Application of miRNAs from insect vectors in inhibiting rice stripe virus infection
By overexpressing miR-263a derived from the small brown planthopper in rice, the problem of rice stripe virus transmission was solved, the virus proliferation and incidence were significantly reduced, the disease resistance of rice was enhanced, and the application of insect salivary gland miRNA in plant virus regulation was expanded.
Patent Information
- Application Number
- CN202410157230.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-02-04
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2044-02-04
AI Technical Summary
Existing technologies lack effective methods to block the transmission of rice stripe virus to rice plants through small brown planthoppers, and the regulatory mechanism of miRNA in insect saliva in plants is still unclear, resulting in insufficient resistance of rice to the virus.
By overexpressing miR-263a derived from the small brown planthopper in rice and taking advantage of its mature form of 24nt, a corresponding overexpression vector was constructed and introduced into rice plants to enhance the plant's resistance to rice stripe virus.
It significantly reduced the proliferation and incidence of rice stripe virus, improved rice's resistance to the virus, enriched the theoretical research on insect-mediated virus transmission, and provided potential control targets for virus prevention and control.
Smart Images

Figure CN117802104B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and particularly relates to the application of miRNA derived from insect vectors in inhibiting rice stripe virus infection. Background Art
[0002] Plant viruses cause damage to agricultural and cash crops, with approximately 80% of these viruses being transmitted by insects (Hohn, 2007). The prevention and control of insect-borne viral diseases is complex, requiring control of the proliferation and spread of viruses in plants and insects. Currently available commercial agents are mostly insecticides targeting insect vectors or immune inducers targeting crops, with no effective specific treatments for viruses. In response to the need for green ecological development, blocking the spread of viruses at the source of insect vectors has become a crucial requirement for ensuring stable yields of grain and cash crops.
[0003] RSV is spread in rice fields by gray leafhoppers. The virus enters the insect body through gray leafhoppers feeding on infected rice, infects the insect-borne intestinal cavity, then passes through the intestinal wall to enter the hemolymph, and then circulates and is transported to other tissues such as the brain, salivary glands, testes and ovaries (Toriyama, S. (1986) Rice stripe virus: prototype of a new group of viruses that replicate in plants and insects. Microbiol Sci, 3, 347-51.). When the infected gray leafhoppers feed on healthy rice, the virus can be horizontally transmitted to new rice plants along with the saliva secreted by the insects, achieving a new round of infection. Salivary glands, as a bridge connecting insects and plants, play a key role in the horizontal transmission of the virus. Key effector factors therein, such as salivary proteins or small RNAs, can participate in regulating the spread and infection of the virus.
[0004] RNA interference (RNAi) is an innate antiviral immune mechanism in insects (Ding, S. W. and Voinnet, O. (2007) Antiviral immunity directed by small RNAs. Cell, 130, 413-26., Carthew, R. W. and Sontheimer, E. J. (2009) Origins and Mechanisms of miRNAs and siRNAs. Cell, 136, 642-55.). Previous studies have found that miRNAs and small interfering RNAs from insects can regulate viral proliferation in insects (Kutter, C. and Svoboda, P. (2008) miRNA, siRNA, piRNA: Knowns of the unknown. RNA Biol, 5, 181-8.). Studies have also found that insect-derived small RNAs can be detected in the salivary glands or secreted saliva of mosquitoes and ticks that can transmit a variety of human pathogens, indicating that small RNAs may be secreted into human hosts through the salivary glands (Arca, B., Colantoni, A., Fiorillo, C., Severini, F., Benes, V., Di Luca, M., et al. (2019) MicroRNAs from saliva ofanopheline mosquitoes mimic human endogenous miRNAs and may contribute to vector-host-pathogen interactions. Sci Rep, 9, 2955.; Malik, MI, Nawaz, M., Hassan, IA, Zhang, H., Gong, H., Cao, J., et al. (2019) A microRNA profile of saliva and role of miR-375 in Haemaphysalis longicornis (Ixodida: Ixodidae). Parasit Vectors, 12, 68.). However, it is still unclear whether insect vector salivary small RNAs can enter plants and regulate plant resistance to viruses. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to overexpress a mature 24-nt insect-derived miRNA in rice plants. The technical problem to be solved is not limited to the technical subject matter described herein, and those skilled in the art will clearly understand other technical subjects not mentioned herein through the following description.
[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:
[0007] The present invention provides applications of miRNA or substances that regulate miRNA expression, wherein the applications are any of the following:
[0008] H1) Use of miRNA or a substance regulating miRNA expression in regulating plant resistance to rice stripe virus;
[0009] H2) Use of miRNA or a substance that regulates miRNA expression in the preparation of a product for regulating plant resistance to rice stripe virus;
[0010] H3) Application of miRNA or substances regulating miRNA expression in plant breeding;
[0011] The miRNA is the following miRNA A1) and A2):
[0012] A1) a single-stranded RNA molecule having a nucleotide sequence of SEQ ID No. 1;
[0013] A2) A miRNA obtained by substituting and / or deleting and / or adding nucleotides to the nucleotide sequence shown in SEQ ID No. 1, which has more than 90% identity with the RNA molecule shown in A1) and is related to plant resistance to rice stripe virus.
[0014] The above-mentioned miRNA can be artificially synthesized, or the DNA encoding its precursor can be synthesized first and then expressed biologically.
[0015] As used herein, identity refers to the identity of an amino acid sequence or a nucleotide sequence. The identity of an amino acid sequence can be determined using a homology search site on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values), respectively, and performing a search to calculate the identity of the amino acid sequence, the value (%) of identity can then be obtained.
[0016] Herein, the 90% or greater identity may be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.
[0017] The above-mentioned regulation may be upregulating, enhancing or increasing the expression of the gene encoding the miRNA or the content or activity of the miRNA in the plant, or downregulating, inhibiting or reducing the expression of the gene encoding the miRNA or the content or activity of the miRNA in the plant.
[0018] The aforementioned regulation of the plant's resistance to rice stripe virus may be upregulation, enhancement or improvement of the plant's resistance to rice stripe virus, or downregulation, inhibition or reduction of the plant's resistance to rice stripe virus.
[0019] The plant breeding can be to cultivate plants with up-regulated, enhanced or improved resistance to rice stripe virus, or to cultivate plants with down-regulated, inhibited or reduced resistance to rice stripe virus.
[0020] Furthermore, in the above application, regulating the resistance of the plant to rice stripe virus is to improve the resistance of the plant to rice stripe virus.
[0021] Furthermore, in the above application, the substance is a substance that promotes the expression of the miRNA in plants.
[0022] Furthermore, in the above application, the substance is any of the following:
[0023] B1) a nucleic acid molecule that produces the aforementioned miRNA or a nucleic acid molecule that produces a precursor of the aforementioned miRNA;
[0024] B2), an expression cassette containing the nucleic acid molecule described in B1);
[0025] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);
[0026] B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3);
[0027] B5), a transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);
[0028] B6), transgenic plant tissue containing the nucleic acid molecule described in B1), or transgenic plant tissue containing the expression cassette described in B2);
[0029] B7) A transgenic plant organ containing the nucleic acid molecule described in B1) or a transgenic plant organ containing the expression cassette described in B2).
[0030] B1) The nucleic acid molecule is a DNA molecule, which can be transcribed into a precursor of the miRNA and then processed to form the miRNA.
[0031] Furthermore, in the above application, the nucleic acid molecule in B1) is a DNA molecule having a nucleotide sequence of SEQ ID No. 2.
[0032] In the above-mentioned biological materials, the expression cassette containing the nucleic acid molecule described in B2) refers to a DNA molecule capable of expressing the miRNA precursor encoding the above-mentioned application in a host cell. The DNA may include not only a promoter for initiating the expression of the encoding gene, but also a terminator for terminating the expression of the encoding gene. Furthermore, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue-, organ- and development-specific promoters, and inducible promoters. Examples of promoters include, but are not limited to, the constitutive promoter 35S of cauliflower mosaic virus; a wound-inducible promoter from tomato, leucine aminopeptidase ("LAP", Chao et al. (1999) Plant Physiology 120:979-992); a chemically inducible promoter from tobacco, pathogenesis-related 1 (PR1) (induced by salicylic acid and BTH (benzothiadiazole-7-thiocarboxylic acid S-methyl ester)); a tomato proteinase inhibitor II promoter (PIN2) or LAP promoter (both inducible by methyl jasmonate); a heat shock promoter (U.S. Pat. No. 5,187,267); a tetracycline-inducible promoter (U.S. Pat. No. 5,057,422); seed-specific promoters, such as the millet seed-specific promoter pF128 (CN101063139B (Chinese Patent No. 200710099169.7)), and promoters specific for seed storage proteins (e.g., the promoters for phaseolin, napin, oleosin, and soybean beta-conglycin (Beachy et al. (1985) EMBO J. 4:3047-3053)). They can be used alone or in combination with other plant promoters.All references cited herein are incorporated in their entirety. Suitable transcription terminators include, but are not limited to, the Agrobacterium nopaline synthase terminator (NOS terminator), the cauliflower mosaic virus CaMV 35S terminator, the tml terminator, the pea rbcS E9 terminator, and the nopaline and octopine synthase terminators (see, e.g., Odell et al. (1985) Nature 313:810; Rosenberg et al. (1987) Gene, 56:125; Guerineau et al. (1991) Mol. Gen. Genet, 262:141; Proudfoot (1991) Cell, 64:671; Sanfacon et al. Genes Dev., 5:141; Mogen et al. (1990) Plant Cell, 2:1261; Munroe et al. (1990) Gene, 91:151; Ballad et al. (1989) Nucleic Acids Res. 17:7891; Joshi et al. (1987) Nucleic Acid Res., 15:9627).
[0033] Available existing plant expression vector construction contains the recombinant expression vector of described encoding gene expression cassette.Described plant expression vector comprises binary agrobacterium vector and the carrier etc. that can be used for plant microprojectile bombardment.Such as pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA company) etc.Described plant expression vector can also comprise the 3 ' end non-translated region of foreign gene, promptly comprise polyadenylic acid signal and any other DNA fragment that participates in mRNA processing or gene expression.Described polyadenylic acid signal can guide polyadenylic acid to join the 3 ' end of mRNA precursor, and the non-translated region of transcribed as agrobacterium crown gall induction (Ti) plasmid gene (such as nopaline synthase gene Nos) and plant gene (such as soybean storage protein gene) 3 ' end all has similar function. When using gene construction plant expression vector of the present invention, also can use enhancer, comprise translation enhancer or transcription enhancer, these enhancer regions can be ATG start codon or adjacent region start codon etc., but must be identical with the reading frame of coding sequence, to ensure the correct translation of whole sequence.The source of described translation control signal and start codon is extensive, can be natural, also can be synthetic.The translation initiation region can be from transcription initiation region or structural gene. To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be modified to include genes encoding enzymes or luminescent compounds that can be expressed in plants (such as the GUS gene, luciferase gene), antibiotic marker genes (such as the nptII gene, which confers resistance to kanamycin and related antibiotics; the bar gene, which confers resistance to the herbicide phosphinothricin; the hph gene, which confers resistance to the antibiotic hygromycin; the dhfr gene, which confers resistance to methatrexate; and the EPSPS gene, which confers resistance to glyphosate), chemical resistance marker genes (such as herbicide resistance genes), and mannose-6-phosphate isomerase genes, which provide the ability to metabolize mannose. For the safety of transgenic plants, it is possible to omit any selectable marker genes and directly screen transformed plants using stress.
[0034] In the above-mentioned biological materials, the recombinant microorganisms can specifically be yeast, bacteria, algae and fungi.
[0035] Furthermore, in the above application, the plant is any one of the following:
[0036] G1) Monocotyledonous or dicotyledonous plants;
[0037] G2) Graminales;
[0038] G3) Grasses;
[0039] G4) Oryza;
[0040] G5) Rice.
[0041] The present invention provides a method for improving a plant's resistance to rice stripe virus, comprising increasing the expression level of the aforementioned miRNA gene or / and the gene expression level of the miRNA precursor or / and the content of the miRNA or / and the content of the miRNA precursor in a target plant, so as to improve the plant's resistance to rice stripe virus.
[0042] The present invention provides a method for cultivating plants with improved resistance to rice stripe virus, comprising increasing the expression level of the aforementioned miRNA gene or / and the gene expression level of the miRNA precursor or / and the content of the miRNA or / and the content of the miRNA precursor in the target plant, to obtain a plant with improved resistance to rice stripe virus; the plant with improved resistance to rice stripe virus has higher resistance to rice stripe virus than the target plant.
[0043] Furthermore, in the above method, increasing the content of the aforementioned miRNA or / and the content of the miRNA precursor or / and the miRNA gene expression level or / and the gene expression level of the miRNA precursor in the target plant is achieved by introducing the aforementioned nucleic acid molecule into the target plant.
[0044] The miRNA precursor encoding gene can be introduced into plant cells by conventional biotechnology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).
[0045] In the above methods, the transgenic plants are understood to include not only first- and second-generation transgenic plants, but also their progeny. Transgenic plants can be propagated within their species or transferred into other varieties of the same species, particularly commercial varieties, using conventional breeding techniques. Transgenic plants include seeds, callus, whole plants, and cells.
[0046] The aforementioned miRNA or substance also falls within the protection scope of the present invention.
[0047] The present application not only provides a method for expressing exogenous miRNA in rice, but also provides a method for obtaining plants resistant to pathogens, the method comprising: constructing a plant overexpression vector of miR-263a, increasing the transcription level of miR-263a in the plant, and thus increasing the expression level of miR-263a.
[0048] The present invention takes rice-small gray planthopper-RSV as the research object, and studies the molecular mechanism by which miRNA in the salivary glands of small gray planthoppers inhibits the proliferation of the virus in rice. The results showed that a miRNA derived from small gray planthoppers, miR-263a, can be transmitted to rice plants along with saliva during the process of small gray planthoppers taking rice, thereby inhibiting the proliferation of RSV in rice. The mature body of miR-263a is 24nt in length, while the existing commercial rice overexpression vector can only express miRNA with a mature body of 21nt and is not suitable for overexpression of miR-263a. Therefore, a miR-263a overexpression vector and the corresponding gene-edited rice were prepared. The study found that the gene-edited rice significantly reduced the proliferation of RSV and also significantly reduced the incidence of RSV in rice. It can be seen that overexpression of miR-263a has good application potential in plant disease resistance. The results of this invention will deepen researchers' understanding of the mechanism by which insect salivary gland functional miRNA regulates the proliferation and spread of plant viruses, enrich theoretical research on insect-mediated virus transmission, and provide potential control targets for the prevention and control of RSV. BRIEF DESCRIPTION OF THE DRAWINGS
[0049] Figure 1 Schematic diagram of the miR-263a plant overexpression vector backbone. Legend: Green represents the mature sequence of rice miR-1876 (the resulting mature form is 24 nt) and its complementary sequence (osa-miR-1876*); red represents the mature sequence of miR-263a and its antisense strand (miR-263a*).
[0050] Figure 2 Rice protoplasts overexpressing miR-263a; (A) Microscopic examination of rice protoplast activity. (B) Quantitative analysis of miR-263a expression and viral NP expression in rice protoplasts before and after transfection with the overexpression vector. Data are presented as mean ± standard error. Statistical significance was determined using a t-test. "*" indicates a significant difference at p < 0.05; "**" indicates an extremely significant difference at p < 0.01.
[0051] Figure 3Overexpression of miR-263a in rice inhibits viral accumulation. (A) Quantitative PCR analysis of miR-263a levels in overexpressing rice lines. (B) Northern blotting analysis of mature and precursor forms of miR-263a in overexpressing rice lines. (C) Quantitative PCR analysis of RSV NP expression after infection. Data are presented as mean ± standard error. One-way ANOVA was used to determine statistical significance; different letters indicate significant differences (p < 0.05). DETAILED DESCRIPTION
[0052] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0053] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0054] Rice stripe virus (RSV) and infected SBPH are described in the non-patent literature "Zhao, W., Yang, P., Kang, L. and Cui, F. (2016) Different pathogenicities of Rice stripe virus from the insect vector and from viruliferous plants. New Phytologist, 210, 196-207." RSV-infected rice and SBPH were obtained from the Insect Vector and Viral Genomics Group, Institute of Zoology, Chinese Academy of Sciences. The sequences of the four RNA strands of the viral genome have been uploaded to NCBI (accession numbers MF287953–MF287956).
[0055] Example 1. Construction of miR-263a overexpression vector
[0056] Based on Northern blotting, qPCR, and Sanger sequencing, the inventors demonstrated that miR-263a originates from the small brown planthopper (Lagerstroemia striatum). Its full-length sequence is 5'-AAUGGCACUGGAAGAAUUCACGGG-3' (corresponding to SEQ ID No. 1: 5'-AATGGCACTGGAAGAATTCACGGG-3'), with a length of 24 nucleotides (nt). Plant miRNAs range in length from 20 to 24 nt, with a majority concentrated in the 20-22 nt range. Currently, overexpression of miRNAs in rice is widely used commercially. However, the backbone of the overexpression vector is designed based on the rice miR-528 precursor sequence and can only produce a mature miRNA of 21 nt. It is not suitable for overexpressing miRNAs of other lengths, and therefore, was not suitable for overexpressing miR-263a in this study. Therefore, based on literature research and preliminary experiments, the inventors selected miR-1876, which is highly abundant in rice and has a mature form of 24 nt, as an experimental target, hoping to use its pre-precursor sequence (primary miRNA, pri-miRNA) as a backbone to express insect-derived miR-263a. The specific steps are as follows:
[0057] First, we cloned the partial pri-miRNA cDNA gene sequence of miR-1876 from the rice transcript. The length is 490bp and the sequence is as follows:
[0058] Partial pri-miRNA of miR-1876
[0059] CCCACAGUCUCAUAUUAAGGGGGCAGAAUAUACAGACGUUUCUUCAAUUUUAGUGUUAUUAUUCUCCACAUGUCAUAAUUUUAAAGAUAGCCAAGCCAAGUUCUGAAGUCAAGAAGGUUUAGUAAGAUUUUGUUUAGCAGGGAUUUGGAAGGCACAUAUGUUGGUAUUCUAUUGGAAUGCAAGU GGGCUGGCUUUUGAACCCAUUUAU GGGCUAUUCAAGUGGGUAAACCAUAGGUUGGUGCACUUAAAUGGCCU AUAAGUGGGUUUGUGGGCUGGCCCUCUUGUAUCCUGAUAGUUUAGUAUGAUUGGUAAUAAUAGCAAUGCUACUUUUAAAUUUAAGGUUUGUUAUGGACUAGUGAUAACUGUUAUGGGAUCGAGUACCAGUGGCACAAGAAACUACUGGCUAGUCUCGUAGCUUGCUAGGUACUCCCUCUGUCCCAAAAUAAACAAAGCUAGUACGGGGAUGUGGCACUUCCUAGUCCUGUACUAG
[0060] cDNA gene sequence of partial pri - miR - 1876
[0061] 5’-CCCACAGTCTCATATTAAGGGGGCAGAATATACAGACGTTTCTTCAATTTTAGTGTTATTATTCTCCACATGTCATAATTTTAAAGATAGCCAAGCCAAGTTCTGAAGTCAAGAAGGTTTAGTAAGATTTTGTTTAGCAGGGATTTGGAAGGCACATATGTTGGTATTCTATTGGAATGCAAGT GGGCTGGCTTTTGAACCCATTTAT GGGCTATTCAAGTGGGTAAACCATAGGTTGGTGCACTTAAATGGCCT ATAAGTGGGTTTGTGGGCTGGCCC TCTTGTATCCTGATAGTTTAGTATGATTGGTAATAATAGCAATGCTACTTTTAAATTTAAGGTTTGTTATGGACTAGTGATAACTGTTATGGGATCGAGTACCAGTGGCACAAGAAACTACTGGCTAGTCTCGTAGCTTGCTAGGTACTCCCTCTGTCCCAAAATAAACAAAGCTAGTACGGGGATGTGGCACTTCCTAGTCCTGTACTAG - 3’
[0062] The underlined sequence in the downstream sequence is the mature gene sequence of miR-1876: 5'-ATAAGTGGGTTTGTGGGCTGGCCC-3', and the underlined sequence in the upstream sequence is the antisense sequence of the mature miR-1876 (miR-1876*): 5'-GGGCTGGCTTTTGAACCCATTTAT-3'. The mature and antisense sequences of miR-1876 in the cloned partial pri-miRNA of miR-1876 were replaced with the mature and antisense sequences of miR-263a (miR-263a*), respectively, to obtain the pri-miRNA of miR-263a in rice (corresponding to SEQ ID No. 2), which was used in subsequent transfection operations. The schematic diagram of the skeleton construction of the miR-263a plant overexpression vector is shown in the figure below. Figure 1 .
[0063] miR-263a pri-miRNA in rice
[0064] CCCACAGUCUCAUAUUAAGGGGGCAGAAUAUACAGACGUUUCUUCAAUUUUAGUGUUAUUAUUCUCCACAUGUCAUAAUUUUAAAGAUAGCCAAGCCAAGUUCUGAAGUCAAGAAGGUUUAGUAAGAUUUUGUUUAGCAGGGAUUUGGAAGGCACAUAUGUUGGUAUUCUAUUGGAAUGCAAGU CCCGUGGUCUUUCGGUGUCGUA GGGCUAUUCAAGUGGGUAAACCAUAGGUUGGUGCACUUAAAUGGCCU AAUGGCACUGGAAGAAUUCACGGG UCUUGUAUCCUGAUAGUUUAGUAUGAUUGGUAAUAAUAGCAAUGCUACUUUUAAAUUUAAGGUUGUUAUGGACUAGUGAUAACUGUUAUGGGAUCGAGUACCAGUGGCACAAGAAACUACUGGCUAGUCUCGUAGCUUGCUAGGUACUCCCCUCUGUCCCAAAAUAAACAAAGCUAGUACGGGGAUGUGGCACUUCCUAGUCCUGUACUAG
[0065] SEQ ID No.2:
[0066] 5'-CCCACAGTCTCATATTAAGGGGGCAGAATATACAGACGTTTCTTCAATTTTAGTGTTATTATTCTCCACATGTCATAATTTTAAAGATAGCCAAGCCAAGTTCTGAAGTCAAGAAGGTTTAGTAAGATTTTGTTTAGCAGGGATTTGGAAGGCACATATGTTGGTATTCTATTGGAATGCAAGT CCCGTGGTCTTTCGGTGTCGTA GGGCTATTCAAGTGGGTAAACCATAGGTTGGTGCACTTAAATGGCCT AATGGCACTGGAAGAATTCACGGG TCTTGTATCCTGATAGTTTAGTATGATTGGTAATAATAGCAATGCTACTTTAAATTTAAGGTTTTGTTATGGACTAGTGATAACTGTTATGGGATCGAGTACCAGTGGCACAAGAAACTACTGGCTAGTCTCGTAGCTTGCTAGGTACTCCCTCTGTCCCAAAATAAACAAAGCTAGTACGGGGATGTGGCACTTCCTAGTCCTGTACTAG-3'.
[0067] The underlined sequence at the downstream is the mature miR-263a gene sequence: 5'-AATGGCACTGGAAGAATTCACGGG-3', and the underlined sequence at the upstream is the antisense strand sequence of the mature miR-263a (miR-263a*): 5'-CCCGTGGTCTTTCGGTGTCGTA-3'. The constructed miR-263a pri-miRNA sequence in rice (SEQ ID No. 2) was inserted into the plant expression vector pBI221 (purchased from Wuhan Miaoling Biotechnology Co., Ltd., catalog number P6700) between the BamHI and SmaI restriction enzyme recognition sites, while keeping the other nucleotide sequences of pBI221 unchanged to obtain the recombinant expression vector pBI221-OE263a.
[0068] Transform Escherichia coli DH5α with pBI221-OE263a. Take 1 mL of the bacterial suspension and add it to 100 mL of ampicillin-resistant LB liquid medium. Incubate the cells in a shaker at 37°C at 200 rpm overnight. Use the Endotoxin-Free Plasmid Extraction Kit (DP117, TIANGEN BIOTECH, Beijing, China) to extract the endotoxin-free expression plasmid in bulk and store it at -20°C until use. The specific steps are as follows:
[0069] (1) Column equilibration step: Add 2.5 mL of BL equilibration solution to the adsorption column, centrifuge at 8000 rpm for 2 minutes, discard the waste liquid, and return the adsorption column to the collection tube.
[0070] (2) Take 100 mL of bacterial solution and add it to a centrifuge tube. Centrifuge at 8000 rpm for 3 minutes at room temperature to collect the bacteria and remove the supernatant.
[0071] (3) Add 8 mL of P1 solution to the centrifuge tube and vortex to thoroughly suspend the bacterial cell pellet.
[0072] (4) Add 8 mL of P2 solution to the centrifuge tube and immediately and gently invert it upside down 8 times to fully lyse the bacteria. Let it stand at room temperature for 5 minutes.
[0073] (5) Add 8 mL of P4 solution to the centrifuge tube and immediately and gently invert the tube eight times to mix thoroughly until a white, dispersed flocculent precipitate appears. Then, let it sit at room temperature for about 10 minutes. Centrifuge at 8000 rpm for 30 minutes to allow the white precipitate to settle to the bottom of the tube. Carefully pour the entire solution into the filter CS1 and slowly push the handle to filter. Collect the filtrate in a clean 50 mL tube.
[0074] (6) Add 0.3 times the volume of isopropanol to the filtrate, mix thoroughly by inverting, and transfer to adsorption column CP6.
[0075] (7) Centrifuge at 8000 rpm for 2 minutes at room temperature, discard the waste liquid in the collection tube, and put the adsorption column CP6 back into the collection tube.
[0076] (8) Add 10 mL of PW rinse solution to the adsorption column CP6, centrifuge at 8000 rpm for 2 minutes, discard the waste liquid in the collection tube, and return the adsorption column to the collection tube.
[0077] (9) Repeat step 8.
[0078] (10) Add 3 mL of anhydrous ethanol to the adsorption column CP6, centrifuge at 8000 rpm for 2 min at room temperature, and discard the waste liquid.
[0079] (11) Place the adsorption column CP6 back into the collection tube and centrifuge at 8000 rpm for 5 minutes to remove the remaining rinse solution in the adsorption column.
[0080] (12) Place the adsorption column CP6 in a clean 50 mL collection tube. Add 600 μL of ddH2O dropwise to the center of the adsorption membrane. Allow to stand at room temperature for 5 minutes. Centrifuge at 8000 rpm for 2 minutes. Transfer the eluate from the 50 mL centrifuge tube to a clean 1.5 mL centrifuge tube and store at -20°C.
[0081] Example 2. Preparation of miR-263a overexpressing rice protoplasts
[0082] 1. Preparation of Rice Protoplasts
[0083] Healthy Wuyujing rice seedlings that were not inoculated with the virus were collected and rice protoplasts were prepared using a rice protoplast preparation and transformation kit (PPT111-10T, Coolaber Bio, Beijing, China) as follows:
[0084] 1. Prepare 7-day-old, non-toxic rice seedlings. Use a sharp blade to remove the roots and leaf tips, preserving as much of the meristem at the base as possible. Cut 5-10 seedlings at a time and cut the leaves perpendicular to the main vein into 0.5-1.0 mm segments.
[0085] 2. Place the cut rice pieces into a small beaker containing 20 mL of freshly prepared enzyme solution, wrap with tin foil, leave a hole in the beaker, and evacuate for 30 minutes (15Hg / 50kPa / 0.5). The enzyme solution contains 16 mL of Solution I, 0.3 g of Cellulose R10, 0.15 g of Macerozyme R10, 200 μL of 10% BSA, 7.14 μL of β-mercaptoethanol, and 10 μL of Amp (100 mg / mL).
[0086] 3. Shake on a shaker at 40-50 rpm for 4 hours in the dark. Before collecting the protoplasts, gently shake the beaker to completely release the cells.
[0087] 4. Rinse the cell sieve with 1 mL of pre-cooled solution II-W5 solution and discard the waste liquid.
[0088] 5. Filter the enzymatic hydrolysis product through a cell sieve. A thick green liquid will be visible dripping. Rinse the enzymatic hydrolysis vessel and undigested leaves 2-3 times with 10 mL of pre-cooled solution II-W5 solution. Collect all the liquid into a 50 mL centrifuge tube.
[0089] 6. Use a horizontal rotor, centrifuge at 150g for 5 minutes, and remove the supernatant (the green precipitate in the tube is the protoplast).
[0090] 7. Gently resuspend the protoplasts at the bottom with 10 mL of pre-cooled solution II-W5 solution, gently resuspend and mix, centrifuge at 150 g for 3 minutes, and remove the supernatant.
[0091] 8. Add 1 mL of pre-cooled solution II-W5 solution to resuspend the protoplasts and place on ice in the dark for 30 minutes.
[0092] 9. Before centrifugation, the state of the protoplasts can be observed under a microscope and counted on a hemocytometer.
[0093] 2. Transformation and Infection of Rice Protoplasts
[0094] The recombinant expression vector pBI221-OE263a was transformed into rice protoplasts using a rice protoplast preparation and transformation kit (PPT111-10T, CoolaberBio, Beijing, China) as follows:
[0095] 1. Based on the conditions explored in the early stage, use PBS buffer to extract RSV virus crude extract from RSV-infected rice seedlings. The specific operation method is as follows:
[0096] (1) Collect 100 laboratory-reared virus-infected Laodelphax striatellus (fourth-instar larvae), place them in a 1.5 mL RNase-free EP tube, add 100 μL PBS buffer (pH 7.2), grind thoroughly, and let stand on ice for 5 minutes.
[0097] (2) Centrifuge at 12000 rpm and 4°C for 15 minutes, and transfer the supernatant to a clean EP tube.
[0098] (3) Repeat the centrifugation 4-5 times until the supernatant becomes clear and free of impurities, thereby obtaining a crude RSV virus extract.
[0099] 2. ELISA quantitative RSV crude extract
[0100] (1) Prepare NP standards in PBS buffer (pH 7.2). Prepare nine dilution concentrations (0, 0.0045, 0.045, 0.45, 4.5, 12.5, 25, 45, and 90 ng / ml).
[0101] (2) RSV original extract was used as the sample. 100 μl of standard and sample were added to each well of a 96-well ELISA plate, mixed with 100 μl of 1x ELISA coating buffer (Solarbio, catalog number: C1050), and incubated at 4°C overnight.
[0102] (3) Each well was washed three times with 200 μL PBST, each time for at least 3 minutes.
[0103] (4) Add 200 μl of blocking solution (PBST buffer containing 5% skim milk powder) to each well and incubate at room temperature for at least 30 minutes.
[0104] (5) Repeat step (3) to wash.
[0105] (6) Add 100 μL of laboratory-prepared monoclonal anti-NP antibody dilution (1:2000 dilution in blocking buffer) to each well and incubate at room temperature for 1.5 hours.
[0106] (7) Repeat step (3) to wash.
[0107] (8) Add 100 μL of diluted goat anti-mouse IgG, HRP-conjugated antibody (Thermo Fisher Scientific, Invitrogen™, catalog number: 32430) (1:5000 dilution in blocking buffer) to each well and incubate at room temperature for 1.5 hours.
[0108] (9) Remove the supernatant and wash the plate five times with PBST for 1 minute each time.
[0109] (10) Add 100 μL of TMB solution (Sigma-Aldrich, catalog number: T0440) to each well.
[0110] (11) Gently shake the mixture using a Decolorizing Orbital Shaker at room temperature for 30 minutes.
[0111] NOTE: The reaction should be protected from light.
[0112] (12) Add 100 μL of 2M H2SO4 or 1% SDS to stop the reaction.
[0113] NOTE: Ensure that the color in all wells has changed from blue to yellow.
[0114] (13) The optical density (OD) at a wavelength of 450 nm was read within 5 minutes on a multi-mode detection platform. The final concentration of NP was adjusted to 1 μg / mL and sterilized by filtration using a 0.45 μm filter membrane to obtain a sterile RSV crude extract.
[0115] 3. In a 2 ml round-bottom centrifuge tube, add 100 μL of the protoplasts obtained in step 1, 10 μL (10-20 μg) of the purified and endotoxin-free recombinant expression vector pBI221-OE263a, and 10 μL of filter-sterilized RSV crude extract. Then add 120 μL of IV-PEG solution, mix gently, and incubate at 28°C for 30 min.
[0116] 4. Add 1.6 mL of pre-chilled II-W5 solution and mix gently to terminate the transformation. Centrifuge at 150 g for 3 minutes at room temperature and remove as much supernatant as possible.
[0117] 5. Add 2 mL of pre-cooled solution II-W5 solution to suspend the protoplasts, centrifuge at 150 g for 3 min at room temperature, and remove the supernatant to obtain RSV-inoculated rice protoplasts.
[0118] 3. Protoplast Culture and Collection
[0119] 1. Add 1 mL of pre-chilled II-W5 solution to the RSV-inoculated rice protoplasts to suspend the cells. Place the centrifuge tube horizontally at room temperature (avoiding strong light) and incubate for 48 hours.
[0120] 2. When collecting cells, slowly pick up the centrifuge tube and gently suspend the cells attached to the tube wall with the tip of the pipette. Let the centrifuge tube stand vertically at room temperature for a few minutes and then centrifuge it at 150g for 3 minutes to remove most of the solution II-W5solution and collect the protoplasts for subsequent RNA extraction and quantitative experiments.
[0121] Rice protoplasts treated with the same reagents but not inoculated with RSV were used as negative controls.
[0122] 4. qPCR detection of miR-263a and virus content in protoplasts
[0123] RNA from rice protoplasts before and after RSV inoculation was extracted using the Trizol method (Invitrogen, Carlsbad, CA, USA) (Zhao et al., 2016). miRNA cDNA was synthesized using the miRcute Enhanced miRNA cDNA First-Strand Synthesis Kit (Tiangen, Beijing, China). The miR-263a content was then quantified using the miRcute Enhanced miRNA Fluorescence Quantification Detection Kit (Tiangen) (for the detection method, see the non-patent literature “Zhao, W., Yu, J., Jiang, F., Wang, W., Kang, L. and Cui, F. (2021) Coordination between terminal variation of the viral genome and insect microRNAs regulates Rice stripe virus replication in insect vectors. PLoS Pathogens, 17, e1009424.”). The reverse transcriptase activity of the miRcute Enhanced miRNA Fluorescence Quantification Detection Kit (Tiangen) was used to determine the expression of miR-263a. Primer and miR-263a-F in Table 1 are primer pairs for amplifying a fragment of the mature sequence of miR-263a (SEQ ID No. 1). The internal reference gene is OsU6 from rice.
[0124] Rice and viral mRNA cDNAs were synthesized using Promega M-MLV Reverse Transcriptase and random primers. The level of the viral nucleocapsid protein encoding gene NP was detected using Roche SYBR Green Master. The detection method is described in the non-patent literature "Zhao, W., Yang, P., Kang, L. and Cui, F. (2016) Different pathogenicities of rice stripe virus from the insect vector and from viruliferous plants. New Phytologist, 210, 196-207."). The internal reference gene was rice UBQ10 (Table 1).
[0125] Table 1 Primers required for fluorescence quantitative PCR
[0126] Primer name Primer sequence (5'-3') miR-263a-F AATGGCACTGGAAGAATTCACGGG OsU6-F TACAGATAAGATTAGCATGGCCCC OsU6-R GGACCATTTCTCGATTTGTACGTG NP-F GGAACAAATGCCAATGCTATC NP-R TGAGACATTTGGGAATAGCTGA UBQ10-F TGGTCAGTAATCAGCCAGTTTGG UBQ10-R GCACCACAAATACTTGACGAACAG
[0127] Table 2 miRNA fluorescence quantitative PCR reaction
[0128] Reagents volume 2×Mix 10 μL F primer (self-prepared) 0.5μL R primer (provided by the kit) 0.5μL cDNA 2μL (10-100 times dilution) <![CDATA[ddH2O]]> 7μL
[0129] qPCR program: pre-denaturation at 95°C for 15 minutes, denaturation at 94°C for 20 seconds, annealing and extension at 60°C for 34 seconds, 45 cycles. Melting curve analysis: 94°C for 5 seconds, 60°C for 1 minute, 97°C for 15 seconds, and 40°C for 10 seconds.
[0130] Table 3 Conventional gene fluorescence quantitative PCR reaction
[0131] Reagents volume 2×SYBR Mix (Roche) 10 μL F primer 0.5μL R primer 0.5μL cDNA 2μL (diluted 4 times) <![CDATA[ddH2O]]> 7μL
[0132] qPCR protocol: pre-denaturation at 95°C for 15 minutes; denaturation at 95°C for 10 seconds, annealing at 58°C for 20 seconds, and extension at 72°C for 20 seconds, cycled 40 times. Melting curve analysis: 95°C for 5 seconds, 65°C for 1 minute, and 40°C for 10 seconds.
[0133] The results of rice protoplast extraction are as follows Figure 2 As shown in Figure A, the activity of protoplasts was determined by fluorescein diacetate staining (FDA staining method). Figure 2 The right image of A. The quantitative results are as follows Figure 2 As shown in B ( Figure 2 OE263a in the expression vector represents rice protoplasts transfected with pBI221-OE263a. After transfection with this vector, insect-derived miR-263a can be expressed in rice protoplasts. Moreover, after expressing miR-263a, the expression level of viral NP is significantly downregulated compared with the viral level in untransfected rice protoplasts.
[0134] Example 3: Construction of rice plants overexpressing miR-263a (OE263a)
[0135] 1. Preparation of miR-263a overexpressing rice plants
[0136] 1. Insert SEQ ID No. 2 into the pBWA(V)HS plasmid (purchased from Wuhan Boyuan Biotechnology Co., Ltd., catalog number #REC10-I) between the BsaI and Eco31I restriction enzyme recognition sites after the 35S promoter to obtain a ligation product.
[0137] 2. The ligation product in step (1) was transformed into competent E. coli, transformed into kanamycin-resistant plates, cultured at 37°C for 12 hours, and identified by plaque PCR.
[0138] 3. Pick 10 plaques and simultaneously inoculate them into 1.5ml EP tubes and perform PCR analysis. Take 100 μL of the sample for sequencing, and inoculate the remaining 400 μL of the bacterial solution into LB containing 5-10 mL of kanamycin-resistant bacteria. Shake the tubes and wait for sequencing results. Extract the plasmid from the tube corresponding to the correct sequence and designate it as pBWA(V)HS-OE263a. pBWA(V)HS-OE263a is a recombinant expression vector derived by replacing the fragment between the BsaI and Eco31I restriction sites of the pBWA(V)HS plasmid with the miR-1876 precursor gene (SEQ ID No. 2), while maintaining the remaining nucleotide sequences unchanged.
[0139] 4. The recombinant expression vector pBWA(V)HS-OE263a was transformed into Agrobacterium EHA105. The primers in Table 4 were used to identify whether the transformed Agrobacterium EHA105 contained the recombinant expression vector pBWA(V)HS-OE263a. The correctly identified Agrobacterium was then transferred into embryonic callus of Nipponbare rice.
[0140] The specific experimental operations and the required culture medium preparation methods are as follows:
[0141] (1) Rice callus induction: Hulled rice seeds were sterilized with 75% alcohol for 2 minutes and rinsed three times; soaked in 0.15% mercuric chloride (containing 0.1% Tween 20) for 15 minutes and rinsed three times; the sterilized seeds were inoculated into the induction medium and cultured at 32°C under light for 5 to 10 days.
[0142] (2) Agrobacterium activation: Streak on LB medium containing 50 mg / L kanamycin and culture at 28°C.
[0143] (3) Infection: Add activated Agrobacterium to the suspension culture medium, shake and culture at 28°C and 180 rpm for 3 hours, and adjust the bacterial solution concentration to OD600 = 0.1; place the induced callus tissue in the Agrobacterium suspension and infect it for 1.5 minutes; pour out the bacterial solution and use filter paper to absorb the bacterial solution on the callus surface; cover the callus surface with filter paper and blow dry it in a clean bench for 30 minutes; transfer the callus to the co-culture medium and culture it in the dark at 20°C overnight, and continue to culture it in the dark at 25°C for 2 days.
[0144] (4) Cleaning: Transfer the co-cultured callus tissue to an empty container and wash it with sterile distilled water for 7 to 8 times. Wash quickly for the first 3 times and soak for 3 to 5 minutes each time for the next 3 to 4 times. Soak it in sterile distilled water containing 500 mg / L Cn for 30 minutes. Pour away the solution, absorb the moisture on the callus surface with filter paper, cover the callus surface with filter paper, and blow dry it in a clean bench for 1 hour.
[0145] (5) Screening: Place the cleaned callus on screening medium and culture under light at 32°C for 14 days.
[0146] (6) Differentiation: After 14 days of screening, the resistant calli were transferred to differentiation medium and cultured at 28°C (photoperiod: 14 h light / 10 h dark).
[0147] (7) Rooting: When the resistant callus forms 3-4 cm high regenerated seedlings on the differentiation medium, it is transferred to the rooting medium until a complete plant is formed. It is named OE263a rice.
[0148] Induction medium: Add ddH2O to 1 L, adjust the pH to 5.8, and sterilize by autoclaving.
[0149] Table 4 Induction medium formula
[0150] <![CDATA[N 6max Storage Solution (10x)]]> 100mL <![CDATA[N 6min Storage Solution (100x)]]> 10mL <![CDATA[Fe 2+ -EDTA Storage Solution (100x)]]> 10mL Vitamin storage solution (100x) 10mL 2,4-Dichlorophenoxyacetic acid(D-7299,Sigma) 2.5mL Proline 0.6g Casein Enzymatic Hydrolysate(N-4642,Sigma) 0.8g Sucrose 30g Phytagel 3g
[0151] Co-culture medium: Add ddH2O to 250 mL and adjust the pH to 5.6. Autoclave and add 5 mL of 50% glucose and 250 μL of Acetosringone storage solution before use.
[0152] Table 5 Co-culture medium formula
[0153] <![CDATA[N 6max Storage Solution (10x)]]> 12.5mL <![CDATA[N 6min Storage Solution (100x)]]> 1.25mL <![CDATA[Fe 2+ -EDTA Storage Solution (100x)]]> 1.25mL Vitamin storage solution (100x) 2.5mL 2,4-Dichlorophenoxyacetic acid(D-7299,Sigma) 0.625mL Proline 0.15g Casein Enzymatic Hydrolysate(N-4642,Sigma) 0.2g Sucrose 7.5g Agar powder 2g
[0154] Screening medium: Add ddH2O to 250 mL and adjust the pH to 6.0. Autoclave and add 250 μL of 50 mg / mL Hygromycin B solution and 500 μL of 250 mg / mL Carbenicillin.
[0155] Table 6 Screening medium formula
[0156] <![CDATA[N 6max Storage Solution (10x)]]> 25mL <![CDATA[N 6min Storage Solution (100x)]]> 2.5mL <![CDATA[Fe 2+ -EDTA Storage Solution (100x)]]> 2.5mL Vitamin storage solution (100x) 2.5mL 2,4-Dichlorophenoxyacetic acid(D-7299,Sigma) 0.625mL Proline 0.15g Casein Enzymatic Hydrolysate(N-4642,Sigma) 0.2g Sucrose 7.5g Agar powder 2g
[0157] Differentiation medium: Add ddH2O to 250 mL and adjust the pH to 6.0. Autoclave and add 250 μL Hn (50 mg / mL) and 500 μL Cn (250 mg / mL) before use.
[0158] Table 7 Differentiation medium formula
[0159]
[0160]
[0161] Rooting medium: Add ddH2O to 1 L and adjust pH to 5.8. Autoclave.
[0162] Table 8 Rooting medium formula
[0163] <![CDATA[MS max Storage Solution (10x)]]> 50mL <![CDATA[MS min Storage Solution (100x)]]> 5mL <![CDATA[Fe 2+ -EDTA Storage Solution (100x)]]> 5mL Vitamin storage solution (100x) 5mL Sucrose 20g Phytagel 3g
[0164] Table 9 Primers used for PCR bacterial detection
[0165] Primer name Primer sequence (5'-3') HS)35seq,35seq(G) TTCATTTGGAGAGAACACGGGGGAC NOSseq-R,Noseq(G) CAAGACCGGCAACAGGATTCAATC
[0166] 2. Verification of rice lines overexpressing miR-263a
[0167] 1. Molecular identification of the OE263a rice line
[0168] RNA was extracted from the OE263a rice obtained in Step 1. miRNA cDNA was synthesized using the miRcute Enhanced miRNA cDNA First-Strand Synthesis Kit (Tiangen). The miRcute Enhanced miRNA Fluorescence Quantification Detection Kit (Tiangen) was then used to quantify miR-263a levels to determine whether the overexpression vector could successfully express insect-derived miR-263a in rice. A fragment containing SEQ ID No. 1 (24 nt) was amplified using the Reverse Primer provided in the miRcute Enhanced miRNA Fluorescence Quantification Detection Kit (Tiangen) and miR-263a-F listed in Table 1. The internal reference gene was OsU6 from rice.
[0169] For quantification, 6-8 biological replicates were set, and 2 technical replicates were performed for each sample. If the data conformed to a normal distribution, an independent sample t-test was used for statistical analysis. If the data did not conform to a normal distribution, a Wilcoxon rank sum test was used. Multiple comparisons were performed using one-way analysis of variance and Tukey's test. Reference 2 -ΔCT The relative expression of genes was calculated by PCR. The experiment was repeated three times.
[0170] The results are as follows Figure 3 As shown in middle A, two strains of the T2 generation with significantly increased miR-263a expression were screened for subsequent experiments and named OE263a-1 and OE263a-2, respectively.
[0171] 2. RNA was extracted from WT, OE263a-1, and OE263a-2 cells and subjected to Northern blotting. A biotinylated, LNA-modified DNA probe was designed based on the reverse complement of the mature miR-263a sequence. Rice rRNA was used as an internal control.
[0172] The specific steps of Northern blotting are as follows:
[0173] Gel running: Prepare a 15% polyacrylamide gel (4.2 g urea, 3.75 mL 40% acrylamide-methyleneacrylamide solution, 1 mL 10× TBE, 60 μL 10% ammonium persulfate, 4.6 μL TEMED) using 1× TBE as the electrophoresis buffer. Pre-electrophoresis was performed at 200 V for 15 min. Afterwards, the wells were rinsed with electrophoresis buffer and the samples (WT, OE263a-1, and OE263a-2 RNA) were quickly loaded. The gel was run at 180 V for approximately 45 min until bromofinil reached the bottom of the gel. The gel was soaked in 0.5× TBE for approximately 10 min and stained with SYBR Gold (Invitrogen) for 10–20 min. RNA electrophoresis was visualized under UV light and marked on the gel.
[0174] Transfer: Wash the gel with 0.5×TBE for 5 min, transfer the nylon membrane (BrightStar TM Soak a 100-plus positively charged nylon membrane (Thermo Fisher Scientific) and two thick filter papers in transfer buffer (0.5 x TBE) for approximately 10 minutes. Then, transfer to the transfer buffer: Pour the transfer buffer into a tray with the white sheet facing down. Arrange the membrane in the order of white sheet, sponge, filter paper, membrane, gel, filter paper, sponge, and black sheet. Use a roller to tap each layer, tapping any air bubbles. Once assembled, place the membrane in a transfer trough, with the black sheet facing the black side and the white sheet facing the red side. Place the trough in an ice-water mixture and transfer at 300 mA for 1 hour.
[0175] UV crosslinking: energy value 1200, crosslinking 300s. Bake the membrane in an oven or hybridization oven at 80℃ for 30min.
[0176] Prehybridization: Hybridization buffer (Ultrahyb-oligo hybridization buffer, Ambion) was preheated to 37°C. The membrane was placed in a hybridization tube and 5 mL of preheated hybridization buffer was added. Prehybridization was performed for 1 h.
[0177] Hybridization: Preheat the hybridization solution containing the probe (probe concentration: 100 ng / mL) to 37°C, replace the prehybridization solution, and hybridize overnight at 37°C. The miR-263a probe sequence (5'-3'): BIO-CC+CGT+GAA+TTC+TTC+CAG+UGC+CATT-BIO, where "+" indicates LNA modification. Rice total RNA was used as an internal control, and the extraction quality was verified by agarose gel electrophoresis.
[0178] Washing and blocking: Wash twice with 2×SSC+0.1% SDS at 37°C for 30 min; add 10 mL Blocking Buffer for 15 min, and shake slowly on a shaker; add HRP Streptavidin horseradish peroxidase-labeled streptavidin (Yeasen / Yisheng 35105ES60) at a ratio of 1:300 and incubate for 1 h; wash the membrane 4 times with 1×Wash solution; dilute FITC-tyramide working solution (BF06084-500T, Biodragon / Boaolong, biotinylation tyramide kit) with diluent at a ratio of 1:50-1:200, and incubate at room temperature in the dark for 20 min; wash the membrane 4 times with 1×Wash solution.
[0179] Color development: ECL luminescent solution (Thermo, A38556), solution A and solution B were mixed in a ratio of 1:1, 400 μL was added to each membrane, and imaging was performed using a gel imaging device.
[0180] The results are as follows Figure 3 As shown in B, both OE263a-1 and OE263a-2 express insect-derived miR-263a.
[0181] 3. Overexpression of miR-263a inhibits RSV proliferation in host rice
[0182] RSV inoculation experiments on non-virulent rice seedlings: When WT, OE263a-1, and OE263a-2 rice seedlings reached 2.5 leaf stages, RSV was inoculated at fixed locations on rice leaves using micro-insect cages. Each leaf was inoculated with 15 RSV-infected fourth-instar larvae of the small brown planthopper (SBPH) (Lady Laodelphax striatellus). Leaves infested with RSV-infected SBPH were designated as inoculated leaves, while the remaining rice leaves were designated as systemic leaves. Two days after inoculation, the RSV-infected SBPH and micro-insect cages were removed. The inoculated rice plants were cultured for an additional 7 days, and then the inoculated leaves were harvested for quantitative PCR analysis of the virus infection rate (i.e., NP gene expression).
[0183] The experimental method was as follows: RNA was extracted from the three inoculated leaves using the Trizol method (Invitrogen, Carlsbad, CA, USA). Rice and virus cDNAs were synthesized using Promega random primers and M-MLV reverse transcriptase. The level of the viral nucleocapsid protein encoding gene NP was detected using Roche SYBR Green Master. The detection method is described in the non-patent literature "Zhao, W., Yang, P., Kang, L. and Cui, F. (2016) Different pathogenicities of Rice stripe virus from the insect vector and from viruliferous plants. New Phytologist, 210, 196-207."). The internal reference gene was rice UBQ10 (Table 1).
[0184] For quantification, 10-12 biological replicates were set, and 2 technical replicates were performed for each sample. If the data conformed to a normal distribution, an independent sample t-test was used for statistical analysis. If the data did not conform to a normal distribution, a Wilcoxon rank sum test was used. Multiple comparisons were performed using one-way analysis of variance and Tukey's test. Reference 2 -ΔCT The relative expression of genes was calculated by PCR. The experiment was repeated three times.
[0185] Quantitative results showed that the NP gene content in miR-263a overexpressing rice lines (OE263a-1 and OE263a-2) was significantly lower than that in wild-type lines, indicating that overexpression of miR-263a can inhibit the proliferation of RSV virus in plants ( Figure 3 Middle C).
[0186] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. Use of miRNA or a substance that regulates miRNA expression, characterized in that: The application is any of the following: H1) Use of miRNA or a substance regulating miRNA expression in regulating resistance of rice to rice stripe virus; H2) Use of miRNA or a substance that regulates miRNA expression in the preparation of a product for regulating rice resistance to rice stripe virus; H3) Use of miRNA or substances regulating miRNA expression in breeding rice with upregulated, enhanced or improved resistance to rice stripe virus; The miRNA is a single-stranded RNA molecule with a nucleotide sequence of SEQ ID No.
1.
2. The use according to claim 1, characterized in that The regulating the resistance of rice to rice stripe virus is to improve the resistance of rice to rice stripe virus.
3. The use according to claim 1, characterized in that The substance is a substance that promotes the expression of the miRNA in rice.
4. The use according to any one of claims 1 to 3, characterized in that: The substances are any of the following: B1) a nucleic acid molecule that produces the miRNA of claim 1 or a nucleic acid molecule that produces a precursor of the miRNA of claim 1; B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4), a recombinant microorganism containing the nucleic acid molecule described in B1), or a recombinant microorganism containing the expression cassette described in B2), or a recombinant microorganism containing the recombinant vector described in B3).
5. The use according to claim 4, characterized in that B1) The nucleic acid molecule is a DNA molecule with a nucleotide sequence of SEQ ID No.
2.
6. A method for improving rice resistance to rice stripe virus, comprising increasing the expression level of the miRNA gene of claim 1 or / and the gene expression level of the miRNA precursor or / and the content of the miRNA or / and the content of the miRNA precursor in the target rice, so as to improve the resistance of rice to rice stripe virus.
7. A method for cultivating rice with improved resistance to rice stripe virus, comprising increasing the expression level of the miRNA gene of claim 1 or / and the gene expression level of a precursor of the miRNA or / and the content of the miRNA or / and the content of a precursor of the miRNA in the target rice, thereby obtaining rice with improved resistance to rice stripe virus; the rice with improved resistance to rice stripe virus has higher resistance to rice stripe virus than the target rice.
8. The method according to claim 7, characterized in that The increasing of the miRNA gene expression level or / and the gene expression level of the miRNA precursor or / and the content of the miRNA or / and the content of the miRNA precursor in the target rice according to claim 1 is achieved by introducing the nucleic acid molecule according to claim 4 or 5 into the target rice.
Citation Information
Patent Citations
Seed specificity highly effective promoter and its application
CN101063139A
Seed specific highly effective promoter and its application
CN101063139B
Recombinant DNA: transformed microorganisms, plant cells and plants: a process for introducing an inducible property in plants, and a process for producing a polypeptide or protein by means of plants or plant cells
US5057422A
Plant proteins, promoters, coding sequences and use
US5187267A