A promoter ProGES of Morinda officinalis GES gene and its preparation method and application

Abstract

The present invention discloses a promoter ProGES of Morinda officinalis GES gene and its preparation method and application. The preparation method comprises the following steps: extracting Morinda officinalis genomic DNA; using Morinda officinalis genomic DNA as a template, PCR amplifying the promoter ProGES of Morinda officinalis GES gene by primer combination ProGES-F / ProGES-R; using an agarose gel recovery kit to recover the promoter ProGES fragment of Morinda officinalis GES gene from the PCR product. The promoter ProGES is a strong endogenous promoter of Morinda officinalis, which can not only regulate gene expression in Morinda officinalis in response to environmental and hormone treatments, but also drive gene expression efficiently and stably in model plants such as Nicotiana benthamiana and Arabidopsis thaliana. The present invention provides a gene expression regulatory element with great application potential for using genetic engineering technology or synthetic biology technology to carry out directional genetic improvement and improve target active ingredients.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and biotechnology, and relates to a promoter ProGES of Morinda officinalis GES gene and a preparation method and application thereof. Background Art

[0002] The promoter is the most important regulatory element for regulating gene transcription and expression, and determines the transcription efficiency of gene expression. It mainly includes the core promoter region and the promoter regulatory region. The core promoter region contains the necessary TATA-box and CAAT-box, while the promoter regulatory region is located at the 5' end upstream of the core promoter, and mainly includes regulatory sequences that enhance or inhibit transcription efficiency, cis-regulatory elements that respond to environmental stress or plant hormones, etc. The structure and function of the promoter and its cis-acting elements are crucial to the regulation of gene transcription and expression and tissue-specific expression. Promoters are widely used in plant biotechnology and synthetic biology, and are necessary regulatory tools for studying gene functions, increasing the yield of active ingredients, and inducing the expression of exogenous proteins.

[0003] At present, the most widely used heterologous promoters in plant genetic engineering and synthetic biology expression systems are the CaMV35S promoter from the cauliflower mosaic virus and the Ubiquitin gene promoter Ubi from maize. For example, in plants such as rice, Arabidopsis, tobacco, and tomatoes, the CaMV35S and Ubi promoters are used to drive the expression of related genes to improve their stress resistance, yield, etc. However, the use of heterologous promoters in heterologous expression systems often results in low initial transcription efficiency, no transcriptional activity, or gene silencing, thereby affecting the transcriptional expression level of the target gene. For example, in monocotyledons, the CaMV35S promoter has problems such as low transcriptional activity and gene silencing; in Morinda officinalis, the Ubi promoter has the phenomenon of unstable promoter activity. Using promoters from endogenous or closely related species in heterologous expression systems is conducive to the recognition of regulatory elements on the promoter by receptor cell regulatory factors and reduces gene silencing. Therefore, the research on endogenous strong promoters in plants has attracted more and more attention, and new endogenous strong promoters are urgently needed to improve the efficient expression of key structural genes, thereby promoting the conversion rate of substrates and the accumulation of effective ingredient yields, enhancing plant stress resistance and increasing crop yields.

[0004] The hairy root expression system has been widely used in the basic research and application fields of medicinal plants. It is an ideal platform for the verification of gene function and the production of active ingredients in medicinal plants. Hundreds of medicinal plants have successfully established hairy root induction and culture systems at home and abroad. The hairy root system has been used to produce a variety of secondary metabolites with medicinal value, such as flavonoids, alkaloids, anthraquinones, saponins, terpenes, etc. Among them, ginseng hairy roots have achieved commercial large-scale production of ginsenosides. Iridoids are the main active ingredients in Morinda officinalis that have anti-inflammatory, analgesic, anti-rheumatoid arthritis, anti-osteoporosis and prevention and treatment of bone loss. The hairy root expression system and genetic transformation system of Morinda officinalis are mature, but there are no reports on strong endogenous promoters of Morinda officinalis. Therefore, it is of great research significance and application value to explore highly active endogenous promoters of Morinda officinalis for the study of gene function, genetic breeding and synthetic biology of Morinda officinalis. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention provides a promoter ProGES of Morinda officinalis GES gene and a preparation method and application thereof.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] A promoter ProGES of Morinda officinalis GES gene, wherein the nucleotide sequence of the promoter ProGES of Morinda officinalis GES gene is shown as SEQ ID NO:1.

[0008] A method for preparing the promoter ProGES of Morinda officinalis GES gene comprises the following steps:

[0009] (1) Extracting Morinda officinalis genomic DNA;

[0010] (2) Using the genomic DNA of Morinda officinalis as a template, the promoter ProGES of the Morinda officinalis GES gene was amplified by PCR using the primer combination ProGES-F / ProGES-R, where:

[0011] As shown in SEQ ID NO: 2, the sequence of ProGES-F is (5'-3'): TGACTTTAAACCCTAACACCGTTTATC;

[0012] As shown in SEQ ID NO:3, the sequence of ProGES-R is (5'-3'): GTTTTTTTTCTCCTCTATTTTTTGCGCT;

[0013] (3) Use an agarose gel recovery kit to recover the promoter ProGES fragment of the Morinda officinalis GES gene from the PCR product.

[0014] In step (1), 0.5 g of leaves of Morinda officinalis tissue culture seedlings were taken and ground into powder in liquid nitrogen, and then the Morinda officinalis genomic DNA was extracted using a plant genomic DNA extraction kit.

[0015] In step (2), the PCR reaction conditions are as follows: 95°C, pre-denaturation for 3 min; 95°C, denaturation for 15 s; 57°C, annealing for 20 s; 72°C, extension for 90 s; amplification for 35 cycles; and 72°C, final extension for 10 min.

[0016] In step (2), the PCR reaction system used includes the following reaction components and their addition amounts:

[0017] Add 25 μL of 2× Phanta Max Buffer;

[0018] Add 1 μL of 10 mM each dNTP Mix;

[0019] Add 1 μL of Phanta Max Super-Fidelity DNA Polymerase;

[0020] 2 μL of ProGES-F at a concentration of 10 μM was added;

[0021] 2 μL of ProGES-R at a concentration of 10 μM was added;

[0022] 100 ng of Morinda officinalis genomic DNA was added;

[0023] Add ddH20 to make up to 50 μL.

[0024] The promoter ProGES of the Morinda officinalis GES gene is used to initiate the expression of the target gene.

[0025] The application of the promoter ProGES of the Morinda officinalis GES gene in plant genetic engineering.

[0026] The application of the promoter ProGES of the Morinda officinalis GES gene in synthetic biology.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] The present invention provides a strong endogenous promoter ProGES of Morinda officinalis, which can not only regulate gene expression in Morinda officinalis in response to environmental and hormone treatments, but also efficiently and stably drive gene expression in model plants such as Nicotiana benthamiana and Arabidopsis thaliana. The present invention provides a gene expression regulatory element with great application potential for using genetic engineering technology or synthetic biology technology to carry out directional genetic improvement and increase target active ingredients. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The figure is the agarose gel electrophoresis of the cloned promoter ProGES, where M is the DL2000 DNA Marker.

[0030] Figure 2 Analysis of the cis-acting elements of the promoter ProGES.

[0031] Figure 3 Schematic diagram of promoter ProGES truncation and construction of promoter-GUS reporter system.

[0032] Figure 4 The figure is the agarose gel electrophoresis of the truncated promoter ProGES, where M is the DL2000 DNA Marker, and the sizes of the P1, P2, P3 and P4 fragments are 377 bp, 615 bp, 1267 bp and 1598 bp, respectively.

[0033] Figure 5 GUS staining of Nicotiana benthamiana transiently infected with promoter ProGES of different lengths.

[0034] Figure 6 The GUS enzyme activity of Nicotiana benthamiana transiently infected with promoter ProGES of different lengths.

[0035] Figure 7 GUS staining of Arabidopsis thaliana stably transformed with promoter ProGES of different lengths, where WT is wild-type Arabidopsis thaliana.

[0036] Figure 8 GUS enzyme activity of Arabidopsis thaliana stably transformed with promoter ProGES of different lengths.

[0037] Fig. 9 GUS staining of Nicotiana benthamiana transiently infected with promoter CaMV35S and promoter ProGES.

[0038] Fig.10 The GUS enzyme activity of Nicotiana benthamiana transiently infected with promoter CaMV35S and promoter ProGES.

[0039] Fig.11 The response of the promoter ProGES to different environmental stress treatments on the transcriptional expression of the GES gene. The horizontal axes 0h, 6h, 12h, 24h, and 48h represent the time of stress treatment. DETAILED DESCRIPTION

[0040] The technical solution of the present invention is further described below through embodiments.

[0041] Example 1. Preparation of the strong endogenous promoter ProGES from Morinda officinalis

[0042] About 0.5 g of leaves of Morinda officinalis tissue culture seedlings were taken and ground into powder in liquid nitrogen. Then, the genomic DNA of Morinda officinalis was extracted using a high-efficiency plant genomic DNA extraction kit (DP350).

[0043] Geraniol synthase (GES) catalyzes geraniol from geranyl pyrophosphate (GPP) to enter the iridoid biosynthesis pathway and is the first key rate-limiting enzyme in the iridoid biosynthesis pathway. Based on the structural characteristics of the GES gene, specific primers were designed to amplify the nucleotide sequence of about 1.6 kb upstream of the GES gene, which was named promoter ProGES.

[0044] Design specific primer sequences and prepare the following primers:

[0045] As shown in SEQ ID NO: 2, ProGES-F (5'-3'): TGACTTTAAACCCTAACACCGTTTATC;

[0046] As shown in SEQ ID NO:3, ProGES-R (5'-3'): GTTTTTTTTCTCCTCTATTTTTTGCGCT.

[0047] Using Morinda officinalis genomic DNA as a template, the promoter ProGES sequence was cloned using the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme, P505). PCR reaction conditions: 95 ℃, pre-denaturation for 3 min; 95 ℃, denaturation for 15 s; 57 ℃, annealing for 20 s; 72 ℃, extension for 90 s; amplification for 35 cycles; 72 ℃, final extension for 10 min. The PCR reaction system is shown in Table 1.

[0048] Table 1. PCR reaction system for amplifying promoter ProGES sequence

[0049]

[0050] In Table 1, 10 mM each means that the concentrations of the four bases A, T, C, and G are all 10 mM.

[0051] The PCR products were detected by 1% agarose gel electrophoresis. Figure 1 As shown, the obtained fragment size was about 1.6 kb; the promoter ProGES fragment was recovered using an agarose gel recovery kit (AG21005).

[0052] The recovered and purified promoter ProGES fragment was connected to the pCE2_TA-Blunt-Zero vector using a TOPO cloning kit to obtain the recombinant pCE2_TA-Blunt-Zero-ProGES vector; the recombinant pCE2_TA-Blunt-Zero-ProGES vector was transformed into Escherichia coli competent cells DH5α using the heat shock method, and after screening with ampicillin and kanamycin, the positive single clones were picked for sequencing to obtain the nucleotide sequence of the promoter ProGES.

[0053] The nucleotide sequence of the promoter ProGES of the Morinda officinalis GES gene is shown in SEQ ID NO: 1 (5'-3'):

[0054]

[0055] Example 2. Construction of promoter transcription activity reporter vector

[0056] The GUS gene encodes β-glucuronidase, which can hydrolyze 5-bromo-4-chloro-3-indole-β-D-glucuronic acid cyclohexylamine salt (X-Gluc) to produce a blue product; at the same time, the GUS protein can react with the substrate 4-methylumbelliferone-β-glucuronide to produce the fluorescent substance 4-methylumbelliferone, and the content of GUS protein can be quantitatively detected by fluorescence spectrophotometry. Therefore, the promoter-GUS reporter system was used to quantitatively identify the transcriptional activity of the promoter by detecting GUS staining and GUS enzyme activity.

[0057] The nucleotide sequence of the promoter ProGES obtained in Example 1 was submitted to the PlantCARE database (https: / / bioinformatics.psb.ugent.be / webtools / plantcare / html / ) to analyze the cis-acting elements on the promoter. The analysis results are as follows: Figure 2 As shown, the promoter ProGES contains a large number of core promoter elements TATA-box, AT~TATA-box and enhancer sequence CAAT-box, indicating that the promoter ProGES is a strong promoter.

[0058] The promoter ProGES was truncated by deleting the 5' end of the promoter to analyze the core region and regulatory elements of the promoter. According to the distribution of cis-elements on the promoter, the promoter ProGES was truncated into P1 (377 bp), P2 (615 bp), P3 (1267 bp) and P4 (1598 bp).

[0059] The plant expression vector pEGProGUS-B was purchased from Wuhan Aidijing Biotechnology Co., Ltd. The vector carries the CaMV35S promoter driving GUSPlus TM , and the resistance screening marker gene BlpR. Using homologous recombination, HindIII and NcoI restriction sites were selected to replace the CaMV35S promoter, and a promoter transcription activity reporter vector was constructed. The construction diagram is shown in Figure 3 shown.

[0060] Specific primer sequence combinations P1-F / PR, P2-F / PR, P3-F / PR and P4-F / PR were designed, and promoter sequences of different lengths were obtained by PCR amplification. The primer sequences are shown in Table 2.

[0061] Table 2. Primers for amplifying promoter sequences of different lengths

[0062] Primers ST.26 standard sequence nucleotide or amino acid sequence ID number in the table Sequence (5'-3') P1-F As shown in SEQ ID NO:4 TGATTACGCCAAGCTTACCCTCACCAAATAACTTAAGCC P2-F As shown in SEQ ID NO:5 TGATTACGCCAAGCTTGAGATCAAACTTAGAGGATGAATGGG P3-F As shown in SEQ ID NO:6 TGATTACGCCAAGCTTCCGAGACCTTAATTTTACCATATGCA P4-F As shown in SEQ ID NO:7 TGATTACGCCAAGCTTTGACTTTAAACCCTAACACCGTTTATCTTATTAGACT PR As shown in SEQ ID NO:8 GACCACCCGGGGATCCGTTTTTTTTTCTCCTCTATTTTTTGCGCTATTGG

[0063] Using pCE2_TA-Blunt-Zero-ProGES plasmid as template, high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase (Vazyme, P505) was used to clone promoter sequences of different lengths. PCR reaction conditions: 95℃, pre-denaturation for 3 min; 95℃, denaturation for 15 s; 57℃, annealing for 20 s; 72℃, extension for 90 s; amplification for 35 cycles; 72℃, final extension for 10 min. The PCR reaction system is shown in Table 3.

[0064] Table 3. PCR reaction system for amplifying promoter sequences of different lengths

[0065]

[0066] The PCR products were detected by 1% agarose gel electrophoresis. Figure 4 As shown, the obtained fragment sizes were consistent with the expected sizes; promoter fragments P1, P2, P3 and P4 of different lengths were recovered using an agarose gel recovery kit (AG21005).

[0067] The plant expression vector pEGProGUS-B was linearized using endonucleases HindIII and NcoI. The enzyme digestion reaction conditions were: 37°C, 60 min; 80°C, 20 min. The digestion products were detected by 1% agarose gel electrophoresis, and the linearized pEGProGUS-B vector was recovered using an agarose gel recovery kit (AG21005). The enzyme digestion system is shown in Table 4.

[0068] Table 4. Enzyme digestion reaction system

[0069]

[0070] The ClonExpress Ultra One Step Cloning Kit V2 was used to connect the recovered promoter fragments of different lengths to the pEGProGUS-B linearized vector by homologous recombination. The recombination reaction was set up on ice at 50 °C for 5 min and immediately placed on ice to cool to obtain the recombinant product. The homologous recombination reaction system is shown in Table 5.

[0071] Table 5. Homologous recombination reaction system

[0072]

[0073] The homologous recombination products were transformed into Escherichia coli competent cells DH5α by heat shock method. After kanamycin selection, positive single clones were picked for sequencing verification. Promoter fragments of different lengths were inserted into the pEGProGUS-B linearized vector to obtain promoter transcription activity reporter vectors pEGProGUS-B-P1, pEGProGUS-B-P2, pEGProGUS-B-P3 and pEGProGUS-B-P4.

[0074] The obtained pEGProGUS-B-P1, pEGProGUS-B-P2, pEGProGUS-B-P3 and pEGProGUS-B-P4 plasmids were transformed into Agrobacterium tumefaciens GV3101 competent cells by freeze-thaw method, and after selection with kanamycin, rifampicin and gentamicin, the strains were preserved for future use.

[0075] Example 3. Identification of promoter transcription activity

[0076] (1) Transient expression of Nicotiana benthamiana to identify the activity of different promoter segments

[0077] Prepare infection solution: activate pEGProGUS-B-P1, pEGProGUS-B-P2, pEGProGUS-B-P3 and pEGProGUS-B-P4 Agrobacterium tumefaciens GV3101 strains and shake the culture. When the OD600 value of the culture solution reaches 0.8-1.0, collect the cells by centrifugation, resuspend the cells in 10 mL MgCl2 solution (10 mM, containing 200 μM AS), adjust the OD600 to about 1.0, and let it stand at 28°C for 2-3 h to obtain the infection solution.

[0078] Tobacco instantaneous infection: Select Nicotiana benthamiana seedlings with good growth conditions, and infect tobacco leaves by injection. Use a 1 mL syringe without a needle to inject 200-300 μL of infection solution from the lower epidermis of the tobacco leaves, mark them, and culture them in weak light for 48 h for subsequent experiments.

[0079] GUS staining method to detect the expression of GUS protein: GUS staining kit (Coollebo, SL7160) was used to detect the promoter activity of different length fragments P1, P2, P3 and P4 of the promoter ProGES. For specific operations, please refer to the kit instructions. GUS staining results are shown in Figure 5 As shown, all truncated fragments of the promoter ProGES have transcriptional activity and can drive the transcriptional expression of GUS protein, and the shortest fragment P1 (377 bp) also has promoter activity.

[0080] GUS enzyme activity detection: The plant glucuronidase (GUS) ELISA kit (Boshen, BS-E17997O2) was used to determine the GUS protease activity driven by different length fragments of the promoter ProGES P1, P2, P3 and P4. About 0.1 g of infected tobacco leaf tissue was weighed, fully ground and placed in a 1.5 mL centrifuge tube, 1 mL of PBS (containing 1 μg / L protease inhibitor) buffer was added, shaken and mixed, centrifuged at 8000 g for 10 min, and the supernatant was collected in a new centrifuge tube, which was the glucuronidase extract. The standard curve was drawn according to the method of the reference kit, and the obtained standard curve was y=98.278x-4.2516, R 2 =0.9961, and the GUS enzyme activity was calculated by the standard curve. Figure 6 As shown, GUS protease activity can be detected in tobacco leaves infected with promoter ProGES fragments of different lengths P1, P2, P3 and P4, among which P2 and P4 fragments have the strongest activity.

[0081] (2) Stable expression in Arabidopsis thaliana to identify the activity of different promoter segments

[0082] Prepare infection solution: activate pEGProGUS-B-P1, pEGProGUS-B-P2, pEGProGUS-B-P3 and pEGProGUS-B-P4 Agrobacterium tumefaciens GV3101 strains and shake the culture. When the OD600 value of the culture solution reaches 0.8-1.0, collect the cells by centrifugation, resuspend the cells in 10 mL 5% sucrose solution (containing 0.05% Silwet L-77), and adjust the OD600 to about 1.0.

[0083] Arabidopsis genetic transformation: Colombian wild-type Arabidopsis was transformed by the floral dip method, positive transgenic Arabidopsis was obtained through basta resistance screening, and T3 generation stable expression strains were obtained through continuous screening.

[0084] GUS staining and GUS enzyme activity assay were performed according to the method in Example 3.(1).

[0085] GUS staining results Figure 7 As shown, the wild-type Arabidopsis was stained white, and the stably transformed Arabidopsis was stained blue, indicating that the promoter ProGES fragments of different lengths P1, P2, P3 and P4 can drive the stable expression of GUS protein, and are stably expressed in different tissues such as Arabidopsis roots, stems, and leaves.

[0086] The results of GUS enzyme activity assay were as follows Figure 8 As shown, GUS protease activity can be detected in Arabidopsis transformed with promoter ProGES fragments of different lengths P1, P2, P3 and P4, among which the activities of P3 and P4 are stronger than those of P1 and P2.

[0087] Example 4. Comparative analysis of the activity of the full-length ProGES promoter and the CaMV35S promoter

[0088] The CaMV35S promoter is the most commonly used promoter in commercial genetic engineering. The plant expression vector pEGProGUS-B carries the CaMV35S promoter to drive GUSPlus TM Therefore, pEGProGUS-B vector was selected as a comparison vector. Referring to the method in Example 3, Agrobacterium GV3101 infection fluid containing pEGProGUS-B and pEGProGUS-B-P4 was prepared respectively, and the activities of the full-length promoter ProGES and the CaMV35S promoter were compared and analyzed by using the Nicotiana benthamiana transient expression system, GUS staining and GUS enzyme activity detection.

[0089] GUS staining results Fig. 9 As shown, both the full-length ProGES promoter and the CaMV35S promoter can drive the expression of GUS protein. The infected parts of tobacco leaves are blue, and the parts driven by the ProGES promoter are darker in color.

[0090] GUS enzyme activity assay Fig.10 As shown, the GUS enzyme activity driven by the ProGES promoter is stronger than that driven by the CaMV35S promoter.

[0091] Example 5. Effects of the promoter ProGES on the transcriptional expression of the GES gene in response to different environmental stress treatments

[0092] In addition to core elements such as TATA-box and CAAT-box, the promoter ProGES also contains cis-acting elements of light, hormones and adverse stress, indicating that the promoter ProGES can regulate the transcriptional expression of the target gene in response to different environmental conditions. The stress-treated materials were derived from the Morinda officinalis tissue culture seedlings of the Guangdong Provincial Key Laboratory of Crop Genetic Improvement. The different stress treatments are shown in Table 6.

[0093] Table 6. Methods of different stress treatments

[0094]

[0095] The expression of GES gene was detected by real-time fluorescence quantitative PCR (qRT-PCR) reaction, and the regulatory mode of promoter ProGES on GES gene expression in response to external environmental stimuli was analyzed. TaKaRa MiniBEST Universal RNAExtraction Kit was used to extract total RNA from Morinda officinalis under different stress treatments; Evo M-MLV Reverse Transcription Kit (AG11705) was used to reverse transcribe and synthesize cDNA; Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712) and Bio-Rad CFX960 fluorescence quantitative PCR instrument were used for qRT-PCR reaction. MoGAPDH gene as an internal reference gene.

[0096] Design specific primer sequence combinations MoGAPDH-F / MoGAPDH-R, MoGES-F / MoGES-R, and prepare the following primers:

[0097] As shown in SEQ ID NO:9, MoGAPDH-F (5'-3'): GCTGGCATTGCYTTGAATCC;

[0098] As shown in SEQ ID NO: 10, MoGAPDH-R (5'-3'): AATCAACCACGCGAGAACTG;

[0099] As shown in SEQ ID NO: 11, MoGES-F (5'-3'): TGATCTGGGAACTGCAAAGG;

[0100] As shown in SEQ ID NO: 12, MoGES-R (5'-3'): GACCCTCTTCGTCTGATGTTATG.

[0101] The cDNA synthesized by reverse transcription was used as a template for qRT-PCR reaction. The reaction program was as follows: pre-denaturation, 95°C, 30s; denaturation, 95°C, 10s; extension, 60°C, 30s; fluorescence collection, 40 cycles; melting curve (default program). The fluorescence quantitative qRT-PCR reaction system is shown in Table 7.

[0102] Table 7. qRT-PCR reaction system

[0103]

[0104] The stress treatment used Morinda officinalis with normal growth as the control group (0 h), and Morinda officinalis with different treatment times as the experimental group; the light / dark treatment used Morinda officinalis with dark treatment as the control group, and the light treatment as the experimental group; 2 −ΔΔCtMethods The relative expression of GES gene after treatment was calculated.

[0105] The results are as follows Fig.11 As shown in the figure, the expression of GES was downregulated under high temperature and salt stress; it first increased and then decreased under low temperature, MeJA, PDJ and drought stress; compared with the dark treatment, light can significantly induce the expression of GES gene. The above results show that the promoter ProGES can respond to different environmental conditions and regulate the transcriptional expression of the target gene.

[0106] According to the customary usage in the technical field of the present invention, mmol / L may be abbreviated as mM; μmol / L may be abbreviated as μM.

Claims

1. A promoter ProGES of Morinda officinalis GES gene, characterized in that: The nucleotide sequence of the promoter ProGES of the Morinda officinalis GES gene is shown in SEQ ID NO:

1.

2. A method for preparing the promoter ProGES of the Morinda officinalis GES gene according to claim 1, characterized in that: The steps include: (1) Extracting Morinda officinalis genomic DNA; (2) Using the genomic DNA of Morinda officinalis as a template, the promoter ProGES of the Morinda officinalis GES gene was amplified by PCR using primers ProGES-F and ProGES-R, where: The sequence of ProGES-F is: TGACTTTAAACCCTAACACCGTTTATC; The sequence of ProGES-R is: GTTTTTTTTCTCCTCTATTTTTTGCGCT; (3) Use an agarose gel recovery kit to recover the promoter ProGES fragment of the Morinda officinalis GES gene from the PCR product.

3. The preparation method according to claim 2, characterized in that: Specifically, step (1) comprises taking 0.5 g of leaves of Morinda officinalis tissue culture seedlings, grinding them into powder in liquid nitrogen, and then extracting Morinda officinalis genomic DNA using a plant genomic DNA extraction kit.

4. The preparation method according to claim 2, characterized in that: In step (2), the PCR reaction conditions are: 95°C, pre-denaturation for 3 min; 95°C, denaturation for 15 s; 57°C, annealing for 20 s; 72°C, extension for 90 s; amplification for 35 cycles; 72°C, final extension for 10 min.

5. The preparation method according to claim 2, characterized in that: In step (2), the reaction components of the PCR reaction system and their addition amounts are as follows: Add 25 μL of 2× Phanta Max Buffer; Add 1 μL of 10 mM each dNTP Mix; Add 1 μL of Phanta Max Super-Fidelity DNA Polymerase; 2 μL of ProGES-F at a concentration of 10 μM was added; 2 μL of ProGES-R at a concentration of 10 μM was added; 100 ng of Morinda officinalis genomic DNA was added; Add ddH20 to make up to 50 μL.

6. Use of the promoter ProGES according to claim 1 to promote the expression of a target gene in a plant, wherein the plant is Morinda officinalis, Arabidopsis thaliana or Nicotiana benthamiana.

Images