Extension factor BnELP2 gene for regulating sclerotinia sclerotiorum resistance of brassica napus and application thereof

By constructing and validating overexpression and knockout vectors of the BnELP2 gene in rapeseed, the problem of lack of genetic source for resistance to sclerotinia stem rot in rapeseed was solved, and effective regulation of rapeseed resistance to sclerotinia stem rot and variety improvement were achieved.

CN117778456BActive Publication Date: 2025-11-21HUBEI UNIV +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311847178.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-28
Publication Date
2025-11-21
Estimated Expiration
2043-12-28

AI Technical Summary

Technical Problem

Existing technologies lack effective genetic sources of resistance in the control of sclerotinia stem rot in rapeseed. Chemical and biological control methods suffer from environmental pollution or high costs. Furthermore, gene editing technology is rarely used in rapeseed, and the disease resistance function of the elongation factor complex ELP2 has not been thoroughly studied.

Method used

By screening and validating the BnELP2 gene with the highest homology in rapeseed, an overexpression vector and a CRISPR/Cas9 gene knockout vector were constructed. Agrobacterium-mediated genetic transformation was used to overexpress and knock out the gene in Brassica napus, and its function in resisting sclerotinia stem rot and regulating the JA/ET and reactive oxygen species signaling pathways were analyzed.

Benefits of technology

This study significantly improved the resistance of rapeseed to sclerotinia stem rot, and overexpression of BnELP2 increased H2O2 accumulation and the expression of disease resistance-related genes, providing new genetic resources and a pathway for breeding resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure GDA0005640346130000081
    Figure GDA0005640346130000081
  • Figure GDA0005640346130000091
    Figure GDA0005640346130000091
  • Figure GDA0005640346130000092
    Figure GDA0005640346130000092
Patent Text Reader

Abstract

The application belongs to the technical field of plant genetic engineering, and particularly relates to an extension factor subunit BnELP2 gene for regulating resistance of Brassica napus to sclerotinia stem decay and application. An extension factor subunit BnELP2 gene induced by Sclerotinia sclerotiorum is screened, the nucleotide sequence of the gene is shown as SEQ ID NO:1, and the protein sequence coded by the gene is shown as SEQ ID NO:2. By using Agrobacterium-mediated transformation, a BnELP2 overexpression transgenic line and a CRISPR / Cas9 mutant line are obtained. It is found by inoculating the transgenic material with Sclerotinia sclerotiorum that the BnELP2 overexpression line has enhanced resistance to Sclerotinia sclerotiorum, and the mutant line is more susceptible to Sclerotinia sclerotiorum, which indicates that BnELP2 is a positive regulation factor for resistance of Brassica napus to Sclerotinia sclerotiorum, plays a positive regulation role in resistance of Brassica napus to Sclerotinia sclerotiorum, and overexpression of the gene can significantly improve the resistance of Brassica napus to Sclerotinia sclerotiorum.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering, specifically involving the BnELP2 gene, an extension factor that regulates resistance to sclerotinia stem rot in Brassica napus, and its application. Background Technology

[0002] Rapeseed is one of my country's important oilseed crops, ranking first in both planting area and total yield. Sclerotinia sclerotiorum rot, caused by the fungus *Sclerotinia sclerotiorum*, is one of the most serious diseases affecting rapeseed. Sclerotinia sclerotiorum rot primarily damages the stems, leaves, flowers, pods, and seeds of rapeseed. It is a global fungal disease, occurring in China, Europe, India, Australia, and the United States (Zheng X., Koopmann B., Ulber B., et al. A global survey on diseases and pests in oilseed rape—current challenges and innovative strategies of control. Frontiers in Agronomy, 2020, 2:590908). Studies have shown that crop losses due to sclerotinia sclerotiorum exceed $200 million annually in the United States (Bolton MD, Thomma B.PHJ, Nelson B.D. Sclerotinia sclerotiorum (Lib.) de Bary: biology and molecular traits of a cosmopolitan pathogen. Mol Plant Pathol, 2006, 7). In China, sclerotinia sclerotiorum generally causes yield losses of 10%-30% in rapeseed (Cai Junsong. Study on the occurrence pattern and diversity of sclerotinia sclerotiorum in rapeseed in Chongqing. Southwest University, 2020). However, in some years, the damage is severe due to climate and other conditions. For example, in Ezhou City, Hubei Province, sclerotinia sclerotiorum occurred in all plots for two consecutive years, with the affected area reaching 95.58% in 2021 (Wu Jiang. Analysis of the causes and control strategies for the severe occurrence of sclerotinia sclerotiorum in rapeseed in Ezhou City. Hubei Plant Protection, 2022: 54-55). In addition, sclerotinia stem rot can lead to a reduction in dry matter accumulation, decreased seed vigor, lower oil yield, and reduced germination rate in rapeseed, thereby reducing its economic benefits (Li Dongfeng; Zhao Yanfen; Wang Weifeng; Xu Nianning; Shao Hongmei; Occurrence and control of sclerotinia stem rot in seed cabbage. Seed Industry Guide, 2016).

[0003] Currently, there are three main methods for controlling crop diseases caused by Sclerotinia sclerotiorum: chemical control, biological control, and agricultural control. Chemical control mainly involves spraying chemical fungicides, which has little impact on sclerotia in the soil but causes serious environmental pollution. Agricultural control is costly and has minimal effect. Biological control is affected by the environment and has low stability in actual effectiveness. Developing new disease-resistant crop varieties is the most economical and effective approach. However, hybridization breeding is time-consuming and lacks effective sources of resistance genetics. Transgenic breeding of crops using genetic engineering technology has advantages such as wide applicability, stable control effects, and the ability to manipulate and select single or multiple effector genes. Currently, the most widely used gene editing systems include three categories: zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and the CRISPR / Cas system. Among them, the CRISPR / Cas system has become an important method for crop gene function research and trait improvement. Researchers have already developed various disease-resistant crops using gene editing technology, such as insect-resistant cotton and rice blast-resistant rice. Therefore, continuously exploring Sclerotinia sclerotinia resistance genes through gene editing technology and elucidating their resistance molecular mechanisms can provide theoretical guidance and germplasm resources for the breeding of Sclerotinia sclerotinia resistant varieties, and have important reference value for the safe production of rapeseed.

[0004] The elongator complex (ELP) is a protein complex identified by Otero et al. during their research on transcriptional elongation regulators in yeast. It binds tightly to highly phosphorylated RNA polymerase II, hence the name (Wittschieben BO, Otero G, de Bizemont T, F et al. A novel histoneacetyltransferase is an integral subunit of elongating RNA polymerase II holoenzyme. Mol Cell. 1999 Jul; 4(1):123-8). The ELP interacts with RNA polymerase II, promoting transcriptional elongation through histone acetyltransferase activity. It also participates in various cellular activities, including tRNA modification, histone modification, DNA demethylation or methylation, tubulin acetylation, and exocytosis. Mutations in the ELP in plants can lead to abnormal growth and development, increased resistance to abiotic stresses, and decreased resistance to pathogens. Studies have shown that ELP proteins in Arabidopsis and tomato play a positive regulatory role in plant immunity. Heterologous overexpression of Arabidopsis AtELP3 and AtELP4 genes in tomatoes significantly enhances plant resistance to bacterial spot disease without affecting normal plant growth and development, demonstrating a good potential for coordinating plant growth and disease resistance (Pereira JA, Yu F, Zhang Y, et al. The Arabidopsis elongator subunit ELP3 and ELP4 confer resistance to Bacterial Speck in tomato. Frontiers in Plant Science. 2018, 24(9):1066). Although studies on Arabidopsis ELP have found that this gene family has a positive regulatory effect on plant immune responses, research on the disease resistance function of ELP2 is still limited. There are few reports on the function of ELP in other plants, especially crops. Among them, whether ELP2 mediates resistance to sclerotinia stem rot in rapeseed has not been reported, and its function needs further verification. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings and deficiencies of existing technologies and provide an application of the extension factor complex gene BnELP2 in the resistance of rapeseed to Sclerotinia stem rot. Functional verification and transformation applications of this gene were conducted. Based on Arabidopsis thaliana homologous sequence alignment, the BnELP2 sequence with the highest homology was selected. The nucleotide sequence of the gene is shown in SEQ ID NO: 1. The gene was cloned, and overexpression and knockout vectors were constructed. Overexpression and knockout expression were performed in Brassica napus Westar using Agrobacterium-mediated genetic transformation. Sclerotinia stem rot was then inoculated, and the disease resistance of transgenic plants, the inhibitory effect of leaf extracts on Sclerotinia stem rot growth, the accumulation of endogenous reactive oxygen species in leaves, and the detection of JA / ET and reactive oxygen species signaling pathway marker genes were analyzed. The function of this gene in rapeseed resistance to Sclerotinia stem rot was rapidly identified, providing a new genetic resource for breeding rapeseed with resistance to Sclerotinia stem rot.

[0006] The technical solution of the present invention is as follows:

[0007] The applicant cloned a gene, BnELP2, which regulates resistance to sclerotinia stem rot in rapeseed, and its nucleotide sequence is shown in SEQ ID NO:1.

[0008] The protein sequence encoded by the above-mentioned rapeseed elongation factor BnELP2 gene, which regulates resistance to sclerotinia stem rot in rapeseed, is shown in SEQ ID NO:2.

[0009] The present invention relates to the application of the BnELP2 gene in regulating resistance to sclerotinia stem rot in rapeseed.

[0010] The more detailed technical solution is as follows:

[0011] The expression patterns of the rapeseed ELP gene family induced by *Sclerotinia sclerotiorum* were analyzed using RT-qPCR. Based on the gene expression patterns, the target gene BnELP2 was ultimately identified (see [link to study]). Figure 1 ).

[0012] RNA was extracted from the leaves of Brassica napus (Usage) The Super Total RNA Extraction Kit (purchased from Promega, USA) was used to reverse transcribe the RNA into cDNA using Superscript III (purchased from Invitrogen, USA). The reaction conditions were: 70℃ / 5 min; 25℃ / 5 min; 42℃ / 90 min; 70℃ / 10 min. Using information from the rapeseed genome, amplification primers were synthesized: the forward primer BnELP2-full-F (5'TGGACCGGCATTATCTGCTC 3') and the reverse primer BnELP2-full-R (5'GTACATGTCTCCAATTGTTACTGTT 3') to amplify the BnELP2 gene cDNA. PCR reaction conditions were: 94℃ pre-denaturation for 3 min; 94℃ for 30 sec, 59℃ for 30 sec, 72℃ for 2 min 50 sec, 28 cycles; extension at 72℃ for 7 min. The PCR product obtained by amplification was ligated into the pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced to obtain the required gene ORF, the sequence of which is the nucleotide sequence shown in SEQ ID NO:1, encoding an 824-amino acid sequence (the sequence shown in SEQ ID NO:2).

[0013] This invention uses pCBC-DT1DT2 (vector resistance is chloramphenicol) as the intermediate gene editing vector. Figure 2 Figure A in the diagram shows that pKSE401 (vector resistance is kanamycin) is the final gene editing vector. Figure 2 Figure B in the diagram shows that pGWB418 (vector resistance to kanamycin and spectinomycin) is the final overexpression vector (see Figure B). Figure 2(Figure C in the original text) The applicant constructed the overexpression vector pGWB418-BnELP2 and the CRISPR / Cas9-Bnelp2 gene knockout vector for this gene, respectively. The applicant transformed these two vectors into Brassica napus Westar cells using Agrobacterium-mediated hypocotyl infection until regenerated differentiated seedlings were obtained. Genomic DNA was extracted from leaves of wild-type Brassica napus as a control and from transgenic rapeseed lines using the CTAB method. The gene-edited line was named U626-IDF(5'TGTCCCAGGATTAGAATGATTAGGC). Using primers 3') and U629-IDR (5'AGCCCTCTTCTTTCGATCCATCAAC3'), overexpression lines were amplified by PCR using primers JD418-F (5'ATGTGATATCTCCACTGACGTA3') and JDELP2-R (5'ACAATTGCTTTGGAGTCAGC3'). Positive lines overexpressing this gene and CRISPR / Cas9 knockout positive lines were screened. Expression levels in positive materials were then detected by RT-qPCR and sequenced. The transcriptional level of BnELP2 in ELP2-4, ELP2-5, ELP2-7, ELP2-10, ELP2-14, ELP2-23, and ELP2-24 was significantly upregulated compared to the wild type. Figure 3 -A). Gene editing materials elp2-39 and elp2-77 are single-base insertions, while elp2-50 is a 4-base deletion. Figure 3 -B). The above-mentioned transgenic materials were self-pollinated to obtain higher generations, which were then used as materials for subsequent experiments.

[0014] This invention conducted in vitro leaf inoculation experiments and leaf extract culture experiments on BnELP2 transgenic materials (overexpression lines and CRISPR / Cas9 mutant lines) to detect Sclerotinia sclerotiorum rot. The results showed that compared with the control materials, the BnELP2 overexpression materials exhibited significantly increased resistance to Sclerotinia sclerotiorum rot, while the ELP2 mutant was more susceptible to the pathogen. Figure 4 and Figure 5 Thirty-six hours after inoculation with Sclerotinia sclerotiorum, DAB staining was performed on the inoculated leaves of wild-type and transgenic lines to observe H2O2 accumulation. The results showed that overexpression of BnELP2 increased H2O2 accumulation in rapeseed leaves during Sclerotinia sclerotiorum infection, while knockout of BnELP2 decreased H2O2 accumulation in rapeseed during Sclerotinia sclerotiorum infection. Figure 6 Further RT-qPCR revealed that BnELP2 can increase H2O2 accumulation in rapeseed leaves by inhibiting the transcription of catalases BnCAT1 and BnCAT2. Figure 7The expression levels of disease resistance-related genes BnLOX2, BnOPR1, and BnPDF1 were significantly higher in the BnELP2 overexpression material than in the control material. Figure 8 This shows that BnELP2 positively regulates the resistance of rapeseed to sclerotinia stem rot.

[0015] Advantages of this invention:

[0016] This invention analyzes the expression patterns of rapeseed elongation factor complex genes induced by Sclerotinia stem rot, screening and identifying the BnELP2 gene. It was also discovered that BnELP2 is a positive regulator of rapeseed resistance to Sclerotinia stem rot. Increased expression of the BnELP2 gene can regulate the JA / ET pathway marker genes BnLOX2, BnOPR1, and BnPDF1, as well as the H2O2 degradation genes BnCAT1 and BnCAT2, thus participating in rapeseed resistance to Sclerotinia stem rot. Through genetic transformation, overexpression of this gene yielded new rapeseed lines resistant to Sclerotinia stem rot. BnELP2 can serve as a potential marker gene for rapeseed resistance materials. Attached Figure Description

[0017] Figure 1 Analysis of BnELP expression patterns after Westar inoculation with Sclerotinia sclerotiorum. Figure labeling: Figure 1 RT-qPCR results were obtained after inoculating detached leaves of wild-type Brassica napus with Sclerotinia sclerotiorum at 0, 6, 12, 24, 36, 48, and 72 hours. The results indicate that BnELP2 may be a key subunit mediating resistance to Sclerotinia sclerotiorum in Brassica napus.

[0018] Figure 2 Map of vectors used to construct the BnELP2 overexpression vector and the CRISPR / Cas9 gene knockout vector. (Figure labels are explained below.) Figure 2 Figure A in the diagram is the pCBC-DT1DT2 vector map. Figure 2 Figure B in the diagram is the pKSE401 vector map. Figure 2 Figure C in the diagram is the pGWB418 vector map.

[0019] Figure 3 : Expression levels and sequencing analysis results of transgenic materials. Figure labeling explanation: Figure 3 Figure A in the figure shows the expression level detection results of the T0 generation BnELP2 overexpression material. Figure 3 Figure B in the diagram represents the sequencing alignment analysis of the T0 generation BnELP2 gene-edited materials. Overexpression transgenic lines of ELP2-4, ELP2-5, ELP2-7, ELP2-10, ELP2-14, ELP2-23, and ELP2-24, as well as gene-edited materials elp2-39, elp2-77, and elp2-50, were selected for further studies.

[0020] Figure 4: Mycelial plaque formation on detached leaves of transgenic rapeseed seedlings inoculated with *Sclerotinia sclerotiorum* 36 hours after inoculation. (See attached image for labeling.) Figure 4 Figure A shows the phenotypic observation of the control material and the transgenic material 36 hours after inoculation with Sclerotinia sclerotiorum. Figure 4 Figure B in the middle shows the statistical results of plaque area. The results indicate that, compared with the control material, BnELP2 overexpression is more resistant to sclerotinia stem rot, while the Bnelp2 mutant is more susceptible to sclerotinia stem rot.

[0021] Figure 5 Growth of *Sclerotinia sclerotiorum* cultured from leaf extracts of transgenic strains for 48 hours. (Figure labels are explained below.) Figure 5 Figure A shows the bacterial plaque formation of Sclerotinia sclerotiorum after 48 hours of culturing with rapeseed leaf extract. Figure 5 Figure B shows the statistical results of plaque area. Figure 5 Figure C shows the local plaque growth of *Sclerotinia sclerotiorum* after culturing rapeseed leaf extract under a stereomicroscope for 48 hours. The results indicate that, compared with the control material, the leaf extract of the BnELP2 overexpressing material significantly inhibited the growth of *Sclerotinia sclerotiorum*, further demonstrating that BnELP2 positively regulates rapeseed resistance to *Sclerotinia sclerotiorum*.

[0022] Figure 6 DAB staining of detached leaf samples 36 hours after inoculation with *Sclerotinia sclerotiorum*. (Figure labels are explained below.) Figure 6 The H2O2 content was measured 36 h after inoculation of detached leaves with *Sclerotinia sclerotiorum* to verify whether the disease resistance exhibited by overexpressing lines is related to the accumulation of reactive oxygen species. The results showed that overexpression of BnELP2 increased H2O2 accumulation in rapeseed leaves during *Sclerotinia sclerotiorum* infection, while the absence of BnELP2 decreased H2O2 accumulation in rapeseed during *Sclerotinia sclerotiorum* infection.

[0023] Figure 7 Analysis of ROS-related gene expression levels in BnELP2 transgenic lines. Figure labeling explanation: Figure 7 The results are from the detection of ROS synthesis and degradation gene expression levels in wild-type and transgenic strains inoculated for 36 hours. Figure 7 Figure A shows the expression of the ROS synthesis and degradation gene BnCAT1. Figure 7 Figure B shows the expression of the ROS synthesis and degradation gene BnCAT2. The results indicate that BnELP2 increases the accumulation of reactive oxygen species in rapeseed by inhibiting catalases BnCAT1 and BnCAT2, thereby enhancing the rapeseed's resistance to Sclerotinia sclerotiorum.

[0024] Figure 8 Analysis of disease resistance-related gene expression in control and transgenic materials 36 hours after inoculation with *Sclerotinia sclerotiorum*. Figure labeling explanation: Figure 8This study measured the expression levels of disease resistance-related genes LOX2, OPR1, and PDF1 in control and transgenic materials 36 hours after inoculation with *Sclerotinia sclerotiorum*. The results showed that overexpression of BnELP2 increased the transcription levels of JA synthesis-related genes BnLOX2 and BnOPR1, as well as the phytoalexin BnPDF1, thereby enhancing the resistance of Brassica napus to *Sclerotinia sclerotiorum*. Detailed Implementation

[0025] Description of sequences in a sequence list

[0026] SEQ ID NO: 1 is the nucleotide sequence of the rapeseed BnELP2 gene cloned in this invention.

[0027] SEQ ID NO: 2 is the protein sequence encoded by the BnELP2 gene.

[0028] The following embodiments define the present invention and describe the methods for isolating and cloning cDNA segments containing the complete coding region of the BnELP2 gene, and for verifying the function of the BnELP2 gene. Based on the following description and these embodiments, those skilled in the art can determine the essential features of the present invention, and various changes and modifications can be made to the invention to suit different uses and conditions without departing from the spirit and scope thereof.

[0029] Example 1: Isolation and Cloning of the BnELP2 Gene

[0030] 1. Rapeseed RNA extraction and reverse transcription

[0031] The Westar variety of Brassica napus (provided by the Crop Genetics Laboratory of Hubei University) was used as the experimental material. Total RNA was extracted using the MiniBEST PlantRNAExtraction Kit, following the instructions of the TaKaRaPrimeScript™RTreagent Kit with gDNAEraser.

[0032] cDNA synthesis utilizes The IIQ RT SuperMix for qRNA (+gDNAwiper) kit (purchased from Vazyme, China) was used. Based on the RNA concentration, the required amount of 2000 ng RNA was calculated and added to an enzyme-free tube, with enzyme-free water added to a final volume of 5 μl. The enzyme-free tube was then placed in a PCR instrument at 70°C for 5 minutes for denaturation, and immediately placed on ice. 5 μL of a mixture of Buffer Mix Oligo, Enzyme Mix, and enzyme-free water was added, bringing the total volume to 10 μL. The reverse transcription PCR system was as follows: 70°C / 5 min; 25°C / 5 min; 42°C / 90 min; 70°C / 10 min.

[0033] 2. Analysis of the expression pattern of the BnELP2 gene induced by Sclerotinia sclerotiorum.

[0034] A 6mm mycelial block of *Sclerotinia sclerotiorum* (preserved by the Crop Genetics Laboratory of Hubei University) was punched and placed in a PDA plate for activation. When the mycelium was about to spread to the edge of the plate, it was placed in a new PDA plate for activation and incubated in the dark at 22℃ for about 40 hours. The storage containers were cleaned and sterilized, and absorbent paper was placed at the bottom for leaf storage and incubation. An equal amount of sterile water was added to each container, and the containers were sealed for later use. The second-to-last fully expanded 6-leaf stage new leaves of rapeseed of the same size were selected and placed in the storage container. The petiole was kept moist with a cotton ball. A 6mm mycelial block of newly formed mycelium near the edge of the plate was taken, avoiding the main vein, and placed upside down in the same position on the leaf. The same amount of water was sprayed evenly to maintain humidity, and the containers were incubated in the dark at 22℃. After inoculation, total RNA was extracted from the inoculated leaves at different time points and reverse transcribed into cDNA as a template. A real-time quantitative RT-qPCR kit was used for analysis. Use the Green PCR Master Mix (following the kit instructions) and perform the reaction on a BIO-Rad CFX Connect (manufactured by BIO-Rad) real-time PCR instrument. The required primers are as follows: internal control primer Q-BnActin7F (5'TCTTCCTCACGCTATCCTCCG3'), internal control primer Q-BnActin7R (5'AGCCGTCTCCAGCTCTTGC3'), Q-BnELP1-F (5'ATGAGATCTTGAAACTGGCGTA3'), Q-BnELP1-R (5'GCAAATTAACTCCACCGCTTAT3'), Q-BnELP2-F (5'TGGACCGGCATTATCTGCTC3'), Q-BnELP2-R (5'GTACATGTCTCCAATTGTTACTGTT3'), Q-BnELP3-F (5'CGGCGAATCGAAAAAGCAACCAC3'), Q-BnELP3-R (…). The assays included 5'TCCGGCAAGCCTGGGTTTTAATC3', Q-BnELP4-F (5'CCGCATCGCCATCCAGTCATTC3'), Q-BnELP4-R (5'CGCCATGTGCTGCAGTCTTGTTGAG3'), Q-BnELP6-F (5'CTAGCCTTAGGGTTAGATGAGC3'), and Q-BnELP6-R (5'GACAGATTGCATCCGAGTTTAC3'). The results showed that BnELP2 expression was significantly upregulated by *Sclerotinia sclerotiorum*, suggesting that BnELP2 may be involved in the resistance response of rapeseed to *Sclerotinia sclerotiorum*.

[0035] 3. Obtaining the BnELP2 gene sequence

[0036] Using the above cDNA as a template, the target gene was amplified using the forward primer BnELP2-full-F (5'TGGACCGGCATTATCTGCTC3') and the reverse primer BnELP2-full-R (5'GTACATGTCTCCAATTGTTACTGTT3'). PCR reaction conditions were as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 20 sec, 56–60℃ annealing for 30 sec, 72℃ extension for 90 sec, 30 cycles; 72℃ extension for 10 min, and storage at 4℃. The amplified PCR product was ligated into the pGEM-T vector (purchased from Promega, USA), positive clones were screened and sequenced, and positive strains were stored at -80℃. The open reading frame (ORF) of the desired BnELP2 gene was obtained, and its nucleotide sequence is shown in SEQ ID NO: 1. The 824 amino acids corresponding to the open reading frame (ORF) of the BnELP2 gene were determined using BlastX (http: / / www.ncbi.nlm.nih.gov), and the protein sequence encoded by the BnELP2 gene was inferred as shown in the sequence listing SEQ ID NO: 2.

[0037] Example 2: Overexpression of BnELP2 and Construction of CRISPR / Cas9 Gene Knockout Vector

[0038] 1. Construction of overexpression vectors

[0039] The pGWB418 strain was activated in liquid LB medium (with 50 mg / L kanamycin added). After plasmid extraction, it was double-digested with AfeI and SacI. The digested products were purified and recovered, and stored at -20℃ for later use. The target fragment with adapter BnELP2 recovered from the above digestion was infused with the linearized vector pGWB418 using homologous recombinase (purchased from Nanjing Novizan Biotechnology Co., Ltd.) to obtain the recombinant vector (pGWB418-BnELP2). The specific reaction system was as follows: 1.0 μL of double-digested linearized pGWB418 vector, 1.0 μL of 5×CEⅡ buffer, 0.5 μL of LexnaseⅡ homologous recombinase, 1 μL of PCR purified and recovered BnELP2 product with vector adapter, and the volume was made up to 5.0 μL with sterile ddH2O. After reacting at 37℃ for 40 min, heat shock transformation of Escherichia coli was performed using Escherichia coli DH5α strain. The specific transformation procedure is as follows: Thaw *E. coli* DH5α competent cells stored at -80℃ on ice. Add 50 μL of competent cells to 5 μL of the ligation reaction mixture, mix gently, and place on ice for 10 min. After the ice bath, incubate at 42℃ for 90 sec, then immediately place on ice for 2 min. Add 200 μL of LB liquid medium and incubate at 37℃ and 200 rpm for 50 min to recover the cells. After recovery, spread the bacterial culture evenly on LB solid medium (with 50 mg / L kanamycin added) and incubate inverted at 37℃ overnight. Pick single clones, select 2-3 positive clones for sequencing, and preserve the strain without any mutations and the corresponding plasmid, naming it recombinant plasmid pGWB418-BnELP2. The correctly sequenced recombinant plasmid pGWB418-BnELP2 was transformed into Agrobacterium GV3101 competent cells using chemical transformation. Single colonies were picked and cultured on YEP liquid medium (YEP liquid medium is a commonly used medium; in this example, 30 mg / L rifampin and 50 mg / L kanamycin were added). The culture was shaken at 28°C for 24-36 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use.

[0040] 2. Construction of CRISPR / Cas9 gene knockout vector

[0041] Based on the BnELP2 gene sequence of Brassica napus obtained from the BnPIR database, two gRNAs with the highest scores and strongest specificity were screened using CRISPR-P 2.0 (CRISPR-Pv2.0(hzau.edu.cn)) developed by the State Key Laboratory of Crop Genetic Improvement at Huazhong Agricultural University: elp2-gRNA1 (5'TGTGAGCTTAAAGGCCACA3') and elp2-gRNA2 (5'GAAGATTGGGTCTATTCCG3'). Amplification primers were synthesized based on gRNA: elp2-BsF (5'ATATATGGTCTCGATTGTGTGAGCTTAAAGGCCACAGTT3'), elp2-BsR (5'ATTATTGGTCTCGAAACCGGAATAGACCCAATCTTCCAA3'), elp2-F (5'TGTGTGAGCTTAAAGGCCACATTTAGAGCTAGAAATAGC3'), and elp2-R (5'AACCGGAATAGACCCAATCTTCCAATCTCTTAGTCGACTCTAC3'). Using the intermediate vector pCBC-DT1T2 as a template, the four primers were mixed for amplification. The product was then preserved, digested, and ligated for use. The PCR product from the previous step was then ligated with the pKSE401 vector using BsaI restriction enzyme and T4 ligase at 37°C for 12 hours. The reaction product was heat-shocked and transformed into *E. coli* DH5α. Single colonies were selected for positive detection and sequencing. Positive strains and plasmids were preserved, and the positive plasmids were transformed into *Agrobacterium* GV3101 competent cells. Single colonies were picked and cultured in YEP liquid medium with appropriate resistance at 28°C with shaking for 36-48 h. After PCR detection, positive strains were stored at -80°C with an appropriate amount of glycerol for later use.

[0042] Example 3: Genetic transformation of rapeseed

[0043] Recombinant plasmids (i.e., overexpression vectors and knockout vectors) were screened and differentiated into seedlings using Agrobacterium-mediated hypocotyl infection. The specific steps are as follows:

[0044] 1. Seedling emergence: Select plump and active Westar seeds, put them into EP tubes, add mercuric chloride to sterilize in a clean bench for 4 minutes, pour out and recover the mercuric chloride, add 75% ethanol to sterilize for 2 minutes, pour out, rinse with sterile water for 2 minutes, repeat 3 times, use sterile tweezers to evenly place the treated seeds in M0 medium, and culture in the dark at 24℃ for 5 days.

[0045] 2. Activation of Agrobacterium: Two days after inoculation, Agrobacterium was cultured on YEP medium supplemented with the appropriate antibiotic at 28°C for 48 hours. A single colony was picked and transferred to 5 ml of YEP medium, and cultured at 28°C with shaking for 36 hours. Subsequently, 1 ml of the bacterial suspension was transferred to 45 ml of YEP medium and cultured at 28°C with shaking for 12 hours. Afterward, the cells were collected by centrifugation at 4000 rpm at 4°C. The Agrobacterium was then resuspended in DM medium and diluted to an OD600 of approximately 0.7.

[0046] 3. Infection and Co-culture: In a clean bench, cut cultured hypocotyls (8-10 mM is recommended), keeping them moist by adding DM medium during cutting. Then, immerse them in the prepared Agrobacterium suspension for 20 minutes, gently stirring with sterile forceps to ensure thorough inoculation. Finally, aspirate the suspension, transfer the hypocotyls to filter paper to remove excess suspension, and place them on M1 medium. Incubate at 24°C in the dark for 36 hours.

[0047] 4. Selection culture: Transfer the hypocotyls from M1 to M2 medium and culture at 24℃ for 16 hours under light for 8 hours in the dark for 12 days.

[0048] 5. Differentiation culture: Remove the brown hypocotyls from M2, transfer the healthy hypocotyls to M3 medium, and culture at 24℃ for 16 hours in light and 8 hours in darkness. Repeat this process every 12 days until germination.

[0049] 6. Rooting culture: After the buds appear, remove the callus tissue from the buds and insert them into M4 medium. Culture at 24℃ for 16 hours under light and 8 hours in the dark until roots are formed.

[0050] The embodiments of the present invention involve the following: a specialized culture medium, antibiotic and hormone formulations, and their preparation.

[0051] Culture medium formulation and preparation method:

[0052] 1. M0 seedling culture medium

[0053] MS 4.405g;

[0054] 7.0g of agar;

[0055] Dissolve the contents gradually, then add distilled water to bring the volume to 1000mL, adjust the pH to 5.8-6.0, dispense 50mL into each seedling box, and sterilize in an autoclave at 121℃ for 20min.

[0056] 2. M1 co-culture medium

[0057]

[0058] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. After bringing the volume to 1000 mL, 2,4-D (1 mg / mL) and KT (1 mg / mL) were added, and the pH was adjusted to 5.8-6.0. The mixture was then placed in an autoclave at 121°C for 20 min to sterilize. After that, AS (100 mM / mL) was added in a clean bench and then dispensed into petri dishes.

[0059] 3. M2 screening medium

[0060]

[0061] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. After bringing the volume to 1000 mL, 2,4-D (1 mg / mL) and KT (1 mg / mL) were added, and the pH was adjusted to 5.8-6.0. The mixture was then placed in an autoclave at 121°C for 20 min to sterilize. After sterilization, TMT (50 mg / mL), Kan (50 mg / mL), and AgNO3 were added in a clean bench and then dispensed into petri dishes.

[0062] 4. M3 differentiation medium

[0063]

[0064] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. The pH was adjusted to 5.8-6.0, and the mixture was placed in an autoclave at 115°C for 15 min to sterilize. After sterilization, TMT (50 mg / mL), ZT (0.5 mg / mL), and IAA (1 mg / mL) were added in a clean bench and then dispensed into petri dishes.

[0065] 5. M4 Rooting Medium

[0066] MS 2.202g;

[0067] 7g of agar;

[0068] Dissolve the contents gradually, then add distilled water to bring the volume to 1000 mL, adjust the pH to 5.8-6.0, dispense 50 mL into each conical flask, and sterilize in an autoclave at 121°C for 20 min.

[0069] 6. DM culture medium

[0070]

[0071]

[0072] The solid powder was dissolved in batches, and then distilled water was added to bring the volume to 1000 mL. After bringing the volume to 1000 mL, 2,4-D (1 mg / mL) and KT (1 mg / mL) were added. The pH was adjusted to 5.8-6.0 and then dispensed into 50 mL portions into each culture flask. The flasks were then placed in an autoclave at 121 °C for 20 min to sterilize.

[0073] 7. YEP medium

[0074]

[0075] Add distilled water to a final volume of 1000 mL, autoclave at 121°C for 20 minutes, then dispense. Note: Liquid YEP medium does not require the addition of agar.

[0076] Antibiotic formulation:

[0077] 1. Kanamycin (Kan, 50mg / ml): Weigh 0.5g of kanamycin powder, add 10ml of deionized water to dissolve it completely, filter it, and dispense it into sterile EP tubes. Store at -20℃.

[0078] 2. Ampicillin (Amp, 50mg / ml): Weigh 0.5g of ampicillin powder, add 10ml of deionized water to dissolve it completely, filter to sterilize, dispense into individual containers, and store at -20℃.

[0079] 3. TMT (200mg / l): Under aseptic conditions, inject 4ml of sterile deionized water into 1.6g of unopened bottled TMT powder using a syringe. After mixing thoroughly, remove the powder, add another 4ml of sterile deionized water, mix thoroughly, dispense directly into sterile EP tubes, and finally store at -20℃.

[0080] 4. Rifampin (30mg / ml): Weigh 0.5g of rifampin powder, add 10ml of DMSO to dissolve it completely, filter to sterilize, and dispense into sterile EP tubes. Store at -20℃.

[0081] 5. Spectinomycin (spec, 50mg / ml): Weigh 0.5g of kanamycin powder, dissolve it thoroughly in 10ml of sterile deionized water, filter to sterilize, and then dispense into sterile EP tubes. Store at -20℃.

[0082] Hormone formulation:

[0083] 1. Acetyleugenone (As, 100mM / mL): Weigh 0.196g of acetyleugenone powder, add 10mL of DMSO to dissolve it completely, filter to sterilize, dispense into sterile EP tubes, and finally store in a -20℃ refrigerator.

[0084] 2. Plant growth regulator (2,4-D, 1 mg / mL): Weigh 100 mg of 2,4-D, add 1 mL of 1 N KOH and shake for 5 min. Then add 10 mL of sterile deionized water and shake until 2,4-D is fully dissolved. Finally, bring the volume to 100 mL with sterile deionized water and store at 4°C.

[0085] 3. Kinetin (KT, 1 mg / mL): Weigh 100 mg of KT dry powder, then add 1 mL of 1 N KOH and shake until KT is completely dissolved. Then add ddH2O to make up to 100 mL and store at 4 °C.

[0086] 4. Naphthaleneacetic acid (NAA, 1 mg / ml): Weigh 100 mg of NAA, add 1 mL of 1N KOH and shake until NAA is completely dissolved. Then add sterile deionized water to make up to 100 mL and store in a refrigerator at 4°C protected from light.

[0087] 5. Zeatin (ZT, 0.5 mg / mL): Under aseptic conditions, add 95% ethanol to each tube containing 5 mg of zeatin and dissolve completely. Then add sterile deionized water to bring the volume to 10 mL. Filter to remove bacteria and store at -20°C.

[0088] 6. Indoleacetic acid (IAA, 1 mg / mL): Weigh 100 mg of IAA dry powder and dissolve it in 5 ml of anhydrous ethanol. Add sterile deionized water to bring the volume to 100 mL, then filter to sterilize and finally store in a -20°C refrigerator.

[0089] Example 4: Inoculation and identification of transgenic material *Sclerotinia sclerotiorum*

[0090] 1. Inoculation of detached leaves with *Sclerotinia sclerotiorum*: Place *Sclerotinia sclerotiorum* mycelial blocks in PDA plates for incubation and activation. When the mycelium is about to spread to the edge of the plate, take a 6mm section of newly formed mycelium near the edge of the plate and place it in a new PDA plate for activation. Incubate in the dark at 22℃ for about 40 hours. Clean and sterilize the storage container, place absorbent paper at the bottom of the container for leaf storage and incubation, add an equal amount of sterile water to each container, and seal for later use. Select the second to last fully expanded 6-leaf stage new leaf of rapeseed of the same size, place it in the storage container, and use a cotton ball to retain moisture at the petiole. Take a 6mm section of newly formed mycelium near the edge of the plate, avoiding the main vein, and place it upside down in the same position as the leaf. Spray an equal amount of water evenly to maintain moisture. Incubate in the dark at 22℃. Observe and record the *Sclerotinia sclerotiorum* infection status regularly. Set up 3 biological replicates for each strain.

[0091] 2. DAB staining: Select leaves inoculated for 36 hours with hyphal expansion edges of equal size and place them in 50 mL of 1 mg / mL diaminobenzidine solution. Vacuum the solution, let it stand for 20 minutes, and then incubate it in a 28℃ incubator for 8 hours. Then, immerse the leaves in an acetone:methanol 1:1 solution for decolorization for 8 hours, changing the acetone:methanol mixture 1-2 times during this period. Prepare slides, and finally photograph and record them using a stereomicroscope. The depth of brown color is used as the basis for the content of reactive oxygen species. Three biological replicates are set up for each strain.

[0092] 3. Leaf extract anti-Sclerotinia sclerotiorum experiment: 2g of leaves of the same part and size were ground into powder and mixed with 30mL of extraction solution. The extraction solution formula (per 1L) was as follows: MES (195.24g / mol) 10.65g; Tris (121.14g / mol) 12.14g; EDTA (372.24g / mol) 0.03g; NaCl (58.44g / mol) 1.74g. The mixture was centrifuged at 4500rpm for 30min at room temperature. The supernatant was collected and sterilized using a bacterial filter membrane, then added to PDA medium at a 1:1 ratio for storage. A 6mm block of newly formed hyphae was punched along the edge of the hyphae and placed hyphae-side down in the center of the PDA medium. The area of ​​hyphal expansion was used as the basis for anti-Sclerotinia sclerotiorum activity.

Claims

1. The application of the BnELP2 gene, an elongation factor complex, in improving resistance to sclerotinia stem rot in rapeseed, characterized by: Overexpression of BnELP2 in rapeseed significantly enhances its resistance to Sclerotinia sclerotiorum, and the nucleotide sequence of the rapeseed gene is shown in SEQ ID NO:1.

Citation Information

Patent Citations

  • Elongation factor BnELP4 gene for regulating and controlling cabbage type rape sclerotinia sclerotiorum resistance and application thereof

    CN110564762A