A strain specifically degrading 9-methylguanine and a screening method thereof

Abstract

The application provides a strain capable of specifically degrading 9-methylguanine and a screening method thereof, and belongs to the technical field of microbial sewage treatment.The strain is preserved in the China Center for Type Culture Collection, and has a preservation number of CCTCC NO:M 20231640; the screening method comprises the following steps: S1, pretreatment of an activated sludge sample; S2, enrichment culture of the strain to obtain an enriched strain; S3, domestication culture of the strain through a selective liquid medium to obtain a bacterial suspension; S4, primary screening of the strain to obtain a secondary screening plate; and S5, secondary screening of the strain.The application solves the problem that the prior art lacks a scheme for degrading 9-methylguanine through microorganisms, and has the advantages that the strain can specifically degrade 9-methylguanine and has a good degradation effect.

Description

Technical Field

[0001] This invention relates to the field of microbial wastewater treatment technology, specifically to a strain that specifically degrades 9-methylguanine and its screening method. Background Technology

[0002] 9-Methylguanine, a novel pollutant in the antibiotic class, possesses a complex and stable structure. Furthermore, analysis of the composition of organic pollutants in wastewater from chemical industrial parks indicates that 9-methylguanine constitutes a high proportion of wastewater pollutants and is difficult to degrade during aerobic treatment.

[0003] However, no specific strains have yet been screened or applied for degrading 9-methylguanine. Therefore, how to degrade 9-methylguanine through microbial methods has become an urgent problem to be solved. Summary of the Invention

[0004] The technical problem solved by this invention is that the existing technology lacks a scheme for the degradation of 9-methylguanine by microorganisms.

[0005] To solve the above problems, the technical solution of the present invention is as follows:

[0006] A strain that specifically degrades 9-methylguanine has been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO:M 20231640.

[0007] As one aspect of the present invention, the strain Bacillus sp. MG-1, which specifically degrades 9-methylguanine, was isolated from activated sludge.

[0008] As one aspect of the present invention, the activated sludge is derived from the return tank of a wastewater treatment plant.

[0009] As one aspect of the present invention, the molecular biological identification method for strains that specifically degrade 9-methylguanine includes the following: using the purified bacterial culture of the strain as a template, performing PCR amplification.

[0010] As one aspect of the present invention, the primers used for PCR amplification are the universal primer pair 27F / 1492R; the parameters for PCR amplification are: a. 1× (5 minutes at 95°C); b. 27× (30 seconds at 95°C; 30 seconds at 55°C; 45 seconds at 72°C); c. 10 minutes at 72°C, 10°C until halted by the user; the PCR amplification system is a 50 μl reaction system, including 10 μl of 5×FastPfu Buffer, 2 μl of 2.5 mM dNTPs, 1 μl of Forward Primer (5 μM), 1 μl of Reverse Primer (5 μM), 0.5 μl of FastPfu Polymerase, 10 ng of Template DNA, and ddH2O to a final volume of 50 μl.

[0011] Note: Polymerase Chain Reaction (PCR) is a method for the in vitro enzymatic synthesis of specific DNA fragments. It consists of a cycle of reactions including high-temperature denaturation, low-temperature annealing (renaturation), and temperature-appropriate extension, which are repeated cyclically to rapidly amplify the target DNA. PCR is characterized by high specificity, high sensitivity, ease of operation, and time-saving. It can be used not only for basic research such as gene isolation, cloning, and nucleic acid sequence analysis, but also for disease diagnosis or any application where DNA or RNA is present. PCR is also known as cell-free molecular cloning or specific DNA sequence in vitro primer-directed enzymatic amplification technology.

[0012] This invention also provides a method for screening strains that specifically degrade 9-methylguanine, comprising the following steps:

[0013] S1. Pretreatment of activated sludge samples;

[0014] S2. Enrich the cultured strains to obtain enriched strains;

[0015] S3. Domesticate and culture the strain to obtain a bacterial suspension;

[0016] S4. Initially screened strains to obtain secondary screening plates;

[0017] S5. Rescreen strains.

[0018] As one aspect of the present invention, step S1 includes the following: before strain acclimatization, the activated sludge sample is washed, 750 mL of activated sludge suspension is selected, 250 mL of phosphate buffer is added to the activated sludge suspension and mixed well; after standing until the sludge and aqueous phase separate into layers, the supernatant is drained; the above operation is repeated 3 to 5 times to obtain the pretreated activated sludge sample.

[0019] Note: Phosphate buffer is PBS buffer with a concentration of 0.02 M and a pH of 7.2.

[0020] As one aspect of the present invention, step S2 includes the following: 1 mL of activated sludge sample obtained in step S1 is cultured in a shake flask in LB medium containing 9-methylguanine, that is, the strains in the activated sludge sample are propagated to the logarithmic growth phase at 30°C and 150 rpm; the LB medium is centrifuged at 8000 rpm for 5 min, the supernatant is discarded, and the bacterial precipitate is washed twice with phosphate buffer to obtain enriched bacterial strains.

[0021] Note: The criterion for determining the logarithmic growth phase is OD. 600 The concentration was 1.6; the composition of LB medium was: tryptone 10 g / L, NaCl 10 g / L, and yeast extract 5 g / L.

[0022] As one aspect of the present invention, step S3 includes the following: taking 3 mL of enriched bacterial strain and adding it to 150 mL of selective liquid culture medium with 9-methylguanine concentrations of 5 mg / L, 10 mg / L, and 20 mg / L respectively, and adding 0.1% by volume of trace elements; culturing the enriched bacterial strain at 30°C and 150 rpm; and taking samples every 24 hours to measure OD. 600 until OD 600 After reaching 1.6, stop culturing; then centrifuge the three selective liquid culture media at 8000 rpm for 10 min, discard the supernatant, collect 500 μL of bacterial pellet, and dilute it with 500 μL of sterile PBS buffer to 1 ml of bacterial suspension.

[0023] Note: The selective liquid culture medium consists of: Na₂HPO₄·12H₂O 3.8 g / L, KH₂PO₄ 1.0 g / L, KCl 3.0 g / L, MnSO₄·7H₂O 0.2 g / L, (NH₄)₂SO₄ 0.93 g / L; the trace element composition is: EDTA 52000 mg / L, ZnSO₄·7H₂O 144 mg / L, CoCl₂·6H₂O 190 mg / L, MnCl₂·4H₂O 100 mg / L, CuCl₂·2H₂O 190 mg / L, Na₂MoO₄·2H₂O 36 mg / L, NiCl₂·6H₂O 24 mg / L, H₃BO₄ 100 mg / L, FeSO₄·7H₂O 100 mg / L.

[0024] As one aspect of the present invention, 15 mL of solid separation culture medium is poured into a plate and cooled to solidify. 150 μL of 9-methylguanine is then added dropwise to the surface of the plate, and the plate is capped for later use. 1 mL of bacterial suspension is then taken and diluted to a concentration of 10. -1 10 -2 10 -3 10 -4 10 -5 10 -6 The six gradient dilutions were obtained by multiplying the dilutions by 100 times. 1 mL of each of the six gradient dilutions was dropped onto the plates and spread evenly. The plates were placed in a constant temperature incubator and incubated upside down at 30°C. The growth of colonies in the plates was observed and recorded every 48 hours. After colonies grew, the first colony to grow was marked, and plates with single colonies were selected as re-screening plates.

[0025] As one aspect of the present invention, step S5 includes the following: using a sterilized inoculation loop to pick up the dominant single colony of each category from the rescreening plate, and streaking the bacteria on the inoculation loop onto the isolation plate; placing the streaked plate in a constant temperature incubator and incubating it upside down at 30°C; observing and recording the growth status of the colonies in the plate every 48 hours; if there are still single colonies of multiple bacterial species in the rescreening plate, continue to pick single colonies from the plate and streak them until the colony morphology in each plate is completely consistent; selecting the fastest-growing single colony from each category of strains as the target functional microorganism, transferring it to LB medium for shake-flask expansion culture; after confirming that each strain obtained by screening is a pure strain, preserving the strain by storing it in a -80°C freezer for later use.

[0026] Note: Step S5 also includes the following: Based on the size, color, shape, edge expansion and surface smoothness of the colonies on the screening plate, the single colonies on the screening plate are initially classified, and the single colonies with good growth in each category are selected; The composition of LB medium is: tryptone 10g / L, NaCl 10g / L, yeast extract 5g / L.

[0027] As one aspect of the present invention, the method for the bacterial strain to degrade 9-methylguanine is as follows: the bacterial solution is inoculated into wastewater collected from a sewage treatment plant at a volume ratio of 2% to carry out the degradation of 9-methylguanine.

[0028] As one aspect of the present invention, the bacterial culture is obtained by transferring the bacterial strain to 10 ml of LB medium and culturing it overnight in a shake flask until the bacterial concentration reaches OD600=1.

[0029] The beneficial effects of this invention are:

[0030] The strain of this invention can be applied to any wastewater containing 9-methylguanine. When the concentration of 9-methylguanine is 10 mg / L, the strain has a good removal effect, removing about 50% of 9-methylguanine in 80 hours, and achieving a degradation rate of more than 40% in the first 10 hours. This is of great practical significance for developing efficient microbial agents for degrading organic pollutants and applying them to wastewater treatment. Attached Figure Description

[0031] Figure 1 This is a flowchart of the method for screening strains that specifically degrade 9-methylguanine in Example 3 of the present invention;

[0032] Figure 2 This is a streak diagram of the bacterial strains obtained by the specific degradation of 9-methylguanine strain screening method in Example 3 of the present invention;

[0033] Figure 3 This is a comparison chart of the degradation performance of 9-methylguanine by the strains specifically designed to degrade 9-methylguanine in Example 4 of this invention;

[0034] Figure 4 This is a graph showing the degradation performance of 9-methylguanine by strain Bacillus sp. MG-1 in Example 5 of this invention. Detailed Implementation

[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0036] The terminology used in the embodiments of this invention is for the purpose of describing particular embodiments only and is not intended to limit the invention. The singular forms “a,” “the,” and “the” as used in the embodiments of this invention and the appended claims are also intended to include the plural forms, and “multiple” generally includes at least two unless the context clearly indicates otherwise.

[0037] Example 1: This example describes a strain of Bacillus sp. MG-1 that specifically degrades 9-methylguanine. It is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 20231640; the deposit date is September 7, 2023; and the deposit address is Wuhan University, Wuhan, China. The strain Bacillus sp. MG-1, which specifically degrades 9-methylguanine, was isolated from activated sludge. The activated sludge came from the return reflux tank of a wastewater treatment plant.

[0038]

[0039] The obtained sequences were submitted to the NCBI website and compared with existing strain data in the GenBank database. Then, BLAST (http: / / www.ncbi.nlm.nih.gov / blast / ) was used to search for strains with high similarity. Among them, the strain had a homology of up to 99% with Bacillus sp. NMK17.

[0040] Example 2: This example describes the molecular biological identification method for the strain that specifically degrades 9-methylguanine as described in Example 1, including the following:

[0041] The purified bacterial culture was used as a template for PCR amplification. The universal primer pair 27F / 1492R was selected for PCR amplification (upstream primer: 27F: AGAGTTTGATCCTGGCTCAG, downstream primer: 1492R: GGTTACCTTGTTACGACTT). The PCR amplification parameters were: a. 1× (5 minutes at 95°C); b. 27× (30 seconds at 95°C; 30 seconds at 55°C; 45 seconds at 72°C); c. 10 minutes at 72°C, 10°C until halted by the user. The PCR amplification system consisted of a 50 μl reaction mixture, including 10 μl of 5× FastPfuBuffer, 2 μl of 2.5 mM dNTPs, 1 μl of Forward Primer (5 μM), 1 μl of Reverse Primer (5 μM), 0.5 μl of FastPfu Polymerase, and 10 μl of... ng of template DNA and ddH2O added to 50 μl;

[0042] Understandably, in this embodiment, the bacterial culture was sent to Shanghai Lingen Biotechnology Co., Ltd. for bacterial identification. The purified bacterial culture was used as the DNA template for PCR amplification. TransStart Fastpfu DNA Polymerase was used as the PCR amplification system. The forward primer was 27F, the reverse primer was 1492R, and the template DNA was the purified bacterial culture.

[0043] As you can understand, Polymerase Chain Reaction (PCR) is a method for the in vitro enzymatic synthesis of specific DNA fragments. It consists of a cycle of reactions including high-temperature denaturation, low-temperature annealing (renaturation), and temperature-appropriate extension, which are repeated cyclically to rapidly amplify the target DNA. It is characterized by high specificity, high sensitivity, ease of operation, and time-saving. It can be used not only for basic research such as gene isolation, cloning, and nucleic acid sequence analysis, but also for disease diagnosis or any application where DNA or RNA is present. PCR is also known as cell-free molecular cloning or specific DNA sequence in vitro primer-directed enzymatic amplification technology.

[0044] Example 3: This example describes the screening method for strains that specifically degrade 9-methylguanine, as described in Example 1. Figure 1 As shown, it includes the following steps:

[0045] S1. Pretreatment of activated sludge samples;

[0046] Understandably, in this embodiment, step S1 includes the following: before strain acclimatization, the activated sludge sample is washed, 750 mL of activated sludge suspension is selected, 250 mL of phosphate buffer is added to the activated sludge suspension and mixed well; after standing until the sludge and aqueous phase separate into layers, the supernatant is drained; the above operation is repeated 3 to 5 times to obtain the pretreated activated sludge sample.

[0047] The phosphate buffer is PBS buffer with a concentration of 0.02 M and a pH of 7.2.

[0048] This embodiment uses activated sludge from the return pool of the wastewater treatment plant of Dongzhi Donghua Water Co., Ltd. in Chizhou City, Anhui Province. Under natural conditions, activated sludge contains a small amount of solid sediment, toxic components, and microbial metabolites. Before the strains are domesticated, the sludge needs to be pretreated by washing to eliminate unfavorable conditions for microbial growth.

[0049] S2. Enrich the cultured strains to obtain enriched strains;

[0050] Understandably, in this embodiment, step S2 includes the following: 1 mL of activated sludge sample obtained in step S1 is cultured in LB medium containing 9-methylguanine in a shake flask, that is, the strains in the activated sludge sample are propagated to the logarithmic growth phase at 30°C and 150 rpm; the LB medium is centrifuged at 8000 rpm for 5 min, the supernatant is discarded, and the bacterial precipitate is washed twice with phosphate buffer to obtain the enriched strains;

[0051] Understandably, the criterion for determining the logarithmic growth phase is OD. 600The concentration was 1.6; the composition of LB medium was: tryptone 10 g / L, NaCl 10 g / L, yeast extract 5 g / L;

[0052] S3. Domesticate and culture the strain to obtain a bacterial suspension;

[0053] Understandably, in this embodiment, step S3 includes the following: taking a 250mL conical flask and sealing film, washing and autoclaving at 121℃ for 30min; adding 3mL of enriched bacterial culture to 150mL of selective liquid culture medium with 9-methylguanine concentrations of 5mg / L, 10mg / L, and 20mg / L respectively, and adding 0.1% by volume of trace elements; culturing the enriched bacterial culture at 30℃ and 150rpm; and measuring OD every 24h. 600 until OD 600 Stop culturing after reaching 1.6; then centrifuge the three selective liquid culture media at 8000 rpm for 10 min, discard the supernatant, collect 500 μl of bacterial pellet and dilute it with 500 μl of sterile PBS buffer to 1 ml of bacterial suspension;

[0054] The selective liquid culture medium consisted of the following components: Na₂HPO₄·12H₂O 3.8 g / L, KH₂PO₄ 1.0 g / L, KCl 3.0 g / L, MnSO₄·7H₂O 0.2 g / L, and (NH₄)₂SO₄ 0.93 g / L; the trace element components were: EDTA 52000 mg / L, ZnSO₄·7H₂O 144 mg / L, CoCl₂·6H₂O 190 mg / L, MnCl₂·4H₂O 100 mg / L, CuCl₂·2H₂O 190 mg / L, Na₂MoO₄·2H₂O 36 mg / L, NiCl₂·6H₂O 24 mg / L, H₃BO₄ 100 mg / L, and FeSO₄·7H₂O 100 mg / L.

[0055] S4. Initially screened strains to obtain secondary screening plates;

[0056] Understandably, in this embodiment, step S4 includes the following: 15 mL of solid separation culture medium is poured into a plate and cooled to solidify, and 150 μL of 9-methylguanine is dropped onto the surface of the plate. The plate is then capped and set aside. 1 mL of bacterial suspension is taken and diluted to 10⁻⁶. -1 10 -2 10 -3 10 -4 10 -5 10 -6The six gradient dilutions were obtained by multiplying the dilutions by 100 times. 1 mL of each of the six gradient dilutions was dropped onto the plates and spread evenly. The plates were placed in a constant temperature incubator and incubated upside down at 30°C. The growth of colonies in the plates was observed and recorded every 48 hours. After colonies grew, the first colony to grow was marked, and plates with single colonies were selected as rescreening plates.

[0057] S5, re-screen strains;

[0058] Understandably, in this embodiment, step S5 includes the following: Preliminary classification of single colonies on the rescreening plate based on their size, color, shape, edge expansion, and surface smoothness; selection of healthy single colonies from each category; using a sterilized inoculation loop to pick up the dominant single colony of each category from the rescreening plate, and streaking the inoculum on the loop onto the isolation plate; placing the streaked plate in a constant temperature incubator and inverting it at 30°C; observing and recording the growth status of colonies on the plate every 48 hours. If multiple single colonies of different species still exist on the rescreening plate, continue to pick single colonies from that plate for streaking until the colony morphology on each plate is completely consistent. Figure 2 As shown; single colonies with faster growth were selected from each category of strains as target functional microorganisms, and transferred to LB medium for shake-flask expansion culture; after confirming that each strain obtained by screening was a pure strain, the strains were preserved and stored in a -80℃ refrigerator for later use.

[0059] Example 4: This example describes the method for verifying the 9-methylguanine degradation performance of the strains specifically screened in Example 3, including the following:

[0060] The strain stored at -80℃ was inoculated into LB liquid medium and then activated in a shaker at 30℃. 3 ml of the activated bacterial solution was inoculated into 75 mL of selective medium with 9-methylguanine as the sole carbon source (concentration of 10 mg / L) and cultured for 80 h. Samples were taken at 0, 5, 10.5, 29, 34.5, 52, and 77.5 h, and the degradation performance of the strain was tested by high performance liquid chromatography (HPLC).

[0061] HPLC detection conditions for 9-methylguanine:

[0062] (1) C 18 Column (5μm, 4.6mm × 250 mm);

[0063] (2) Mobile phase: Acetonitrile: Water = 7:93;

[0064] (3) Flow rate 0.8 mL / min;

[0065] (4) Detection wavelength: 254 nm;

[0066] (5) Column temperature 30℃.

[0067] like Figure 3 As shown, compared with the blank control group, this strain can remove about 50% of 9-methylguanine in 80 hours, and can achieve a degradation rate of more than 40% in the first 10 hours.

[0068] Example 5: This example describes the method for the specific 9-methylguanine-degrading strain Bacillus sp. MG-1 obtained in Example 3 to degrade 9-methylguanine. The method involves inoculating the bacterial culture at a volume ratio of 2% into wastewater collected from a sewage treatment plant for 9-methylguanine degradation. The bacterial culture is expanded overnight in shake flasks by transferring the strain to 10 ml LB medium until the bacterial concentration reaches OD600 = 1. Specifically, the bacterial culture is inoculated into wastewater collected from a sewage treatment plant at a volume ratio of 2% and cultured for six days. Samples are taken at 0h, 13.5h, 23h, 72h, 90h, and 136h to determine the degradation performance of strain Bacillus sp. MG-1 on 9-methylguanine. Figure 4 As shown; by Figure 4 It can be seen that the strain Bacillus sp. MG-1 has a certain degradation effect on 9-methylguanine in actual wastewater. It can remove about 23.1% of 9-methylguanine in 140h, and can reach a degradation rate of more than 20.3% in the first 13.5h. This is of great practical significance for developing efficient microbial agents for degrading organic pollutants and applying them to wastewater treatment.

Claims

1. A Bacillus species that specifically degrades 9-methylguanine ( Bacillus sp. strain MG-1, characterized in that, It is deposited in the China Center for Type Culture Collection, with accession number CCTCC NO:M 20231640.

2. A Bacillus subtilis as described in claim 1 ( Bacillus sp. A method for degrading 9-methylguanine using strain MG-1, characterized in that, The method includes: inoculating the bacterial culture at a volume ratio of 2% into wastewater collected from a sewage treatment plant to degrade 9-methylguanine; the bacterial culture is obtained by transferring the bacterial strain to 10 ml LB medium for overnight shake-flask culture until the bacterial concentration reaches OD600=1.

Images