Application of *Penicillium spp.* and fermented tea in the preparation of drugs for lowering blood lipids and / or reducing liver damage.
Fermented tea was prepared by co-fermenting tea with Penicillium spp. from Jiangxi Province, which solved the problem of microbial differences in the tea fermentation process and achieved significant effects in lowering blood lipids and reducing liver damage, providing a new treatment method for hyperlipidemia.
Patent Information
- Application Number
- CN202410032941.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-09
- Publication Date
- 2026-01-30
- Estimated Expiration
- 2044-01-09
AI Technical Summary
There are no reports in the existing technology on the effects of Jiangxi Penicillium tea on hyperlipidemia, and the differences in microbial strains during tea fermentation lead to inconsistencies in secondary metabolites, affecting the tearing speed and quality stability of tea.
Fermented tea was prepared by co-fermenting and culturing Penicillium jiangxiense with tea leaves. By controlling the fermentation conditions, unique active ingredients were formed, which significantly reduced blood lipids and liver damage.
Fermented tea significantly increased HDL-C levels and decreased TG, TC, and LDL-C levels in hyperlipidemic model mice, alleviating lipotoxic liver damage and protecting hepatocytes, demonstrating significant lipid-lowering and liver-damage-reducing effects.
Smart Images

Figure CN117838740B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of tea processing technology, and in particular to the application of Penicillium jixiense and fermented tea in the preparation of drugs for lowering blood lipids and / or reducing liver damage. Background Technology
[0002] Hyperlipidemia, also known as dyslipidemia, is a relatively common condition, mostly caused by genetic defects or the interaction of environmental factors. Symptoms typically include dizziness, fatigue, insomnia, forgetfulness, numbness in the limbs, chest tightness, and palpitations, often accompanied by overweight or obesity. Hyperlipidemia disrupts the metabolism of proteins, carbohydrates, and fats, leading to metabolic syndrome. In severe cases, it can ultimately cause serious diseases such as coronary heart disease, fatty liver, and cirrhosis.
[0003] Tea is a traditional beverage and a natural product, cultivated worldwide. It is widely loved for its unique flavor and health benefits. Studies have shown that tea is rich in beneficial substances such as tea polyphenols, theanine, and catechins, and also has effects such as lowering lipids, aiding digestion, and reducing cholesterol. Fermentation is a key factor in tea production, altering the chemical composition of tea and affecting its sensory qualities and overall quality. Furthermore, during fermentation, microorganisms can increase the tearing speed and quality stability of tea leaves, producing new secondary metabolites beneficial to health. However, different functional microbial strains have varying effects on the tearing speed and quality stability of tea leaves, potentially leading to significant differences in the resulting secondary metabolites. Currently, there are no reports on the effects of Jiangxi Penicillium mold tea on hyperlipidemia. Summary of the Invention
[0004] The purpose of this invention is to provide the application of Penicillium jixiense and fermented tea in the preparation of drugs for lowering blood lipids and / or reducing liver damage, so as to solve the problems existing in the prior art. Fermented tea is prepared by co-fermenting Penicillium jixiense and tea leaves. This fermented tea can significantly lower blood lipids and reduce liver damage, providing a new method for improving hyperlipidemia.
[0005] To achieve the above objectives, the present invention provides the following solution:
[0006] This invention provides the application of *Penicillium jiangxiense* in the preparation of drugs for lowering blood lipids and / or reducing liver damage. The *Penicillium jiangxiense* has the accession number CGMCC No. 40915, the accession date is November 9, 2023, the depositary is the China General Microbiological Culture Collection Center, and the depositary address is Institute of Microbiology, Chinese Academy of Sciences, No. 1 Beichen West Road, Chaoyang District, Beijing.
[0007] This invention also provides the application of fermented tea prepared using Penicillium jiangxiense in the preparation of drugs for lowering blood lipids and / or reducing liver damage. The fermented tea is prepared by co-fermenting and culturing Penicillium jiangxiense and tea leaves. The preservation number of Penicillium jiangxiense is CGMCC No. 40915.
[0008] Preferably, the method for co-fermenting and culturing Penicillium jixiense and tea includes the following steps:
[0009] Tea culture medium is prepared by mixing tea leaves with distilled water and sterilizing it.
[0010] After inoculating the tea culture medium with the *Penicillium jixiense*, the mixture was fermented in the dark until the mycelium of the *Penicillium jixiense* completely covered the tea culture medium.
[0011] Preferably, the tea leaves and distilled water are mixed evenly, allowed to stand for 40-90 minutes, and then sterilized at 121°C for 30-60 minutes to obtain the tea culture medium; wherein the amount of distilled water used is 30%-90% of the dry weight of the tea leaves.
[0012] Preferably, before inoculating the tea culture medium with *Penicillium jixiense*, the method further includes activating *Penicillium jixiense* using PDA medium and transferring the activated *Penicillium jixiense* to malt extract medium to obtain *Penicillium jixiense* mycelia.
[0013] Preferably, the conditions for culturing the *Penicillium jixiense* using the malt extract culture medium are: 20–32°C for 10–20 days.
[0014] Preferably, the temperature for the co-fermentation culture is 20–32°C.
[0015] Preferably, the tea leaves include green tea, yellow tea, white tea, oolong tea, black tea, and dark tea, and may also include tea stems and tea dust; it may also include caffeine-containing substitute teas. This invention is not limited to the above-mentioned tea types, nor is it limited to any one type of tea; it may use only one type of tea or multiple types of tea simultaneously.
[0016] The present invention discloses the following technical effects:
[0017] To fully utilize the bioactivity of microorganisms and tea leaves, and to meet the needs of new tea varieties and deep processing, the inventors, for the first time, co-fermented *Penicillium jixiense* and tea leaves under specific culture conditions to produce a *Penicillium jixiense* fermented tea. Through co-fermentation of *Penicillium jixiense* and tea leaves, the secondary metabolites of both are fully integrated and transformed during fermentation, forming unique active ingredients in the *Penicillium jixiense* fermented tea, giving it richer bioactivity and a better taste. Furthermore, experiments showed that *Penicillium jixiense* fermented tea significantly increased HDL-C levels in hyperlipidemic model mice, significantly reduced TG, TC, and LDL-C levels in the blood lipids of hyperlipidemic model mice induced by a high-fat diet, and significantly reduced ALT and AST levels, alleviating lipotoxic liver damage and protecting hepatocytes, demonstrating good effects on lowering blood lipids and reducing liver damage. Therefore, the *Penicillium jixiense* fermented tea prepared in this invention has the effects of lowering blood lipids and reducing liver damage, providing a theoretical basis for in-depth research and development of novel functional microbial teas and elucidating the effects of *Penicillium jixiense* fermented tea on lowering blood lipids and reducing liver damage. This invention lays the foundation for the development of new products that improve hyperlipidemia and can be applied to the development of lipid-lowering drugs. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 This is a diagram illustrating the culture characteristics of Penicillium spp. from Jiangxi. Detailed Implementation
[0020] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0021] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0022] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0023] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be readily apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0024] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0025] Example 1: Isolation, screening and identification of Penicillium jixiense
[0026] 1. Strains screening
[0027] Aseptically weigh 1g of tea sample and add it to 200mL of sterile water. Shake well and incubate on a shaker at 28℃ with a rotation speed of 180r·min. -1 Incubate for 48–72 hours; centrifuge and collect 1 mL of the supernatant, then mix thoroughly with 9 mL of sterile physiological saline to prepare 10... -1 The bacterial suspension was diluted 10 times, and then successively diluted in 10-fold increments. -2 10 -3 10 -4 10 -5 10 -6 10 -7 The mycelium was inoculated onto PDA medium using a spread plating method, with three replicates for each dilution and two inversions, and incubated upside down at 28°C. After colony growth, single colonies were picked and streaked onto PDA medium plates for isolation and purification. Under aseptic conditions, healthy mycelia were inoculated onto PDA medium plates and incubated at 23–27°C for 15 days to obtain the purified strain, whose colony morphology is as follows. Figure 1 As shown.
[0028] 2. Strain identification
[0029] Genomic DNA was extracted from the isolated and purified strain using the Solarbio Fungal DNA Extraction Kit. The ITS gene of the strain was amplified by PCR and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing analysis. The primers used for amplifying the ITS gene are as follows:
[0030] The upstream primer sequence (SEQ ID NO: 1) is: 5'TCCGTAGGTGAACCTGCGG 3'.
[0031] The downstream primer sequence (SEQ ID NO: 2) is: 5'TCCTCCGCTTATTGATATGC 3'.
[0032] The PCR reaction conditions were: 95℃ pre-denaturation for 4 min, 95℃ denaturation for 40 s, 55℃ annealing for 50 s, 72℃ extension for 1 min, for 32 cycles, followed by a 72℃ extension for 10 min. Sequence alignment in the GeneBank database using NCBI's BLAST function revealed that the strain screened in this invention showed the highest homology (98.40%) with *Penicillium jiangxiense*. Therefore, this strain was identified as *Penicillium jiangxiense* and named *Penicillium jiangxiense* GX0002983.
[0033] The Jiangxi Penicillium GX0002983 was deposited on November 9, 2023, at the China General Microbiological Culture Collection Center (CGMCC), Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 40915.
[0034] Example 2: Preparation of Fermented Tea with Penicillium jirovecii from Jiangxi
[0035] The *Penicillium jixiense* strain was activated using PDA medium and then inoculated onto malt extract medium (Haibo Biotechnology Co., Ltd., HB4176-3). The strain was then placed in an incubator at 28°C and cultured for 15 days. *Penicillium jixiense* grew vigorously and well, with dense mycelium, thus yielding the mycelium of *Penicillium jixiense*.
[0036] Weigh out green tea and place it in a culture bottle. Add 50% of the dry weight of the green tea to the green tea with distilled water, mix thoroughly, let stand for 60 minutes, and sterilize at 121℃ for 30 minutes to prepare a tea culture medium. Pick out healthy Penicillium jixiense mycelia to the above tea culture medium and culture it in the dark at 28℃. When the Penicillium jixiense mycelia completely cover the tea culture medium, dry it to obtain Penicillium jixiense fermented tea.
[0037] Example 3: Preparation of Fermented Tea with Penicillium jirovecii from Jiangxi
[0038] Weigh black tea and place it in a culture bottle. Add distilled water equal to 30% of the dry weight of the black tea to the black tea, mix well, let it stand for 40 min, sterilize it at 121 °C for 40 min to prepare a tea culture medium. Pick well-growing Penicillium jiangxiense hyphae and transfer them to the above tea culture medium, and culture them in the dark at 20 °C. Wait until the Penicillium jiangxiense hyphae completely cover the tea culture medium, and then air-dry to obtain Penicillium jiangxiense fermented tea.
[0039] Example 4 Preparation of Penicillium jiangxiense fermented tea
[0040] Weigh dark tea and place it in a culture bottle. Add distilled water equal to 90% of the dry weight of the black tea to the dark tea, mix well, let it stand for 90 min, sterilize it at 121 °C for 60 min to prepare a tea culture medium. Pick well-growing Penicillium jiangxiense hyphae and transfer them to the above tea culture medium, and culture them in the dark at 20 °C. Wait until the Penicillium jiangxiense hyphae completely cover the tea culture medium, and then air-dry to obtain Penicillium jiangxiense fermented tea.
[0041] Example 5 Animal experiment
[0042] 1. Experimental animals
[0043] SPF-grade C57 male mice, with a body weight of 20 ± 2 g, were purchased from Changsha Tianqin Biotechnology Co., Ltd., and the certificate number was SCXK(Xiang)2019-0014. The experimental animals were housed in the SPF-grade animal house of Guangxi Zhuang Autonomous Region Academy of Chinese Medicine, with the use license number SYXK(Gu)2016-0006. The environmental temperature of the animal house was (22 ± 3) °C, the relative humidity was 60% ± 5%, with a 12-h light-dark cycle, and they had free access to food and water. Feed and water were added regularly every day.
[0044] 2. Establishment and grouping of hyperlipidemic mouse models
[0045] After C57 mice with a body weight of 18 - 22 g were adaptively fed for five days. They were fed with a high-fat diet (78.8% of the experimental basal diet, 10% lard, 1% commercially available cholesterol, 0.2% pig bile salt, 10% egg yolk) for 30 d. Blood was taken from the tail vein to detect the contents of TC, TG, HDL-C, LDL-C, ALT, and AST in the serum. The data were processed using SPSS 21.0 statistical software (one-way analysis of variance). If there were significant differences in the above six indicators between the model group and the normal group, it was proved that the hyperlipidemic mouse model was successfully established. After success, intragastric administration was carried out, and they continued to be fed with the high-fat diet.
[0046] The mice were randomly divided into a normal control group, a model group, a lovastatin positive control group, a green tea group, a high-dose group of Jiangxi Penicillium fermented tea from Example 2 (hereinafter referred to as the high-dose group), a medium-dose group of Jiangxi Penicillium fermented tea from Example 2 (hereinafter referred to as the medium-dose group), and a low-dose group of Jiangxi Penicillium fermented tea from Example 2 (hereinafter referred to as the low-dose group), with 10 mice in each group.
[0047] The extract of Jiangxi Penicillium fermented tea used in the high-dose group, medium-dose group and low-dose group was prepared by accurately weighing a certain amount of fungal tea, boiling it in 100 mL of distilled water for 30 minutes, filtering, repeating the above operation twice with the tea residue, combining the filtrates, heating and concentrating the filtrate, and adjusting the volume to prepare the extract of Jiangxi Penicillium fermented tea.
[0048] 3. Administration
[0049] The successfully induced hyperlipidemia mouse model was randomly divided into groups and labeled. The normal group and the model group were gavaged with the same volume of distilled water. Each treatment group was gavaged with a different drug (i.e., the concentration of lovastatin in the positive control group was 1 mg / mL, the concentration of green tea in the group was 40 mg / mL, the concentration of the high-dose group of Jiangxi Penicillium fermented tea in Example 2 was 40 mg / mL, the concentration of the medium-dose group of Jiangxi Penicillium fermented tea in Example 2 was 20 mg / mL, and the concentration of the low-dose group of Jiangxi Penicillium fermented tea in Example 2 was 10 mg / mL). The gavage dose for each mouse was 10 mL / kg, and the gavage was administered once a day. During the administration period, the normal group was fed a basal diet, and the others were fed a high-fat diet. The gavage was continued for 30 days.
[0050] 4. Specimen collection and testing
[0051] 4.1 Serum sampling
[0052] After 30 days of oral administration of the drug to mice with hyperlipidemia, blood was collected from the eyeballs and the mice were euthanized by cervical dislocation. The serum was collected by centrifugation at 4000 r / min for 15 min at 4℃, and the levels of total cholesterol (TC), triglycerides (TG), high-density lipoprotein (HDL-C), low-density lipoprotein (LDL-C), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) in the serum were measured.
[0053] 4.2 Organ sampling
[0054] After the mice were euthanized, their livers were separated, weighed, and stored in a -80°C freezer for later use.
[0055] 5. Data Processing
[0056] SPSS 21.0 statistical software was used for data analysis. One-way ANOVA was used for comparisons among multiple groups, LSD test was used for pairwise comparisons, and t-tests were used for within-group and between-group comparisons. Experimental results are expressed as mean ± standard deviation. -±s indicates that the difference is statistically significant, with P < 0.05.
[0057] 6. Experimental Results and Analysis
[0058] As shown in Table 1, compared with the normal group, the levels of TC, TG, and LDL-C in the model group were significantly increased (P < 0.01), and the level of HDL-C was significantly decreased (P < 0.01), proving the successful establishment of a diet-induced hyperlipidemia mouse model. Compared with the model group, the high-dose, medium-dose, and low-dose groups of Jiangxi Penicillium fermented tea significantly (P < 0.01 or P < 0.05) reduced the levels of TC and LDL-C and increased the level of HDL-C in hyperlipidemic mice. The high-dose group of Jiangxi Penicillium fermented tea significantly (P < 0.01) reduced the levels of TC, TG, and LDL-C and increased the level of HDL-C in hyperlipidemic mice, with better results than the green tea group. Compared with the model group, the medium-dose group of Jiangxi Penicillium fermented tea significantly reduced the levels of TC, TG, and LDL-C in hyperlipidemic mice (P < 0.01) and significantly (P < 0.05) increased the level of HDL-C. The above results indicate that Jiangxi Penicillium fermented tea has a good lipid-lowering effect and can improve diet-induced hyperlipidemia.
[0059] Table 1. Effects of Jiangxi Penicillium fermented tea on serum lipid levels in hyperlipidemic mice (x) - ±s, n=10)
[0060]
[0061] Note: Compared with the normal group, * P < 0.05 ** P < 0.01, compared with the model group, # P < 0.05 ## P < 0.01;
[0062] As shown in Table 2, compared with the normal group, the ALT and AST levels in the model group were significantly increased (P < 0.01), demonstrating that the liver cell damage in hyperlipidemic mice induced by diet was severe. Compared with the model group, the high-dose group of Jiangxi Penicillium fermented tea significantly reduced the ALT and AST levels in hyperlipidemic mice (P < 0.05), and the medium-dose group of Jiangxi Penicillium fermented tea significantly reduced the AST level (P < 0.05), with better effects than the green tea group. These results indicate that Jiangxi Penicillium fermented tea can reduce diet-induced lipotoxic liver damage and has a protective effect on liver cells.
[0063] Table 2. Effects of Jiangxi Penicillium fermented tea on ALT and AST levels in hyperlipidemic mice (x) - ±s, n=10)
[0064]
[0065]
[0066] Note: Compared with the normal group, * P < 0.05 ** P < 0.01; compared with the model group, # P < 0.05 ## P < 0.01
[0067] The above data indicate that Jiangxi Penicillium fermented green tea can reduce the levels of total cholesterol, triglycerides, and low-density lipoprotein in the blood of mice induced by a high-fat diet, while increasing the level of high-density lipoprotein. It can also lower the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST), thus alleviating lipotoxic liver damage and protecting hepatocytes. It has a good effect on lowering blood lipids and reducing liver damage, and can be used for further research and preparation of related lipid-lowering drugs.
[0068] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. Use of Penicillium jiangxiense in the preparation of a drug for reducing blood lipid and / or reducing liver injury, characterized in that, The Penicillium jiangxiense has a preservation number of CGMCC No.40915.
2. Use of fermented tea prepared by Penicillium jiangxiense in the preparation of a drug for reducing blood lipid and / or reducing liver damage, characterized in that, The fermented tea is prepared by co-fermentation culture of the Penicillium jiangxiense and green tea, and the Penicillium jiangxiense has a preservation number of CGMCC No.40915. The method for co-fermentation culture of the Penicillium jiangxiense and green tea comprises the following steps: The green tea is mixed with 30% to 90% of distilled water of the dry weight of the green tea, and then is placed for 40 to 90 minutes, and then is sterilized at 121 ℃ for 30 to 60 minutes to obtain the tea culture medium; The Penicillium jiangxiense is inoculated into the tea culture medium, and then is co-fermented in the dark until the mycelium of the Penicillium jiangxiense completely covers the tea culture medium; Before the Penicillium jiangxiense is inoculated into the tea culture medium, the method further comprises the following steps: activating the Penicillium jiangxiense by using a PDA culture medium, and transferring the activated Penicillium jiangxiense into a wort culture medium to obtain the mycelium of the Penicillium jiangxiense; The wort culture medium is used to culture the Penicillium jiangxiense at 20 to 32 ℃ for 10 to 20 days; The temperature for the co-fermentation culture is 20 to 32 ℃.
Citation Information
Patent Citations
Making technology of fermented edible mushroom tea and fermented edible mushroom tea
CN107593955A
Hypoxylon sp. Fermented tea with effects of reducing blood fat and protecting liver
CN115282217A