A non-vertex-modified tetrahedral framework nucleic acid complex, its preparation method, and its application in promoting angiogenesis.

Abstract

This invention provides a non-vertex modified tetrahedral framework nucleic acid complex, which is a nanomaterial formed by linking target nucleic acids to the non-vertex positions of DNA tetrahedral framework nucleic acids. The target nucleic acid in this invention's complex is located at a non-vertex position, overcoming the defect of traditional tetrahedral framework nucleic acids being carried into cells at the vertices. Furthermore, the prepared composite material possesses sustained-release drug properties. The material prepared by this invention, carrying the nucleic acid aptamer Apt02 and DMOG, can promote VEGF generation in vascular endothelial cells, thereby promoting angiogenesis, and shows excellent clinical application prospects in the field of tissue engineering.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a non-vertex-modified tetrahedral framework nucleic acid complex, its preparation method, and its use in promoting angiogenesis. Background Technology

[0002] Classic tetrahedral framework nucleic acids are formed by the self-assembly of four DNA sequences through complementary pairing. Numerous studies have confirmed their excellent properties, which can promote the proliferation and migration of various cells. Their specific tetrahedral morphology has four vertices, which can interact with the cell membrane to trigger "corner attack" and ultimately achieve "autonomous" entry into the cell through the caveolin-mediated endocytosis pathway. They also have the characteristic of being easily editable.

[0003] Tetrahedral framework nucleic acids can serve as carriers, delivering target substances into cells to exert their effects. These target substances include miRNAs, siRNAs, nucleic acid aptamers, and so on. Currently reported techniques utilize sticky ends to attach these target nucleic acids, such as miRNAs, siRNAs, and nucleic acid aptamers, to the vertices of the tetrahedron, thus "carrying" them into the cell. However, with increasingly complex modification methods and higher functional requirements, the drawbacks of traditional vertex modification methods are becoming increasingly apparent. The most significant problem is that it may weaken the cell entry advantage brought about by the "corner attack" of the tetrahedron vertices. Furthermore, the sticky end connection method is not an absolutely stable one and has high requirements for the sequence of the sticky ends, incubation time, and temperature. Failure to meet these requirements can significantly affect the yield of the target product, such as reduced yield due to mismatch or the target nucleic acid structure potentially detaching from the sticky ends.

[0004] Therefore, it is necessary to improve the existing methods of carrying drugs using tetrahedral framework nucleic acids. Summary of the Invention

[0005] Tetrahedral framework nucleic acids are three-dimensional nanostructures with a tetrahedral shape, formed by the automatic hybridization and combination of strands through ingenious sequence design and the application of complementary pairing principles. Each tetrahedral structure consists of at least four ss-DNA strands, and each ss-DNA strand is divided into three small fragments. These three small fragments hybridize and combine with each of the other three ss-DNA strands to form one face of the tetrahedral structure. Each pair of hybridized small fragments forms an edge of the tetrahedron with a double helix structure. The 5' and 3' ends of each ss-DNA strand meet at the vertex of the tetrahedron or form a port on the edge.

[0006] This invention modifies the tetrahedron to obtain a non-vertex modified tetrahedral framework nucleic acid complex.

[0007] This invention relates to a non-vertex modified tetrahedral framework nucleic acid complex, which is a nanomaterial formed by linking a target nucleic acid to the non-vertex positions of a DNA tetrahedral framework nucleic acid. The target nucleic acid of this invention can be selected according to the needs of those skilled in the art.

[0008] The target nucleic acid is attached to the bases within 3 bp before and after the midpoint of the edge of the DNA tetrahedral framework nucleic acid; preferably, the target nucleic acid is attached to the bases at the midpoint of the edge of the DNA tetrahedral framework nucleic acid or to the bases on both sides of the midpoint.

[0009] In this process, the target nucleic acid is linked to the DNA tetrahedral framework nucleic acid via click chemistry; and the non-vertical bases on 1 to 3 single-stranded DNA strands of the DNA tetrahedral framework nucleic acid are modified with azide.

[0010] The complex was prepared according to the following method:

[0011] 1) Take three single-stranded DNA molecules from the DNA tetrahedral framework nucleic acid and the target nucleic acid, and incubate them to prepare an intermediate; the non-vertex bases on 1 to 3 of the three single-stranded DNA molecules are modified with azide.

[0012] 2) Take the intermediate from step 1) and react it using a click chemistry method to obtain the intermediate after the reaction;

[0013] 3) Take the fourth single strand of the DNA tetrahedral framework nucleic acid and incubate it with the intermediate obtained in step 3) to obtain the final product.

[0014] The molar ratio of the target nucleic acid to the DNA tetrahedral framework nucleic acid is not less than 1:1; preferably 3:1.

[0015] Wherein, the target nucleic acid is miRNA, siRNA or nucleic acid aptamer; and / or, the length of the target nucleic acid is 10-50 bp, preferably 36 bp; the preferred nucleic acid aptamer is Apt02, and the preferred sequence is shown in SEQ ID NO.5.

[0016] The DNA tetrahedron is formed by base pairing of four single-stranded DNA molecules, and the sequences of the four single-stranded DNA molecules of the DNA tetrahedron are shown in SEQ ID NO.1 to 4, respectively; preferably, the 51st base T of SEQ ID NO.1, the 10th base T of SEQ ID NO.2, and the 31st base T of SEQ ID NO.3 are modified with azide.

[0017] This invention also provides a drug-loaded composite material, which is formed by combining the aforementioned non-vertex-modified tetrahedral framework nucleic acid complex with a drug, wherein the molar ratio of the two is (0.5-2):1000, preferably 1:1000; the drug is preferably DMOG. DOMG is methoxyglycine.

[0018] The present invention also provides a method for preparing the aforementioned composite or composite material, comprising the following steps:

[0019] 1) Take three single-stranded DNA molecules from the DNA tetrahedral framework nucleic acid and the target nucleic acid, and incubate them to prepare an intermediate; the non-vertex bases on 1 to 3 of the three single-stranded DNA molecules are modified with azide.

[0020] 2) Take the intermediate from step 1) and react it using a click chemistry method to obtain the intermediate after the reaction;

[0021] 3) Take the fourth single strand of the DNA tetrahedral framework nucleic acid and incubate it with the intermediate obtained in step 3) to obtain the aforementioned non-vertex modified tetrahedral framework nucleic acid complex.

[0022] 4) Take the complex obtained in step 3), add the drug, mix and incubate to obtain the drug-loaded composite material.

[0023] The present invention also provides the use of the aforementioned non-vertex modified tetrahedral framework nucleic acid complex or drug-loaded composite material in the preparation of VEGF generation promoters or drugs that promote angiogenesis.

[0024] This invention utilizes a chemical synthesis method to stably link the target nucleic acid to the DNA backbone of a tetrahedral framework nucleic acid, constructing a novel framework nucleic acid complex structure, namely a tetrahedral framework nucleic acid complex. This structure does not destroy the vertices of the tetrahedral framework nucleic acid, and has a high synthesis yield and is easy to purify, overcoming the instability and difficulty in cell entry of the sticky end technology.

[0025] The tetrahedral framework nucleic acid complex TAC prepared in this embodiment of the invention carries the nucleic acid aptamer Apt02 (mimicking VEGFA to target VEGFR-positive cells). The drug-loaded composite material TACD further carries the small molecule drug DMOG, which can release DMOG slowly, efficiently promote cell secretion of EGFR, promote lumen formation, stimulate vascular budding, and promote angiogenesis.

[0026] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0027] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0028] Figure 1TAC synthesis principle diagram;

[0029] Figure 2 TAC synthesis principle diagram;

[0030] Figure 3 TAC synthesis principle diagram;

[0031] Figure 4 Electrophoresis results. Lanes 1 and 13 show two different markers; lanes 2-5 show S1-3 and the basic framework composed of them; lanes 6-11 show the results of S4 chains and various S4 chains combined with the basic framework, respectively; lane 12 shows Sapt labeled with Cy5 fluorescence, which appears red in the electrophoresis image; lane 14 shows the result of 1 part Sapt combined with 2 / 3 of S4 and the basic framework; lane 15 shows the result of 2 parts Sapt combined with 1 / 3 of S4; lane 16 shows the intermediate (before the click reaction) and a portion of excess Sapt. To ensure that all sites in the basic framework are occupied by Sapt, the molar ratio of Sapt to the basic framework is slightly more than 3:1 during addition; after annealing, the unreacted Sapt is removed by ultrafiltration, and a complete S4 chain is added to the remaining intermediate (after the click reaction) to complete the chain substitution reaction; lane 17 shows the result of TAC prepared in Example 1.

[0032] Figure 5 Electrophoresis results. Lanes 1-3 show S1, S2, and S3, which form the basic framework; lane 4 shows the results of tetrahedral framework nucleic acids without Sapt; lane 5 shows tetrahedral framework nucleic acids formed by annealing the basic framework and S4, without any modifications. Lane 6 shows SaptO2 with Cy5 fluorescence; lanes 7-9 show the results of intermediates (before the click reaction) formed by annealing Sapt and the basic framework at molar ratios of 1:1, 2:1, and 3:1, respectively; lanes 11-13 show the results of TAC formed by annealing Sapt and the basic framework at molar ratios of 1:1, 2:1, and 3:1, respectively; lane 14 shows the DNA marker.

[0033] Figure 6 Transmission electron microscopy (TEM) images of the intermediate prepared in the examples (before the click reaction) and TAC; the two images on the left are (before the click reaction), and the two images on the right are TAC;

[0034] Figure 7 Graphs of TAC and TACD enzyme-linked immunosorbent assay (ELISA) results;

[0035] Figure 8 DMOG release curve in TACD;

[0036] Figure 9 Image showing the results of fluorescence staining detection of tetrahedral framework nucleic acids without Apt02;

[0037] Figure 10 Flow cytometry results of tetrahedral framework nucleic acids without Apt02;

[0038] Figure 11 Flow cytometry results of tetrahedral framework nucleic acids without Apt02;

[0039] Figure 12 The results of TAC detection by fluorescence staining method in this invention are shown in the figure.

[0040] Figure 13 Flow cytometry results of the TAC of this invention;

[0041] Figure 14 Flow cytometry results of the TAC of this invention;

[0042] Figure 15 The result image generated by VEGF;

[0043] Figure 16 Immunofluorescence staining results of VEGF;

[0044] Figure 17 Immunofluorescence staining results of HIF-1α;

[0045] Figure 18 Immunofluorescence staining results of PHD

[0046] Figure 19 Isoprotein expression diagram

[0047] Figure 20 Image showing the effect of in vitro angiogenesis;

[0048] Figure 21 Image showing the result of vascular sprouting; Detailed Implementation

[0049] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0050] Example 1: Preparation of the tetrahedral framework nucleic acid (TAC) carrying the nucleic acid aptamer Apt02 and TACD of the present invention.

[0051] The raw materials and chemical groups required for the synthesis are all commercially available and can be purchased from Sangon Biotechnology.

[0052] I. Product Preparation

[0053] 1. For example Figures 1-3 The TAC of this invention is prepared as shown:

[0054] Synthesis principle:

[0055] In the basic framework, each of the unpaired edges in S1, S2, and S3 has a dT site modified with azide. These unpaired edges in the basic framework will also serve as the DNA template for the click reaction. The 5' end of Sapt (representing the DNA sequence of Apt02) is modified with an alkyne group.

[0056] In the synthesis of TAC, the basic framework composed of S1-3 is added to Sapt in a 1:3 molar ratio and annealed in a one-pot process to form an intermediate structure, which we refer to as the intermediate (before the click reaction). The 5' end of the Sapt in the intermediate (before the click reaction) corresponds to the dT site of the azide modification. The Sapt in the intermediate and the basic framework have an incomplete base-complementary pairing relationship; the 5' and 3' ends of the Sapt each have 10 bases complementary to the basic framework. After annealing to synthesize the intermediate (before the click reaction), the modified azide and alkyne are linked through a classic Cu+-catalyzed cycloaddition reaction (CuAAC), thereby chemically binding the Sapt to the basic framework. In this process, we utilize a DNA template-based click chemistry reaction. The efficient base-complementary pairing of DNA brings the two reactive groups, azide and alkyne, on the modified ssDNA closer together, increasing their effective molar concentration. This allows the click reaction to proceed efficiently under relatively low substrate concentration conditions. After the click reaction is complete, the S4 strand is added, triggering a toehold-mediated DNA strand displacement reaction to construct a complete tetrahedral framework. Due to the previous click chemical link, although the Sapt is displaced, it cannot detach from the tetrahedral framework nucleic acid, thus forming a functional whole, resulting in the tetrahedral framework nucleic acid complex (TAC).

[0057] Synthesis method:

[0058] S1, S2, S3, and Sapt were added to TM buffer (10 mM Tris-HCl, 50 mM MgCl2, pH 8.0) in a molar ratio of 1:1:1:3. The mixture was heated to 95°C and held for 10 minutes in a thermal cycler, then rapidly cooled to 4°C and held for 20 minutes to prepare intermediates (before the reaction). Other framework nucleic acid structures constructed via annealing in the experiment were also prepared using this method.

[0059] The CuAAC solution used to catalyze the click chemistry reaction between azide and alkyne groups was prepared by mixing BTTAA (10 mM), CuSO4 (5 mM), and sodium ascorbate (10 mM) in a volume ratio of 4:1:5. The intermediate (before the click reaction), PBS buffer (0.01 M), and CuAAC solution were mixed in a volume ratio of 8:1:1, shaken, and reacted at 37°C for 6 h in a thermal cycler to prepare the intermediate (after the click reaction). Subsequently, S4 was added, and the mixture was incubated at 37°C for 4 h, followed by ultrafiltration to obtain TAC.

[0060] The nucleotide sequences of S1, S2, S3, S4, and Sapt are as follows:

[0061] S1(SEQ ID NO.1):

[0062] CATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGCCTATCAGC T GGCCCCCCCC

[0063] S2(SEQ ID NO.2):

[0064] CCTATCAGC T GGCCCCCCCCCGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC

[0065] S3 (SEQ ID NO.3):

[0066] ACGGTATTGGACCCTCGCATGCCTATCAGC T GGCCCCCCCCGGATGGGCATGCTCTTCCCG

[0067] S4-1 / 3:AGCTGATAGG GGGGGGGGGCC

[0068] S4-2 / 3:AGCTGATAGG GGGGGGGGCC AGCTGATAGG GGGGGGGGCC

[0069] S4 (SEQ ID NO.4):

[0070] GGGGGGGGCCAGCTGATAGGGGGGGGGGCCAGCTGATAGGGGGGGGGGCCAGCTGATAGG

[0071] Sapt(SEQ ID NO.5):AGCTGATAGGATGGGTTGTAGGTCTAGGGGGGGGCC

[0072] Note: The underlined T bases are modified with azide.

[0073] 2. Preparation of TACD

[0074] A 10 mM DMOG (HY-15893-27218, MCE, USA) solution was added to a TAC solution (final concentration: 250 μM DMOG, 250 nM TAC), and the mixture was shaken at room temperature for 6 h. After ultrafiltration, the tetrahedral framework nucleic acid complex TACD was obtained.

[0075] The following experimental examples demonstrate the beneficial effects of the present invention.

[0076] Experimental Example 1: Detection of the preparation process and final product of TAC and TACD of the present invention.

[0077] Following the method for preparing TAC and TACD in Example 1, the amount and length of Sapt were adjusted to prepare TAC, and the results were tested to screen suitable conditions.

[0078] 1. The process of TAC synthesis was detected by agarose gel electrophoresis.

[0079] Agarose gel electrophoresis was used to detect various substances in the TAC synthesis process. The agarose gel electrophoresis method adopted was a conventional method in the field (preparing 3% agarose gel, loading the prepared samples one by one, and developing and exposing after 120V constant voltage for 30 min).

[0080] exist Figure 4 and Figure 5 The results of agarose gel electrophoresis demonstrate the stepwise synthesis process of TAC and the possible outcomes of some other chain synthesis.

[0081] Depend on Figure 4 It can be seen that the TAC synthesis of this invention was successful; from Figure 5 It can be seen that regardless of whether the basic framework is saturated (Sapt to basic framework in a molar ratio of 3:1) or unsaturated (Sapt to basic framework in molar ratios of 1:1 and 2:1), a tetrahedral framework nucleic acid complex carrying a DNA aptamer can be formed after click reaction and strand displacement reaction. When the molar ratio of Sapt to basic framework is greater than 3:1, a slight excess of Sapt allows the basic framework to react completely. With increasing Sapt ratio, the fluorescence intensity of the intermediate and the TAC fluorescence both increase. Therefore, in preparing the TAC of this invention, the molar ratio of Sapt to basic framework can be 1:1 to 3:1.

[0082] 2. Dynamic light scattering is used to determine zeta potential and particle size.

[0083] Dynamic light scattering was used to detect various substances during the synthesis of TAC.

[0084] The test results are as follows:

[0085] As the Sapt content increases, the negative charge of the zeta potential of TAC gradually increases. When the ratio of Sapt to the basic framework is 1:1, 2:1, and 3:1, the zeta potential of TAC is -6.3±0.3651mV (n=4), -7.6±0.2415mV (n=4), and -10.1±0.2972mV (n=4), respectively.

[0086] Particle size measurements of the materials synthesized in Example 1 showed that the hydrated particle size of the basic framework was 15.33 ± 0.8819 nm (n = 3), the hydrated particle size of the intermediate was 29.06 ± 1.528 nm (n = 3), and the hydrated particle size of TAC was 47.67 ± 1.764 nm (n = 3).

[0087] 3. Transmission electron microscopy examination

[0088] Transmission electron microscopy was used to visually observe the morphology of nanoparticles, specifically to observe the morphology of the substances synthesized in Example 1.

[0089] According to our conception, the intermediate is a single, independent nanoparticle; in contrast, TAC exhibits a significantly characteristic branched structure. The detection results are as follows... Figure 6 As shown in the TEM image, the TAC structure resembles a combination of a central core and several dendritic protrusions. This morphological characteristic matches the expected morphological characteristics of framework nucleic acids carrying DNA aptamers, indicating that we have successfully prepared the anticipated tetrahedral framework nucleic acid complex structure.

[0090] 4. ELISA reader detection

[0091] The TACD synthesized in Example 1 was detected by an enzyme-linked immunosorbent assay (TAC and TACD samples were mixed with Gelred detection solution at room temperature, shaken and incubated for 10 min, and the absorbance value was detected by an enzyme-linked immunosorbent assay at a wavelength of 312 nm).

[0092] like Figure 7 The results, obtained by microplate reader analysis, show that DMOG affects the binding of gelred and DNA, confirming that DMOG and DNA also have a groove binding mode similar to that of gelred.

[0093] 5. Test for sustained-release effect

[0094] The TACD synthesized in Example 1 was purified by ultrafiltration at 6, 12, 24, 48, and 72 hours after synthesis. The lower layer of the ultrafiltration tube was separated, and the absorbance value was measured at 230 nm using a microplate reader. The DMOG concentration in the lower layer was determined by comparing it with the DMOG standard curve. After accumulation, a DMOG release curve was plotted.

[0095] Release curve as shown Figure 8 As shown in the figure, it can be seen that in the TACD of the present invention, DMOG molecules are gradually released over time, indicating that the TACD of the present invention can release the drug DMOG in a sustained manner.

[0096] Experimental Example 2: Effect Detection of TAC and TACD of the Present Invention

[0097] The experimental groups included: negative control (NC) using serum-free and growth factor-free medium; positive control (PC) supplemented with 8 ng / ml rHuVEGF165 (Prime Gene, Shanghai); DMOG group supplemented with 500 μM DMOG; and TAC and TACD groups supplemented with 250 nM TAC or TACD.

[0098] 1. Detection by fluorescence staining and flow cytometry

[0099] Fluorescence staining: Well-grown HUVECs were seeded in confocal dishes, and TAC prepared in Example 1 or tetrahedral framework nucleic acids without Apt02 were added at a concentration of 250 nM. Cell samples were collected at 1, 6, and 12 h after drug addition. The cells were fixed with 4% PFA for 10 min and washed with PBS. FITC staining solution was added, and the cells were incubated overnight at 4°C. Finally, DAPI staining solution was added, and the cells were incubated for 10 min. The cells were then mounted with glycerol. Images were acquired using a laser confocal microscope (FV3000, Olympus), and analyzed and statistically analyzed using ImageJ software.

[0100] Flow cytometry assay: Well-grown HUVECs were seeded in confocal dishes. After cell adhesion, Cy5 fluorescent nanoparticles were added, followed by TAC prepared in Example 1 or tetrahedral framework nucleic acids without Apt02, at a concentration of 250 nM. Cell samples were collected at 1, 6, and 12 h after drug addition. Flow cytometry was used to quantitatively analyze the uptake of Cy5-labeled nanomaterials by the cells. Cell samples were washed with PBS, collected by cell scraper, thoroughly dispersed, sieved, and the fluorescence intensity was detected by flow cytometry (FC500, BECKMAN) to determine the uptake of tetrahedra. Fluorescence analysis was performed using FlowJO software.

[0101] Fluorescent staining and flow cytometry were used to compare the interaction between the fluorescent material and cells and the tetrahedral framework nucleic acid complex carrying Apt02 (TAC prepared in Example 1) and the tetrahedral framework nucleic acid without Apt02, in order to explore the differences brought about by structural changes.

[0102] Figure 9 It is a tetrahedral framework nucleic acid that does not carry Apt02, i.e. Figure 4 The product of channel 5, in which S4 is modified by Cy5, showed only a very small amount of red fluorescence in a very small number of cells 1 hour after drug administration. With the extension of drug administration time to 6 and 12 hours, the number of cells showing red fluorescence increased significantly. Flow cytometry results also showed a similar trend. The proportion of cells detecting Cy5 fluorescence gradually increased with the extension of drug administration time. Figure 10 ), and the relative fluorescence intensity also increases accordingly ( Figure 11 ).

[0103] The results after carrying Apt02 (TAC prepared in Example 1) are completely different, such as... Figure 12 As shown, fluorescent staining 1 hour after TAC administration revealed a difference compared to... Figure 9 A more general phenomenon of Cy5 fluorescence co-localization with HUVECs cells was observed. As the drug administration time increased to 6 and 12 hours, the red fluorescence of the cells became very strong. At this point, we considered most TACs to be in the cytoplasm, because a clear boundary between the cell nucleus and the material could be observed through fluorescence staining, a phenomenon that often suggests the nanomaterial is in the cytoplasm but cannot enter the cell nucleus. Flow cytometry also detected that the proportion of cells carrying Apt02 showing red fluorescence approached 100% after 6 hours. Figure 13 Compared to the control group, the relative fluorescence intensity increased by 20-30 times. Figure 14 We believe that, compared to the randomized process of contacting the cell membrane before re-entry, the recognition of the VEGFR receptor by the DNA aptamer Apt02 plays a positive role in enabling materials to approach and contact cells positive for this receptor.

[0104] 2. VEGF activation level detection

[0105] Compared to exogenous cytokines, whose effects are often unstable, drugs that promote the continuous secretion of target cytokines by tissue cells themselves, thereby facilitating specific biological behaviors, may be a better strategy. VEGF activation levels were detected using TAC, TACD, and DMOG prepared in Example 1, with positive controls (PC) and negative controls (NC) set up.

[0106] HUVECs in good growth condition were inoculated and treated with TAC or TACD prepared in Example 1 at a concentration of 250 nM. Cell samples were collected at 2, 6, 12, 24, and 48 h after treatment, and the supernatant was extracted by centrifugation for analysis. The HUMAN VEGF ELISAKIT (NOVUS, China) was used, and reagents were prepared on ice according to the manufacturer's instructions. In short, 100 μL of different concentrations of standards were added to each well to create a standard curve. The test sample was added to the well and incubated at 37°C for 120 min. 100 μL of antibody working solution, 100 μL of enzyme conjugate working solution, and 100 μL of chromogenic substrate were added to each well sequentially. The absorbance of the sample was measured at 450 nm after the reaction was terminated, and the standard curve and sample protein concentration were calculated.

[0107] The results are as follows Figure 15 The results showed that at 2h and 6h after drug administration, the VEGF level in the small molecule DMOG group was higher. At 12h after drug administration, the VEGF level in the TACD group was slightly higher than that in the DMOG group, while the VEGF level in the TAC group was slightly lower than that in the DMOG group. At 24h, the VEGF level in the TACD group was significantly higher than that in both the DMOG and TAC groups. At 48h, the difference in VEGF level between the TACD group and other groups continued to widen. At this point, the VEGF levels in the negative control group, DMOG group, TAC group, and TACD group were 115.9±8.112 pg / mL, 222.2±10.55 pg / mL, 326.2±15.39 pg / mL, and 639±27.54 pg / mL, respectively (n=5).

[0108] The results showed that smaller molecules had a faster onset of action within a relatively short time after administration, and the DMOG group had a higher VEGF level. With prolonged administration, the TAC and TACD groups gradually surpassed the levels achieved by simply adding DMOG.

[0109] Figures 16-18 It can be seen that TCAD significantly promotes the expression of VEGF and HIF-1α. Specifically, increased HIF-1α expression was observed in both the nucleus and cytoplasm, while in the control group, only partial expression was observed in the nucleus, with little fluorescence in the cytoplasm. The TCAD group showed a more significant increase in VEGF fluorescence signal, but the fluorescence intensity and distribution of HIF-1α were not significantly different from the control group. PHD immunofluorescence staining results showed no significant differences between the groups.

[0110] The protein expression was further validated using Western blotting technology, such as... Figure 19As shown, the expression levels of VEGF and VEGFR were highest in the TACD group among the five groups. Compared with the NC group, the expression levels of VEGF and VEGFR were also increased in the DMOG and TAC groups. The expression levels of HIF-1α also differed significantly, with the TACD group showing the highest level, followed by the DMOG group, while the expression levels in other groups were very low. Similarly, the expression levels of PHD showed little difference among the groups. Analysis of the results indicates that the effect of TACD is stronger than that of DMOG or TAC alone, and TACD can simultaneously exert a positive effect on both VEGF / VEGFR and HIF, the two pathways that promote angiogenesis.

[0111] Experimental results show that both TAC and TACD of the present invention can effectively promote the generation of VEGF and VEGFR, and can be made into VEGF generation promoters. TACD of the present invention can also effectively promote the expression of HIF-1α, and ultimately effectively promote angiogenesis.

[0112] 3. In vitro angiogenesis effect detection

[0113] The lumen formation assay is a recognized in vitro method for assessing angiogenesis, based on the ability of endothelial cells to form three-dimensional capillary-like tubular structures when cultured on a basement membrane extract gel with reduced growth factors. During the assay, endothelial cells differentiate, migrate in a directed manner to arrange, branch, and form a tubular polygonal network of blood vessels, reflecting differences in the ability of stimuli to promote angiogenesis. Lumen formation was detected using TAC and TACD prepared in Example 1, as well as DMOG, with a positive control (PC) and a negative control (NC).

[0114] exist Figure 20 The schematic diagram illustrates the procedure for the lumen formation experiment in this study. The specific steps are as follows: Matrigel matrix gel (Corning, no. 356234) is laid on a pre-cooled confocal dish and incubated at 37°C until solidification. Human umbilical vein endothelial cells pretreated with drugs (PC group supplemented with 8 ng / ml rHuVEGF165, DMOG group supplemented with 500 μM DMOG, TAC and TACD groups supplemented with 250 nM TAC or TACD, incubated for 30 min) are then pre-cultured with 5 × 10⁶ cells per 100 μL of liquid. 4 Cells were seeded at a concentration of [number] cells per dish using Matrigel matrix gel. 150 μL of cell suspension was added to each dish. At 3, 6, and 12 h, 50 μL of Calcein-AM (abcam, ab141420) was added, and after incubation for 5 min, the formation of cells was observed using a fluorescence inverted microscope (Leica, DMi8). Data were analyzed using ImageJ software.

[0115] As shown in Figure 20, live cell staining images were acquired at 6h and 12h after tube formation, and the images were analyzed using ImageJ software to obtain the total length, number of nodes, number of grids, and grid area for statistical analysis. The live cell staining results show that at 6h, both the PC and TACD groups formed relatively dense network structures, while the TAC group also formed a network structure but with a relatively low density. The DMOG group had a more scattered grid, while the NC group did not show significant tube formation. At 12h, the grid density of all groups decreased, but the trend was consistent with that at 6h. ImageJ statistical results show that the TACD group achieved an in vitro tube formation ability close to that of the PC group, while the TAC group was slightly better than the DMOG group.

[0116] Studies on vascular sprouting also employed a 3D culture observation method, where cell clusters were pre-cultured under different conditions. Cells pre-cultured under these conditions were induced to form cell clusters of similar size. For example... Figure 21 As shown, 24 hours after inoculation with Matrigel, a small amount of budding was observed in all groups except the NC group, with the PC and TACD groups showing relatively more budding. At 72 hours, the TACD group exhibited the most pronounced budding, accompanied by branching structures expanding outwards. Statistical analysis of the budding results in ImageJ showed that the TACD group had the best number of buds, budding area, and total budding length. This result indicates that TACD has a more significant stimulating effect on budding.

[0117] Experimental results show that both TAC and TACD of the present invention can effectively promote lumen formation and stimulate vascular budding, thus having the effect of promoting angiogenesis.

[0118] In summary, this invention provides a novel tetrahedral framework nucleic acid complex capable of non-vertex modification, and specifically prepared a tetrahedral framework nucleic acid complex TAC carrying the nucleic acid aptamer Apt02 through non-vertex modification. Furthermore, a tetrahedral framework nucleic acid complex TACD carrying the nucleic acid aptamer Apt02 and the drug DMOG was also prepared. The effects of TAC and TACD can effectively promote EGFR secretion, promote lumen formation, stimulate angiogenesis, and promote blood vessel sprouting, showing excellent application prospects for diseases dependent on angiogenesis, such as tissue regeneration.

Claims

1. A non-apex-modified tetrahedral framework nucleic acid complex, characterized in that, The nanomaterial is formed by connecting the target nucleic acid to the non-apex position of the DNA tetrahedron framework nucleic acid; The DNA tetrahedron is formed by four single-stranded DNA through base complementary pairing, and the sequences of the four single-stranded DNA of the DNA tetrahedron are shown in SEQ ID NO. 1~4, respectively; the 51st base T of SEQ ID NO. 1, the 10th base T of SEQ ID NO. 2, and the 31st base T of SEQ ID NO. 3 are modified by azide; The target nucleic acid is Apt02, and the sequence is shown in SEQ ID NO. 5; The target nucleic acid is connected to the DNA tetrahedron framework nucleic acid through click chemistry method.

2. The composite of claim 1, wherein, Prepared according to the following method: 1) Take 3 single-stranded DNA of the DNA tetrahedron framework nucleic acid and the target nucleic acid, anneal to prepare an intermediate; the bases at the non-apex position of 1~3 single-stranded DNA are modified by azide; 2) Take the intermediate of step 1) to perform click chemistry method reaction to obtain the reacted intermediate; 3) Take the 4th single-stranded DNA of the DNA tetrahedron framework nucleic acid, and incubate with the reacted intermediate obtained in step 3) to obtain the compound.

3. The composite of claim 1, wherein, The molar ratio of the target nucleic acid to the DNA tetrahedron framework nucleic acid is 3:

1.

4. A drug-loaded composite material, characterized by, The compound is prepared by compounding the non-apex modified tetrahedron framework nucleic acid complex of any one of claims 1~3 with a drug, and the molar ratio of the two is (0.5~2):1000.

5. The drug-loaded composite material of claim 4, wherein, The molar ratio of the non-apex modified tetrahedron framework nucleic acid complex of any one of claims 1~3 to the drug is 1:1000; the drug is DMOG.

6. A method of producing a composite material as claimed in claim 4 or 5, characterised in that: The steps are as follows: 1) Take 3 single-stranded DNA of the DNA tetrahedron framework nucleic acid and the target nucleic acid, anneal to prepare an intermediate; the bases at the non-apex position of 1~3 single-stranded DNA are modified by azide; 2) Take the intermediate of step 1) to perform click chemistry method reaction to obtain the reacted intermediate; 3) Take the 4th single-stranded DNA of the DNA tetrahedron framework nucleic acid, and incubate with the reacted intermediate obtained in step 3) to obtain the compound of any one of claims 1~3; 4) Take the obtained compound of step 3), add the drug, mix and incubate to obtain the composite material of claim 4 or 5.

7. Use of the compound of any one of claims 1~3 or the composite material of claim 4 or 5 in the preparation of a VEGF production promoter or a drug for promoting blood vessel formation.

Images