN8 software. The successfully aligned TaHA1-T-Vector was a successfully constructed recombinant plasmid and could be used as a template for subsequent TaHA1 gene vector construction and amplification.
[0130] Example 2
[0131] An ORF linking the TaHA1 gene described in Example 1 was constructed into the pCAMBIA1302 plant overexpression vector.
[0132] Primers for the ORF sequence of the TaHA1 gene with the stop codon removed were designed using Primer Premier 5.0, as shown in SEQ ID NO.2 and SEQ ID NO.3. The target gene was amplified using TaHA1-T-Vector as a template.
[0133] The pCAMBIA1302 vector was digested with NcoI restriction endonuclease. The specific digestion system was as follows: NcoI 1 μL, 10×Tango buffer 2 μL, pCAMBIA1302 vector 2 μg, and sterile double-distilled water to a final volume of 20 μL. The digestion products were recovered and their concentrations were determined. The target gene fragment was ligated to the digested vector using a one-step cloning enzyme from Nanjing Novizan. The one-step ligation system was as follows: 5×CE II buffer 2 μL, pCAMBIA1302 digest 150 ng, TaHA1-1302 fragment 150 ng, Exnase II. 1 μL of ddH2O was added to bring the volume to 10 μL. After ligation at 37℃ for 30 min, the ligation product was transformed into *E. coli* DH5α strain for colony PCR. Positive clones were subjected to shaking culture and plasmid extraction, and sent to Xi'an Qingke Biotechnology Co., Ltd. for sequencing and sequence alignment. The recombinant vector TaHA1-pCAMBIA1302 was successfully constructed. The successfully constructed TaHA1-pCAMBIA1302 plasmid was transformed into *Agrobacterium* competent cells GV3101 using liquid nitrogen flash freezing for colony PCR verification, following the same method as in Example 1. Positive *Agrobacterium* single colonies were picked and shaken. The bacterial solution was injected into tobacco leaves for 48 h and observed under a fluorescence microscope. The observation results are as follows: Figure 1 As shown. Simultaneously, the empty pCAMBIA1302 plasmid was transformed into Agrobacterium competent cells GV3101. Single colonies of Agrobacterium that tested positive were picked and shaken. The bacterial solution was injected into tobacco leaves and observed under a fluorescence microscope after 48 hours, serving as a control group.
[0134] The TaHA1 gene was constructed into the pCAMBIA1302 plant overexpression vector, which carries a GFP tag. The recombinant plasmid TaHA1-1302 and the empty plasmid 1302 (control) were transformed into Agrobacterium and then injected into Nicotiana benthamiana. The localization of the plasmid within the Nicotiana benthamiana was observed. Figure 1 It was found that the control group 1302 vector (Free-GFP) was highly expressed in the nucleus, cytoplasm, and membrane of tobacco cells, while the fluorescence specificity of the fusion protein TaHA1-GFP was only expressed on the cell membrane; the above results indicate that TaHA1 functions on the cell membrane.
[0135] Example 3
[0136] 1. Using a T-Vector containing the TaHA1 gene cloned in Example 1, the conservation of TaHA1 was analyzed using BLASTN from the NCBI database. The TaHA1 gene sequences with sequence numbers TraesCS2A02G502400, TraesCS2D02G503000, and TraesCS2B02G530500 were selected as TaHA1-2A, TaHA1-2B, and TaHA1-2D, respectively. A 271 bp segment was selected from the conserved region of each of the three copies of TaHA1-2A, TaHA1-2B, and TaHA1-2D as the RNAi silencing fragment, i.e., the TaHA1-1as sequence. Its nucleotide sequence is shown in SEQ ID NO. 4. The sequence alignment results are as follows: Figure 2 As shown.
[0137] Primers were designed for PCR amplification to obtain the RNAi silencing fragment that silences the TaHA1 gene, also known as the RNAi-TaHA1 fragment. The nucleotide sequence of the forward primer is shown in SEQ ID NO.5, specifically:
[0138] 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCCGATCCAGCGCCGCAAG TACCG-3'; The nucleotide sequence of primer R is shown in SEQ ID NO.6, specifically: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTGACACCTTTCGCAAACACC TCAAC-3'.
[0139] Primers were designed for PCR amplification to obtain the OE-TaHA1 fragment overexpressing the TaHA1 gene. The nucleotide sequence of primer F is shown in SEQ ID NO.7, specifically: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTCTATGGGCGGGCTCGAGGA G-3'; the nucleotide sequence of primer R is shown in SEQ ID NO.8, specifically: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCTTCACACGGTGTAGTTCTG G-3'.
[0140] After the above PCR reaction was completed, PCR products were obtained. Electrophoresis was performed on the PCR products, and the results showed that the size of the RNAi-TaHA1 silencing fragment PCR amplification product was approximately 200 bp, while the size of the OE-TaHA1 fragment PCR amplification product was approximately 3000 bp.
[0141] The PCR products were purified by gel extraction of the target fragments. The purified PCR products were then ligated into the target linearized vectors, and the vectors were constructed using the gateway principle.
[0142] The specific steps are as follows: the intermediate vector is pDONR 221, the final vector for the RNAi silencing fragment of the TaHA1 gene is PC336, and the final vector for the OE-TaHA1 fragment of the TaHA1 gene overexpression is pANIC6E.
[0143] Specifically, specific primers were designed according to the attB1 and attB2 sites corresponding to pDONR 221. The nucleotide sequence of the forward primer for RNAi-TaHA1 fragment amplification is shown in SEQ ID NO. 5, and the nucleotide sequence of primer R is shown in SEQ ID NO. 6. The nucleotide sequence of primer F for OE-TaHA1 fragment amplification is shown in SEQ ID NO. 7, and the nucleotide sequence of primer R is shown in SEQ ID NO. 8. Using the above primer pairs, RNAi-TaHA1 fragments and OE-TaHA1 fragments containing the attB site were obtained by PCR amplification.
[0144] The target gene fragment was constructed into the intermediate vector pDONR 221 using a backpropagation (BP) reaction. The amplified fragments containing the attB site, namely the RNAi-TaHA1 fragment and the OE-TaHA1 fragment, were referred to as attB-PCR products. After obtaining the RNAi-TaHA1 fragment and the OE-TaHA1 fragment containing the attB site, a BP reaction was performed. The BP reaction system consisted of 20–60 ng / μL of the attB-PCR product containing the attB site, 0.5 μL of pDONR 221, and BP Clonase. TMII. Add 0.5 μL of TE buffer to a final volume of 5 μL. The BP reaction temperature is 25℃; the BP reaction time is 16–24 h. After the BP reaction is complete, transform the BP product into the DH5α strain. After transformation, culture the transformed DH5α strain. The culture temperature is 37℃, and the culture is performed in a 37℃ incubator for 24–36 h. After culture, single colonies of the transformed DH5α strain are picked for colony PCR to identify positive colonies. The forward primer nucleotide sequence used for colony PCR verification is shown in SEQ ID NO.9, specifically: 5'-TGTAAAACGACGGCCAGT-3', and the reverse primer nucleotide sequence is shown in SEQ ID NO.10, specifically: 5'-CAGGAAACAGCTATGACC-3'. The colony PCR system consisted of 15 μL of Premix ExTaq, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, and 6.5 μL of ddH2O. Positive colonies identified by colony PCR were further sequenced to determine the recombinant entry vectors pDONR 221-TaHA1-RNAi and pDONR 221-TaHA1-OE, respectively. pDONR 221-TaHA1-RNAi and pDONR 221-TaHA1-OE are collectively referred to as the recombinant entry vectors.
[0145] After successful sequencing, the restriction endonuclease Nru I was used to linearize pDONR 221-TaHA1-RNAi and pDONR221-TaHA1-OE, respectively, to reduce false positives in subsequent reactions. The digestion temperature was 37℃, and the digestion time was 3–4 h. The linearized products were recovered, and the RNAi-TaHA1 fragment from the recombinant entry vector pDONR 221-TaHA1-RNAi was constructed into the final vector PC336 via the LR reaction; the OE-TaHA1 fragment from the recombinant entry vector pDONR 221-TaHA1-OE was constructed into the final vector pANIC6E.
[0146] The LR reaction system includes 1–3 μL of enzyme-digested recombinant entry vector, 0.5 μL of final vector, and LR Clonase. TM 1 μL of TE Buffer (pH 8.0) was added to a final volume of 5 μL. The LR reaction was performed at 25°C for 16 h. After the LR reaction, the product was transformed into the DH5α strain. The transformed DH5α strain was then cultured at 37°C for 24–36 h. After culturing, single colonies of the transformed DH5α strain were picked for colony PCR to identify positive colonies.
[0147] The forward primer nucleotide sequence used for colony PCR verification of DH5α strain containing the RNAi-TaHA1 fragment vector is shown in SEQ ID NO.11, specifically: 5'-TCAGCGCCGTCGTCGGTGAA-3', and the reverse primer nucleotide sequence is shown in SEQ ID NO.12, specifically: 5'-CCAAATGTTTGAACGATCGG-3'.
[0148] The forward primer nucleotide sequence used for colony PCR verification of the DH5α strain containing the OE-TaHA1 fragment vector is shown in SEQ ID NO.13, specifically: 5'-GGGGACAAGTTTGTACAA-3', and the reverse primer nucleotide sequence is shown in SEQ ID NO.14, specifically:
[0149] 5'-GGGGACCACTTTGTACAA-3'.
[0150] The colony PCR system described above was 15 μL, specifically composed of: 7.5 μL Premix ExTaq, 0.5 μL of 10 μM forward primer, 0.5 μL of 10 μM reverse primer, and 6.5 μL ddH2O. In this invention, the positive colonies obtained from colony PCR identification were further subjected to plasmid extraction and sent to Qingke Biotechnology Co., Ltd. for sequencing. The successfully sequenced RNAi-TaHA1-PC336 and OE-TaHA1-pANIC6E vectors were transformed into EHA105 Agrobacterium competent cells for culture and used in the creation of transgenic wheat.
[0151] 2. After successful vector construction, the vector was sent to the transgenic platform of the State Key Laboratory of Arid Area Stress at Northwest A&F University for genetic transformation. Wild-type Fielder wheat embryos were used as transformation materials to carry out Agrobacterium-mediated wheat genetic transformation, and T0 generation RNAi-TaHA1 and T0 generation OE-TaHA1 positive plants were finally obtained.
[0152] After obtaining T0 generation RNAi-TaHA1 positive plants and T0 generation OE-TaHA1 positive plants, they were transplanted into wheat culture incubators for propagation culture at a temperature of 20℃, and finally T1 generation RNAi-TaHA1 plants and T1 generation OE-TaHA1 plants were obtained.
[0153] T1 generation RNAi-TaHA1 and T1 generation OE-TaHA1 plants were treated, and genomic DNA was extracted from the first true leaf of the T1 generation plants.
[0154] The forward primer nucleotide sequence for positive identification of T1 generation RNAi-TaHA1 plants is shown in SEQ ID NO.11, and the reverse primer nucleotide sequence is shown in SEQ ID NO.12.
[0155] The nucleotide sequences of the forward primers for positive identification of T1 generation OE-TaHA1 plants are shown in SEQ ID NO.13, and the reverse primer sequences are shown in SEQ ID NO.14. Simultaneously, the RNAi vector plasmid of the RNAi-TaHA1 gene and the vector plasmid of the OE-TaHA1 gene were used as positive controls, water as a blank control, and untransformed plant genomic DNA as a negative control. PCR amplification was performed using the aforementioned primers. The PCR products of the experimental and control groups were detected by 1.2% agarose gel electrophoresis. The experimental group showed bands of the same size as the positive control group, while the blank and negative control groups showed no bands, thus confirming that the T1 generation was a positive plant.
[0156] Electrophoresis results of RNAi-TaHA1 plant experimental group and control group are as follows: Figure 3 As shown in A in the figure. Where M is the DL2000 DNA Marker; WT is the negative control group; H2O is the blank control group; R1 to R5 are the R1 to R5 plants in the T1 generation; PC is the positive control group; and the red arrows point to the size of the target gene band.
[0157] Electrophoresis results of OE-TaHA1 plants in experimental and control groups are as follows: Figure 4 As shown in A in the figure. Where M is the DL2000 DNA Marker; WT is the negative control group; H2O is the blank control group; OE1 to OE7 are the OE1 to OE7 plants in the T1 generation; PC is the positive control group; the red arrow points to the size of the target gene band.
[0158] Depend on Figure 3 From A, we can see that R1 to R5 all amplified the target gene bands, and R1 to R5 are all RNAi-TaHA1 plants. Figure 4 From A, we can see that OE1 to OE7 can all amplify the target gene band, and OE1 to OE7 are all OE-TaHA1 plants.
[0159] 3. When the RNAi plants to be identified reach the two-leaf-one-heart stage, inoculate the second fully expanded true leaf with electronic fluoride solution using the physiological race CYR31 of stripe rust. Inoculate each leaf with 20 μL of electronic fluoride solution and spore suspension, with a spore concentration of 2 mg / mL in the spore suspension. After inoculation, wheat should be placed in a dark and humidified incubator at 16℃ for 24 h, and then placed in a wheat light incubator with a light-dark cycle of 16 h / 8 h and a temperature of 16℃ for light culture. Observe the sporulation of wheat leaves 14 days after inoculation. At the same time, RNA is extracted from wheat leaves inoculated with stripe rust for 24 h, reverse transcribed into cDNA, and the silencing efficiency of different RNAi lines is detected by qRT-PCR.
[0160] Meanwhile, wild-type Fielder wheat was inoculated with stripe rust physiological race CYR31 using electronic fluoride solution on the second fully expanded true leaves. Each leaf was inoculated with 20 μL of electronic fluoride solution and spore suspension. After inoculation, the wheat was first placed in a 16℃ dark humidified incubator for 24 hours, and then placed in a wheat light incubator with a light-dark cycle of 16h / 8h and a temperature of 16℃ for light culture. Sporulation was observed on the wheat leaves 14 days after inoculation. RNA was extracted from wheat leaves inoculated with stripe rust 24 hours prior, reverse transcribed into cDNA, and qRT-PCR was used to detect the expression of the corresponding genes as a control experiment.
[0161] When the OE-TaHA1 plants that were to be identified as positive reached the two-leaf-one-heart stage, the stripe rust physiological race CYR23 was inoculated onto the unfolded second true leaf using electronic fluorination solution. 20 μL of electronic fluorination solution and spore suspension were inoculated onto each leaf, with a spore concentration of 2 mg / mL in the spore suspension. After inoculation, the wheat was first placed in a dark and humidified incubator at 16℃ for 24 h, and then placed in a wheat light incubator with a light-dark cycle of 16 h / 8 h and a temperature of 16℃ for light culture. Sporulation of wheat leaves was observed 14 days after inoculation. At the same time, RNA was extracted from wheat leaves inoculated with stripe rust for 24 h, reverse transcribed into cDNA, and the silencing efficiency of different RNAi lines was detected by qRT-PCR.
[0162] Simultaneously, wild-type Fielder wheat was inoculated with stripe rust physiological race CYR23 using electronic fluoride solution on the second fully expanded true leaves. Each leaf was inoculated with 20 μL of electronic fluoride solution and spore suspension, with a spore concentration of 2 mg / mL in the spore suspension. After inoculation, the wheat was first placed in a 16℃ dark humidified incubator for 24 hours, then placed in a wheat light incubator with a 16h / 8h light-dark cycle and a temperature of 16℃ for light culture. Sporulation was observed on the wheat leaves 14 days after inoculation. RNA was extracted from wheat leaves inoculated with stripe rust for 24 hours, reverse transcribed into cDNA, and qRT-PCR was used to detect the expression of the corresponding genes as a control experiment.
[0163] The forward primer nucleotide sequence used for qRT-PCR to detect RNAi-TaHA1 silencing efficiency is shown in SEQ ID NO.15, specifically: 5'-ATTCATTGGTCTGTTGCCCCTGTTT-3', and the reverse primer nucleotide sequence is shown in SEQ ID NO.16, specifically: 5'-GCCCATCCCAAGCCTCCTAC-3'.
[0164] The nucleotide sequences of the forward primers used for qRT-PCR to detect OE-TaHA1 expression are shown in SEQ ID NO.15, and the reverse primer sequences are shown in SEQ ID NO.16. The above qRT-PCR used TaEF as an internal reference gene. The nucleotide sequences of the forward primers are shown in SEQ ID NO.17, specifically: 5'-TGGTGTCATCAAGCCTGGTATGGT-3', and the reverse primer sequences are shown in SEQ ID NO.18, specifically: 5'-ACTCATGGTGCATCTCAACGGACT-3'. Two... -ΔΔCT The analytical methods included analyzing the silencing efficiency of RNAi-TaHA1 plants and the overexpression of OE-TaHA1 plants. Three parallel assays were performed on each sample for qRT-PCR.
[0165] The silencing efficiency of different RNAi-TaHA1 plants detected by qRT-PCR is shown in Table 1 and... Figure 3 As shown in B in the diagram.
[0166] The results of qRT-PCR detection of overexpression efficiency in different OE-TaHA1 plants are shown in Table 2 and Figure 4 As shown in B in the diagram.
[0167] Table 1. Silencer efficiency of different RNAi-TaHA1 lines detected by qRT-PCR
[0168] WT R1 R2 R3 R4 R5 1 0.30566 0.479632 0.423373 0.258816 0.712025 1 0.438303 0.41466 0.456916 0.20166 0.521233 1 0.460094 0.558644 0.45376 0.293209 0.4166629
[0169] From Table 1 and Figure 3 As shown in B, the relative expression level of the TaHA1 gene in the T1 generation RNAi-TaHA1 plants R1 to R5 was significantly reduced, proving that the TaHA1 gene was significantly suppressed in the R1 to R5 plants.
[0170] Table 2. Expression levels of different OE-TaHA1 strains detected by qRT-PCR
[0171] WT OE4 OE5 OE7 1 5.578975 6.916298 8.633826 1 5.979397 7.260153 8.224911 1 5.205367 5.388934 8.815241
[0172] From Table 2 and Figure 4As shown in B, the relative expression level of the TaHA1 gene in the T1 generation OE-TaHA1 plants OE4, OE5 and OE7 lines was significantly enhanced compared with that of wild-type WT, indicating that the TaHA1 gene in the OE4, OE5 and OE7 lines was significantly enhanced.
[0173] The sporulation of wheat leaves of the RNAi-TaHA1 strain was observed 14 days after inoculation, as shown in Table 3 and Figure 4. Figure 3 C and Figure 3 As shown in D in the figure. Table 3 shows the statistical results of 3cm using ImageJ software. 2 Spore counts of wild-type (WT) and RNAi-TaHA1 wheat leaves 14 days after inoculation with stripe rust fungus. The mean and standard deviation of spore counts of RNAi-TaHA1 positive plants 14 days after inoculation with stripe rust fungus CYR31 are based on three biological replicates. * and ** indicate significant differences (P<0.05) and highly significant differences (P<0.01), respectively.
[0174] Table 3. Spore count of RNAi-TaHA1 strains
[0175] Group Spore count 1 Spore count 2 Spore count 3 WT 636 734 723 R1 166 171 192 R2 259 223 282 R3 135 144 153 R4 396 392 376 R5 482 439 458
[0176] From Table 3 and Figure 3 C and Figure 3 As shown in D, when the second true leaf of RNAi-TaHA1 positive plants and WT plants was inoculated with stripe rust fungus CYR31 (affinity), the number of urediniospores on the leaves of RNAi-TaHA1 wheat plants was significantly lower than that of wild-type plants 14 days after inoculation. The results indicate that silencing the TaHA1 gene provided by this invention enhances the resistance of wheat plants to stripe rust infection.
[0177] The phenotype and biomass of wheat leaves from the OE-TaHA1 strain inoculated with stripe rust fungus CYR23 were quantitatively detected 14 days after inoculation. The specific method was as follows: 14 days after inoculation, total DNA was extracted from each treatment sample and used as a template. qRT-PCR was performed using quantitative PCR primers for the internal control genes TaEF and PsEF, respectively. The forward primer nucleotide sequence for PsEF is shown in SEQ ID NO.19: 5'-TTCGCCGTCCGTGATATGAACAA-3', and the reverse primer nucleotide sequence is shown in SEQ ID NO.20: 5'-ATGCGTATCATGGTGGTGGAGTGA-3'. The results of the quantitative detection of phenotype and biomass of wheat leaves from the OE-TaHA1 strain inoculated with stripe rust fungus CYR23 14 days after inoculation are shown in Table 4 and... Figure 4C and D in the table can be obtained. Table 4 shows the biomass of wild-type (WT) and OE-TaHA1 wheat leaves inoculated with stripe rust fungus 14 days after inoculation using qRT-PCR technology, with TaEF and PsEF as internal control primers. * and ** indicate significant differences (P<0.05) and highly significant differences (P<0.01), respectively.
[0178] Table 4. Biomass of stripe rust fungi in different OE-TaHA1 strains as detected by qRT-PCR
[0179]
[0180]
[0181] From Table 4 and Figure 4 As shown in C and D, inoculating the second true leaf of OE-TaHA1 positive plants and WT plants with the stripe rust fungus CYR23 (incompatible) resulted in obvious sporulation on the wheat leaves of OE-TaHA1 plants 14 days after inoculation. Compared with wild-type WT, the T1 generation OE-TaHA1 lines OE4, OE5, and OE7 showed significantly upregulated stripe rust biomass expression. These results indicate that overexpression of the TaHA1 gene provided by this invention significantly weakens the resistance of wheat plants to stripe rust infection and increases wheat susceptibility to stripe rust.
[0182] In summary, the TaHA1 gene silencing provided by this invention enhances the resistance of wheat plants to stripe rust infection, while overexpression of the TaHA1 gene significantly enhances the susceptibility of wheat to stripe rust. This indicates that silencing the TaHA1 gene plays a role in reducing wheat susceptibility in the interaction between wheat and stripe rust.
[0183] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. Application of silencing TaHA1 gene expression in improving wheat resistance to stripe rust and / or reducing wheat susceptibility to stripe rust, wherein the nucleotide sequence of the TaHA1 gene is shown in SEQ ID NO.
1.
2. A recombinant vector for silencing TaHA1 gene expression, characterized in that, The recombinant vector includes an RNAi-TaHA1 silencing fragment, the nucleotide sequence of which is shown in SEQ ID NO.
4.
3. The method for constructing the recombinant vector for silencing TaHA1 gene expression as described in claim 2, characterized in that, Includes the following steps: The RNAi silencing fragment that silences TaHA1 gene expression was constructed into an intermediate vector using a BP reaction to obtain a recombinant entry vector; The RNAi silencing fragment in the recombinant introductory vector was constructed into the final vector using the LR reaction to obtain the recombinant vector.
4. The construction method according to claim 3, characterized in that, The intermediate carrier includes pDONR 221; the final carrier includes PC336.
5. A method for obtaining stripe rust-resistant wheat, characterized in that, Includes the following steps: The recombinant strain containing the recombinant vector of claim 2 was transferred into wheat embryos by genetic transformation to obtain TaHA1 transgenic wheat.
Citation Information
Patent Citations
Wheat ATP enzyme protein, gene and application thereof
CN117947067A