A positive regulatory factor zmgid1l2 for regulating drought tolerance of maize and application thereof

By screening and regulating the maize ZmGID1L2 gene, and utilizing CRISPR/Cas9 gene editing technology and genetic transformation, the problem of insufficient research on maize drought resistance was solved, and the growth and yield of maize under drought conditions were improved.

CN117904137BActive Publication Date: 2026-03-17HENAN ACAD OF AGRI SCI INST OF GRAIN CROPS +1
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-31
Publication Date
2026-03-17

AI Technical Summary

Technical Problem

There is limited research on drought resistance in existing technologies, especially regarding the function of the Abhydrolase_3 subfamily in the GA receptor, which has resulted in limited growth and development of maize under drought stress, affecting yield and quality.

Method used

The ZmGID1L2 gene in maize that actively responds to drought was screened out. Through genetic transformation and CRISPR/Cas9 gene editing technology, the gene was knocked out or overexpressed to regulate the drought resistance of maize. A recombinant vector overexpressing the ZmGID1L2 protein was constructed and transferred into maize through Agrobacterium genetic transformation.

Benefits of technology

It significantly improved the drought resistance of maize, shortened the flowering-silking interval, enhanced the growth and yield of maize under drought conditions, and provided a theoretical basis for breeding new drought-resistant maize varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117904137B_ABST
    Figure CN117904137B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of molecular breeding and relates to a method for cultivating new drought-resistant plant varieties, specifically a positive regulatory factor for regulating drought resistance in maize. ZmGID1L2 Its applications. This invention screened a gene that actively responds to drought using transcriptome sequencing results. ZmGID1L2 This gene is located on chromosome 4 of maize, encodes 327 amino acids, and contains an Abhydrolase_3 domain. The results indicate that... ZmGID1L2 Genes play a crucial role in drought stress, positively regulating drought resistance in maize. This not only contributes to elucidating the role of maize... ZmGID1 This lays the foundation for the biological functions of family members, provides new ideas for drought-resistant molecular breeding, and stores molecular resources for the cultivation of drought-resistant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular breeding and relates to a method for cultivating new drought-resistant plant varieties, specifically a positive regulatory factor for regulating drought resistance in maize. ZmGID1L2 And its applications. Background Technology

[0002] corn( Zea mays L Maize is an important food, economic, and feed crop. However, maize is subject to various abiotic stresses during its growth and development. Among these, drought stress has become a significant abiotic stress factor limiting maize growth, development, and yield. During critical growth stages, prolonged drought leads to phenomena such as "female imbalance" and "uneven grain production," severely impacting maize yield and quality. Therefore, improving maize's tolerance to drought stress to increase yield is a crucial current objective. Currently, technologies such as transgenics and gene editing are used to directionally express drought-resistant genes in different species, enabling targeted genetic improvement of superior genes and providing a more direct and effective method for drought-resistant maize breeding. Therefore, efficiently identifying key drought-resistant genes and analyzing their genetic mechanisms for coping with water shortages is of great significance for ensuring high and stable grain yields.

[0003] Gibberellins (GA) are hormones that play an important role in plant growth and development, promoting seed germination, cell differentiation, and the development of stems, leaves, flowers, and fruits, as well as the accumulation of bioactive substances. GID1s (Gibberellinin-sensitive dwarf1) are GA receptor proteins, soluble proteins located in the cytoplasm and nucleus. GUIDE1 Gene research began with rice, specifically with rice GA-insensitive mutants. guide1 Found in OsGID1 Not only do they affect plant growth and development, but they also interact with defense-related signaling pathways, playing a crucial role in plant resistance to pathogens. To date, three GID1 genes with GA receptor function have been identified in Arabidopsis thaliana, named... AtGID1a (At3g05120)、AtGID1b (At3g63010) and AtGID1c (At5g27320) These genes are functionally separate yet complementary, and each gene may play a specific role in different tissues, organs, and developmental stages. Six genes have been cloned from cotton. GhGID1 This gene provides a potential target gene for promoting fiber development and improving cotton fiber yield and quality by regulating the gibberellin response. In rice... GID1L2(Os06g0214800, Os07g0162900) The gene involved in regulating plant height and tillering in rice reveals a novel mechanism by which OsAP2-39 controls the ABA / GA balance in rice, thereby regulating plant growth and seed production.

[0004] Although there are numerous reports on the functions of the GID1 gene family, research on its drought resistance in maize is limited. For example, application CN111778265A only discloses its ability to reduce plant height and improve drought resistance in plants such as Arabidopsis thaliana, while no reports have been made on the Abhydrolase_3 subfamily within the GA receptor. The Abhydrolase_3 gene family belongs to the α / β hydrolase superfamily, which includes various enzymes such as carboxylesterases and hormone-sensitive lipases, widely distributed in plants, animals, and microorganisms. The original function of the Abhydrolase_3 gene family was esterase hydrolase activity. Building upon this, the gene family has differentiated into various functions, such as participation in the synthesis of secondary metabolites. In addition, this gene family is also involved in plant disease resistance and stress response, as well as hormone signaling pathways. The functional differentiation of the Abhydrolase_3 gene family may be due to variations in protein structure and enzyme activity caused by gene duplication and mutation during evolution, resulting in a diverse range of functions.

[0005] Plant drought resistance is a complex trait, and the drought resistance regulation mechanism involves multiple genes. However, current research on the function of GID is mostly focused on plants such as Arabidopsis thaliana, cotton, and rice. In order to further study the function of GID-related genes and explore the properties related to drought resistance, this application has conducted in-depth research. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention discloses a positive regulatory factor ZmGID1L2 for regulating drought resistance in maize and its applications.

[0007] The technical solution of this invention is implemented as follows:

[0008] This application screened a gene that actively responds to drought from DAP-Seq and RNA-Seq sequencing results of maize. ZmGID1L2 Furthermore, through genetic transformation, it was confirmed that it positively regulates the drought resistance of maize.

[0009] Firstly, a request is made to protect positive regulatory factors. ZmGID1L2 Its application in regulating the drought resistance of maize is shown in SEQ ID No. 1.

[0010] Secondly, it is requested that the positive regulatory factors be protected. ZmGID1L2 Application in regulating the interval between flowering and silking stages of maize under drought stress.

[0011] The above positive regulatory factors ZmGID1L2 The encoded protein has a conserved amino acid sequence containing an Abhydrolase_3 domain.

[0012] The amino acid sequence of the protein described above is shown in SEQ ID No. 2.

[0013] Thirdly, protection is requested for a recombinant vector containing the positive regulatory factor ZmGID1L2, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0014] Furthermore, the aforementioned recombinant vector is a recombinant vector that overexpresses the ZmGID1L2 protein.

[0015] Fourthly, we request protection of a method for breeding maize varieties resistant to drought stress.

[0016] Fifthly, protection is requested for a method to shorten the flowering-silking interval of maize under drought stress.

[0017] The implementation steps of the methods in the fourth and fifth aspects mentioned above are as follows: construct the recombinant vector that overexpresses the ZmGID1L2 protein, and then transfer it into maize by Agrobacterium genetic transformation to obtain maize varieties with the target agronomic traits.

[0018] The plant mentioned above refers to corn.

[0019] Specifically, the corn is the corn inbred line B104.

[0020] The present invention has the following beneficial effects:

[0021] 1. This application screened a gene that actively responds to drought from DAP-Seq and RNA-Seq sequencing results of maize. ZmGID1L2 Furthermore, through genetic transformation, it was confirmed that it positively regulates the drought resistance of maize.

[0022] 2. This application utilizes CRISPR / Cas9 gene editing technology and transgenic technology to target maize... ZmGID1L2 Gene knockout and overexpression were achieved, and the plants were subjected to drought treatment. The results showed that CRISPR / Cas9 knockout technology effectively knocked out the gene. ZmGID1L2 Genes that completely lose their function will reduce the plant's tolerance to drought stress; transgenic technology can increase... ZmGID1L2 The expression of this gene can better elucidate its function. Using CRISPR / Cas9 gene editing and transgenic technology, it was demonstrated that… ZmGID1L2 Genes play a positive regulatory role in drought processes, providing new insights for breeding drought-resistant maize plants.

[0023] 3. This application discloses a novel regulatory factor, which, through experimental research, has been found that... ZmGID1L2 It is a key regulator of gene expression. Under drought stress conditions, ZmGID1L2After knockout, compared with WT, the survival rate of mutant plants decreased by 42.67%, and the contents of POD, SOD, CAT, Sp, Car, Chl, Pro, and RWC decreased, while the MDA level increased. ZmGID1L2 Actively participating in drought stress response, the loss of function of this gene significantly reduced the drought resistance of maize seedlings and delayed the development of male and female ears. Under drought conditions, the flowering time (FT), silk emergence time (DSE), and flowering-silking interval (ASI) of mutant plants were significantly higher than those of WT plants, while the nutrient biomass of mutant plants was significantly lower than that of WT plants, decreasing by 17.80%. Furthermore, under drought conditions, the growth status and seed quantity of mature ears in WT plants were significantly better than those in mutant plants. These results indicate that, compared with WT, ZmGID1L2 The loss of this function increases sensitivity to drought. Additionally, ZmGID1L2 Overexpression significantly improved the drought resistance of maize. To further understand maize... ZmGID1 The evolution of family genes and their potential role in genetic improvement provide new insights. Therefore, they offer significant advantages in breeding plants with drought resistance. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 for ZmGID1L2 The gene structure diagram.

[0026] Figure 2 for ZmGID1L2 Agarose gel electrophoresis image of the PCR amplification product of the full-length cDNA sequence.

[0027] Figure 3 To knock out ZmGID1L2 Phenotypic changes and physiological and biochemical indicators of transgenic plants under drought treatment.

[0028] Figure 4 To knock out ZmGID1L2 Diagram showing the spike differentiation and agronomic traits of transgenic plants under drought treatment.

[0029] Figure 5 For overexpression ZmGID1L2 Phenotypic changes in positive transgenic plants under drought treatment. Detailed Implementation

[0030] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.

[0031] This application screened a gene that actively responds to drought from DAP-Seq and RNA-Seq sequencing results of maize. ZmGID1L2 Furthermore, through genetic transformation, it was confirmed that it positively regulates the drought resistance of maize.

[0032] Firstly, a request is made to protect positive regulatory factors. ZmGID1L2 Its application in regulating the drought resistance of maize is shown in SEQ ID No. 1.

[0033] Secondly, it is requested that the positive regulatory factors be protected. ZmGID1L2 Application in regulating the interval between flowering and silking stages of maize under drought stress.

[0034] The above positive regulatory factors ZmGID1L2 The encoded protein has a conserved amino acid sequence containing an Abhydrolase_3 domain.

[0035] The amino acid sequence of the protein described above is shown in SEQ ID No. 2.

[0036] Thirdly, protection is requested for a recombinant vector containing the positive regulatory factor ZmGID1L2, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0037] Furthermore, the aforementioned recombinant vector is a recombinant vector that overexpresses the ZmGID1L2 protein.

[0038] Fourthly, we request protection of a method for breeding maize varieties resistant to drought stress.

[0039] Fifthly, protection is requested for a method to shorten the flowering-silking interval of maize under drought stress.

[0040] The implementation steps of the methods in the fourth and fifth aspects mentioned above are as follows: construct the recombinant vector that overexpresses the ZmGID1L2 protein, and then transfer it into maize by Agrobacterium genetic transformation to obtain maize varieties with the target agronomic traits.

[0041] The plant mentioned above refers to corn.

[0042] Specifically, the corn variety is the corn inbred line B104. The following specific embodiments further explain the above technical solution:

[0043] Example 1: ZmGID1L2 Gene structure analysis

[0044] The application requests that the research group screen a gene that actively responds to drought using DAP-Seq and RNA-Seq sequencing results in the early stages. ZmGID1L2 ( Zm00001d050493 Analysis of the gene sequence using the maize genome database EnsemblPlants (http: / / plants.ensembl.org / index.html) revealed that the gene is located on chromosome 4 of maize, with a coding region of 984 bp, encoding 327 amino acids, and no intron regions. Figure 1 ).

[0045] Sequence analysis of this gene revealed... ZmGID1L2 It has a conserved amino acid sequence containing the Abhydrolase_3(PF07859) domain. This gene family belongs to the α / β hydrolase superfamily and is widely distributed in the biological world.

[0046] Example 2: ZmGID1L2 Cloning of genes

[0047] Total RNA extracted from maize inbred line B73 seedlings was reverse transcribed to obtain cDNA, which was then used as a module. The cDNA was downloaded from the EnsemblPlants website. ZmGID1L2 The full-length cDNA of the gene was obtained, and specific primers were designed using the NCBI website (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome).

[0048] ZmGID1L2 -F:

[0049] ATGGCCGCCGCACCCGTCGC;

[0050] ZmGID1L2 -R:

[0051] TCAGCGGTTGAGGAAGTCGC;

[0052] Amplification is performed.

[0053] The amplification program was as follows: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 1 min, 35 cycles, and a final extension at 72℃ for 5 min.

[0054] The results of 1% agarose gel electrophoresis showed a single target fragment with a band size of 984 bp. Figure 2 The gel-recovered product was ligated into the PMD18-T vector, and positive colonies were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results were compared with those of the B73 genome using vector software. ZmGID1L2 The CDS sequence was compared with the reference sequence, and the results showed that the cloned gene was consistent with the reference sequence, both encoding 327 amino acids.

[0055] Example 3: Knockout ZmGID1L2 Analysis of phenotypic changes and physiological and biochemical indicators of transgenic plants under drought treatment

[0056] To verify ZmGID1L2 Its role in drought stress was investigated by knocking out the maize inbred line B104 using CRISPR / Cas9 technology. ZmGID1L2 Filter on the website http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html ZmGID1L2 Identify the cleavage target and design primers:

[0057] F1:ATTGGTCTCCGTCGAGTACCGCC;

[0058] R1:AAACGGCGGTACTCGACGGAGAC;

[0059] F2:ATTGGCGAGGCAGAGATTTGGCA;

[0060] R2:AAACTGCCAAATCTCTGCCTCGC.

[0061] Double knock ( Figure 3 A) By knocking out the gene using gene editing technology, and then obtaining a positive homozygous mutant with mutations at both target sites through PCR detection and sequencing. zmgid1l2 The two target sites of Cas9 cutting are located at ZmGID1L2 Within the exon, this leads to a frameshift ( Figure 3 B). Mutant strain zmgid1l2 It exhibits low expression levels and lacks conserved dehydrogenation domains. Figure 3 C). From a phenotypic perspective, zmgid1l2 It reduced the drought resistance of corn seedlings. Figure 3D). Under drought stress, compared with WT, the survival rate decreased by 42.67%, and the contents of POD, SOD, CAT, Sp, Car, Chl, Pro, and RWC decreased by 24.98%, 23.72%, 34.21%, 39.58%, 46.81%, 37.16%, 29.22%, and 25.97%, respectively, while the MDA level increased by 1.41 times. Figure 3 EI). In summary, ZmGID1L2 Actively participates in drought stress response; loss of function of this gene significantly reduces drought resistance in maize seedlings.

[0062] Example 4: Knockout ZmGID1L2 Analysis of spike differentiation and agronomic traits of transgenic plants under drought treatment

[0063] WT and under drought stress zmgid1l2 The development of male spikes and panicles at stages V10-v14 in the mutant strain was analyzed. Compared with normal conditions, the WT and [other parameters] under drought stress were [higher / low ... zmgid1l2 The mutant plants exhibit delayed development. WT and zmgid1l2 The mutant strains exhibited similar developmental patterns, while zmgid1l2 The mutant strain developed slightly later under drought stress. Figure 4 AB).

[0064] To prove ZmGID1L2 To investigate whether drought stress affects key agronomic traits, WT and transgenic lines were planted in a rain shelter and subjected to normal and drought treatments, respectively, until maturity. The results showed that under normal growth conditions, zmgid1l2 The mutant plants were similar in height to the WT plants, but under drought conditions, they were shorter than those under normal conditions. The mutants exhibited more sensitive characteristics than WT plants, showing more dead leaves under drought conditions. Figure 4 CD). Under normal conditions, zmgid1l2 The flowering time (FT) and filament emergence time (DSE) of the mutant were similar to those of the WT; however, under drought conditions, zmgid1l2 The mutant showed significantly increased FT and DSE compared to the WT, both increasing by 1.05 times. Figure 4 E); Under drought conditions zmgid1l2 The flowering-silking interval (ASI) of the mutant was also significantly longer than that of the WT mutant, increasing by 1.35 times. Figure 4 E). Under normal conditions, zmgid1l2 The mutant's nutrient biomass was consistent with that of the WT mutant; under drought conditions, the mutant's nutrient biomass decreased by 17.80% compared to the WT mutant. Figure 4 E). Furthermore, under drought conditions, the growth status and fruit yield of mature WT ears were significantly better than those of other ears. zmgid1l2 mutant ( Figure 4 F). These results indicate that, compared to WT, zmgid1l2 The loss-of-function mutant increases sensitivity to drought.

[0065] Example 5: Overexpression ZmGID1L2 Phenotypic changes in positive transgenic plants under drought treatment

[0066] Designing primers for the target gene using NCBI:

[0067] ZmGID1L2 -pFGC5941-AscI-F:

[0068] ATTACCATGGGGCGCCATGGCCGCCGCACCCGTCGC;

[0069] ZmGID1L2 -pFGC5941-BamHI-R:

[0070] TCTAGACTCACCTAGGATCCGCGGTTGAGGAAGTCGCTGA.

[0071] The existing original vector pFGC5941 was linearized by double digestion with AscI and BamHI, and the target gene was ligated into the expression vector pFGC5941 using homologous recombination technology (Vazyme). ZmGID1L2 -pFGC5941 vector. Genetic transformation with Agrobacterium tumefaciens was used to... ZmGID1L2 Gene overexpression was achieved by introducing it into the maize inbred line B104. Positive lines (OE) with high expression levels were selected, and phenotypic identification was performed on WT and overexpressing plants. Figure 5 The results showed that under normal growth conditions, both WT and overexpression plants exhibited consistent and good growth. After 7 days of drought treatment, WT plants showed severe leaf curling, wilting, chlorosis, and death; while the overexpression plants showed significantly better growth than wild-type plants. This indicates that overexpression... ZmGID1L2 It can improve the drought resistance of corn seedlings; this gene positively regulates the drought tolerance of the plant.

[0072] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A positive regulator ZmGID1L2 use in modulating drought tolerance in maize, characterized in that: The forward regulatory factor ZmGID1L2 The nucleotide sequence of the forward regulatory factor is shown as SEQ ID No. 1; the forward regulatory factor ZmGID1L2 Located on chromosome 4 of maize, containing Abhydrolase_3 domain, belonging to the α / β hydrolase superfamily.

2. Positive regulator ZmGID1L2 In the use in the regulation of the time between the corn flowering and the silk emergence under drought stress, characterized in that: The forward regulatory factor ZmGID1L2 The nucleotide sequence of the forward regulatory factor is shown as SEQ ID No. 1; the forward regulatory factor ZmGID1L2 Located on chromosome 4 of maize, containing Abhydrolase_3 domain, belonging to the α / β hydrolase superfamily.

3. A method of breeding a maize variety that is resistant to drought stress, characterized in that, The steps are as follows: Construct overexpression ZmGID1L2 The protein recombinant vector was then transferred into maize using Agrobacterium genetic transformation to obtain drought-resistant maize varieties; ZmGID1L2 The amino acid sequence of the protein is shown in SEQ ID No.

2.

4. A method of shortening the interval between the flowering and silking stages of maize under drought stress, characterized in that, The steps are as follows: Construct overexpression ZmGID1L2 The protein recombinant vector was then transferred into maize using Agrobacterium genetic transformation to obtain maize varieties with short flowering-silking intervals. ZmGID1L2 The amino acid sequence of the protein is shown in SEQ ID No.

2.

5. The method according to claim 3 or 4, characterized in that: ZmGID1L2 The corn is the corn inbred line B104.

Citation Information

Patent Citations

  • Mutant gene and mutant of corn gibberellin oxidase, expression vector and applications

    CN111778265A