SNP molecular marker related to growth performance of procambarus clarkii and application thereof

By developing an SNP molecular marker at the 42659bp position of the insulin-like growth factor receptor gene in the red swamp crayfish, and using HRM genotyping technology to screen individuals with the TT genotype as superior parents, the problem of germplasm degradation in the red swamp crayfish was solved, and breeding efficiency and growth performance were improved.

CN117925856BActive Publication Date: 2026-06-05HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410093499.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-23
Publication Date
2026-06-05
Estimated Expiration
2044-01-23

AI Technical Summary

Technical Problem

In existing technologies, the degradation of the germplasm resources of Procambarus clarkii leads to poor growth traits in crayfish farming, and the lack of effective molecular marker-assisted breeding technology affects breeding efficiency.

Method used

A SNP molecular marker located at 42659 bp of the insulin-like growth factor receptor gene in Procambarus clarkii was developed. Specific primers were designed for PCR amplification, and the genotype was identified by HRM genotyping technology. Individuals with the TT genotype were selected as superior parents.

Benefits of technology

It improves the breeding efficiency of red swamp crayfish, increases aquaculture output and income, and ensures excellent growth performance of offspring.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117925856B_ABST
    Figure CN117925856B_ABST
Patent Text Reader

Abstract

The application discloses a SNP molecular marker related to growth performance of Procambarus clarkii, which is located in the second last intron region of an insulin-like growth factor receptor gene of the Procambarus clarkii, and specifically at the 42659th bp of the full-length genome, and the alleles are C and T, wherein the average body weight of an individual with a TT genotype is significantly greater than that of an individual with a CC genotype and an individual with a CT genotype. The application further discloses primers for amplifying the SNP molecular marker and a growth performance typing identification method of the Procambarus clarkii, and has important significance in improving the growth performance and breeding efficiency of offspring shrimps, increasing the breeding yield and income and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular markers and relates to a SNP molecular marker related to the growth performance of Procambarus clarkii in aquaculture and its application. Background Technology

[0002] Red swamp crayfish (Procambarus clarkii) Procambarus clarkii ), belonging to the subphylum Crustacea, order Decapoda, family Astacidae, genus Procambarus ( Procambarus Originally from the United States and Mexico, crayfish were introduced to China from Japan in the 1930s. In recent years, crayfish production has increased year by year, and the scale of farming has continued to expand, making it a new species in my country's freshwater aquaculture industry. Statistics show that in 2022, my country's crayfish farming area reached 28 million mu (approximately 1.2 million hectares), with a production of 2.8907 million tons, continuing its rapid growth. However, due to long-term self-breeding and self-raising, crayfish germplasm resources have degraded, hindering the healthy development of the crayfish farming industry. Therefore, the selection and genetic improvement of *Procambarus clarkii* seedlings is urgently needed. Growth traits are one of the most important economic traits in breeding. Molecular marker-assisted breeding technology is needed to accelerate the selection of superior crayfish varieties, particularly those with rapid growth. Therefore, developing molecular markers related to crayfish growth performance is of great significance for the breeding of superior crayfish varieties.

[0003] Insulin-like growth factor (IGF) in crustaceans functions similarly to insulin, participating not only in glucose metabolism but also regulating cell growth and proliferation, as well as embryonic development. Studies have shown that the IGF receptor in the red swamp crayfish (Procambarus clarkii) can bind to IGF and transmit signals, promoting cell proliferation and growth. Therefore, the IGF receptor gene in the red swamp crayfish plays a role in regulating cell proliferation and growth, and participating in the growth and development of crustaceans. However, no SNP molecular markers related to growth traits on the IGF receptor gene have been reported.

[0004] This invention utilizes HRM genotyping technology and association analysis to successfully obtain a single SNP molecular marker significantly associated with body weight in *Procambarus clarkii*. Statistical analysis of individuals with different genotypes in the population revealed differences in growth performance, with the TT genotype exhibiting significantly higher body weight than the CT and CC genotypes. Therefore, this SNP molecular marker can be applied to the screening of *Procambarus clarkii* parents, thereby improving breeding efficiency. This invention not only develops an SNP molecular marker related to *Procambarus clarkii* growth but also provides a simple and rapid method for genotyping. Summary of the Invention

[0005] The first objective of this invention is to provide an SNP molecular marker related to the growth performance of Procambarus clarkii.

[0006] The SNP molecular marker is located at the 42659th bp of the full-length insulin-like growth factor receptor gene in the red swamp crayfish, with alleles C and T. Individuals with the TT genotype of this marker have a significantly higher average body weight than individuals with the CC and CT genotypes.

[0007] A second objective of this invention is to provide a primer for amplifying the SNP molecular marker.

[0008] The primers used to amplify the SNP molecular marker are shown in SEQ ID NO.1 for the forward primer and SEQ ID NO.2 for the reverse primer.

[0009] The third objective of this invention is to provide an application of the aforementioned SNP molecular marker or primer in the genotyping and identification of growth performance in Procambarus clarkii, which can be used to screen for Procambarus clarkii varieties with high body weight and good growth performance.

[0010] The fourth objective of this invention is to provide a kit for identifying the growth performance of Procambarus clarkii, which contains the aforementioned primers.

[0011] The fifth objective of this invention is to provide a method for identifying and classifying the growth performance of *Procambarus clarkii*, the method comprising the following steps:

[0012] 1) Extract genomic DNA from the red swamp crayfish;

[0013] 2) Using the extracted genomic DNA as a template, PCR amplification was performed using the primers described in claim 2;

[0014] 3) Detect the PCR amplification products.

[0015] The PCR amplification reaction system consisted of: 10 µL of 2× HRM Analysis PreMix; 0.6 µL of forward primer; 0.6 µL of reverse primer; 1 µL of template; and 20 µL of RNase-Free ddH2O.

[0016] The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 10 s, 60℃ annealing for 20 s, 72℃ extension for 30 s, for 40 cycles.

[0017] When detecting PCR amplification products, the fluorescence signal of the amplification products is collected, and the genotype of SNP molecular markers is analyzed by melting curve. If the detected genotype is TT, it is judged to be a species of red swamp crayfish with high body weight and good growth performance.

[0018] The beneficial effects of this invention are:

[0019] This invention proposes a novel molecular marker method for screening high-performing broodstock of *Procambarus clarkii*. The method involves PCR typing to identify the genotype of the broodstock at the specified SNP marker, selecting individuals with the TT genotype as parents for offspring. This invention allows for the accurate and rapid identification of high-quality, high-performing broodstock for breeding, significantly improving breeding efficiency, increasing aquaculture yields, boosting aquaculture income, and meeting market demands. Attached Figure Description

[0020] Figure 1 This is a sequencing peak diagram of different genotypes at the SNP g.42659C>T site on the insulin-like growth factor receptor gene of the red swamp crayfish.

[0021] Figure 2 This is a melting curve of SNP typing in 100 samples of Procambarus clarkii.

[0022] Figure 3 It uses software to... Figure 2 Using the CT genotype as a baseline, the resulting normalized melting curve can more accurately show the differences between the three genotypes. Detailed Implementation

[0023] The present invention will be further described in detail below with reference to specific embodiments.

[0024] Example

[0025] 1. Laboratory animals

[0026] The red swamp crayfish used in this experiment were collected from the crayfish breeding base of Huazhong Agricultural University in Sibaigong Village, Caidian District, Wuhan City, Hubei Province. One hundred crayfish were randomly selected from the same batch of breeding population in the same culture pond for morphological data measurement, and their abdominal muscle was dissected and collected. The initial stocking quality, feed administration, and daily management of the red swamp crayfish from the same batch were ensured to be consistent.

[0027] 2. Test Methods

[0028] 2.1 Extraction of genomic DNA from Procambarus clarkii

[0029] Genomic DNA was extracted from the red swamp crayfish according to the DNA extraction kit instructions. The specific steps are as follows:

[0030] (1) Take 25mg of the abdominal muscle of Procambarus clarkii and place it in a 1.5ml centrifuge tube. Before mixing, add no more than 80µL of Buffer GTL to the sample, and after mixing, add 100µL of Buffer GTL.

[0031] (2) Add 20µL Proteinase K and vortex to thoroughly mix the sample. Incubate in a 56℃ water bath until the tissue is completely lysed. During the incubation process, the centrifuge tube can be inverted or shaken periodically to disperse the sample.

[0032] (3) Add 200µL Buffer GL, vortex to mix thoroughly, and incubate in a 70℃ water bath for 10 minutes. After a short centrifugation, add 200µL anhydrous ethanol and vortex to mix thoroughly.

[0033] (4) After a brief centrifugation, add all the solution obtained in step 3 to the adsorption column (SpinColumns DM) that has been loaded into the collection tube. If the solution cannot be added all at once, it can be added in multiple batches. Centrifuge at 12000 rpm for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0034] (5) Add 500µL Buffer GW1 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12000rpm for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0035] (6) Add 500µL Buffer GW2 to the adsorption column (check that anhydrous ethanol has been added before use), centrifuge at 12000rpm for 1 minute, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube.

[0036] (7) Centrifuge at 12000 pm for 2 minutes and discard the waste liquid in the collection tube. Place the adsorption column at room temperature for several minutes to allow it to dry completely.

[0037] (8) Place the adsorption column in a new centrifuge tube (self-provided), add 50µL of Buffer GE or sterile water to the middle of the adsorption column, let it stand at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 1 minute, and collect the DNA solution.

[0038] (9) Use a nucleic acid protein analyzer and a quantitative analyzer to detect the DNA concentration (>50 ng / µL) and purity (OD260 / 280 1.7~1.9). Then, use 1% agarose gel electrophoresis to detect the DNA fragment integrity. Qualified DNA samples are stored at -20℃ for later use.

[0039] 2.2 Primer Design

[0040] A DNA sequence approximately 200 bp near the SNP marker in the insulin-like growth factor receptor gene (NCBI Gene ID: LOC123759723) was obtained from the genome of *Procambarus clarkii*. Primers were designed using Primer Premier 6.0 software. In designing PCR primers, in addition to following general principles, the product length was kept between 80 and 120 bp, and the SNP site was positioned as centrally as possible in the PCR product sequence. The final HRM PCR primers for amplifying SNP g.42659C>T were:

[0041] igfr -F:5'-CGACATCAGCAAGGCACTACA-3' (SEQ ID NO.1);

[0042] igfr -R:5'-GGACCATACCTCCTCTCTG-3' (SEQ ID NO. 2).

[0043] The sequence of the amplified fragment is as follows (SEQ ID NO.3), with the underlined sequence being the primer sequence:

[0044] CGACATCAGCAAGGCACTACA CATCAAAAAGTCAACCGCCAATTATTGCACAACTATATTCTAC[C / T]CAGTTCAAGACCCAGAACCAACATTGAAG CAGCAAGAGGAGGTATGGTCC

[0045] 2.3 Establishing the HRM PCR reaction system

[0046] The genomic DNA extracted in 2.1 was diluted to 50 ng / µL and used as a template. After primer synthesis, HRM PCR experiments were performed using a Roche LightCycler 480 II. The reaction system is shown in Table 1.

[0047] Table 1 Components of HRM PCR Reaction System

[0048] 2× HRM Analysis PreMix 10µL Forward primer (10 μM) 0.6µL Reverse primer (10 μM) 0.6µL template 1µL RNase-Free ddH2O Up to 20µL

[0049] 2.4 Setting up the HRM PCR reaction program

[0050] Table 2 HRM PCR reaction procedure

[0051]

[0052] When analyzing melting curves, △HRM is generally set to collect fluorescence once at 0.02~0.1℃.

[0053] Roche LightCycler 480 II instrument was used to collect melting curve signal parameters: Ramp Rate 0.05; Acquisitions 12.

[0054] 2.5 Data Analysis

[0055] Known SNPs were detected, with PCR products of 115 bp in length, from a total of 100 samples. The PCR product sequences were further analyzed using the Gene scanning analysis method in LightCycle 480 Software release 1.5.0 to identify the genotype of this SNP molecular marker in different samples. Melting curves from SNP genotyping (…) Figure 2 ) and a graph showing the differences between different genotypes of this SNP molecular marker ( Figure 3 It can clearly distinguish individuals with different genotypes.

[0056] 2.6 Correlation Analysis

[0057] One-way ANOVA was performed on the body weight of individuals with different genotypes of Procambarus clarkii. The LSD method was used to compare individuals with different genotypes that showed significant differences overall to obtain the correlation between genotype and body weight trait.

[0058] Table 3. Procambarus clarkii igfr Correlation analysis of gene SNP variations and body weight

[0059]

[0060] Note: Different lowercase letters within the same group indicate significant differences (P<0.05).

[0061] The analysis results showed that there was a significant correlation between the SNP g.42659C>T on the insulin-like growth factor receptor gene of *Procambarus clarkii* and the body weight of *Procambarus clarkii*, with individuals of the TT genotype having a significantly higher body weight than those of the CT genotype. P <0.001), and the body weight of individuals with the TT genotype was also significantly higher than that of individuals with the CC genotype ( P <0.01).

[0062] 3. From the above 100 red swamp crayfish samples, 48 ​​individuals were randomly selected, and the PCR products of the SNP sites were sequenced using Sanger sequencing to verify the accuracy of the HRM typing results.

[0063] Using the genomic DNA extracted in section 2.1 as a template, primers were synthesized. The PCR reaction volume was 50 µL, including 25 µL of 2×PCRMix, 2.5 µL each of forward and reverse primers, 2.5 µL of template DNA, and 17.5 µL of double-distilled water. The PCR reaction consisted of 30 cycles. Pre-denaturation was performed at 94 °C for 5 min before each cycle. Each cycle included denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 60 s. A final extension at 72 °C for 5 min followed by the end of each cycle was performed. The amplified products were detected by 1.5% agarose gel electrophoresis and then used for direct sequencing.

[0064] Sequencing results showed that only one of the 48 samples had a different genotype from the HRM typing results, and the HRM typing accuracy of SNPg.42659C>T was as high as 97.92%.

[0065] The above results indicate that the SNP molecular markers screened in this invention are associated with the growth performance of *Procambarus clarkii* (claw crayfish). Different genotypes of the SNP g.42659C>T are significantly correlated with the body weight of *Procambarus clarkii*, with individuals of the TT genotype showing significantly higher body weight than other genotypes. Furthermore, the accuracy of the HRM genotyping results demonstrates that this SNP genotyping technique is not only rapid but also maintains high accuracy while having a lower cost per sample than sequencing. This suggests that in subsequent *Procambarus clarkii* breeding work, applying this technique to screen parent stock, and prioritizing individuals with the TT genotype through SNP g.42659C>T genotyping as breeding parents, will ensure excellent growth performance in offspring. This invention provides guidance for the breeding of new *Procambarus clarkii* varieties.

Claims

1. The application of an SNP molecular marker in the genotyping and identification of growth performance in *Procambarus clarkii*, characterized in that: The SNP molecular marker is located at the 42659th bp of the full-length insulin-like growth factor receptor gene of the red swamp crayfish, with alleles C and T. The average body weight of individuals with the TT genotype marked by this marker is significantly greater than that of individuals with the CC and CT genotypes. The NCBI Gene ID of the insulin-like growth factor receptor gene of the red swamp crayfish is LOC123759723, and the growth performance refers to body weight.

2. The application of primers for amplifying the SNP molecular marker described in claim 1 in the genotyping and identification of growth performance in *Procambarus clarkii*, characterized in that: The forward primer sequence is shown in SEQ ID NO.1, and the reverse primer sequence is shown in SEQ ID NO.

2. The growth performance refers to body mass.

3. A method for typing and identifying the growth performance of *Procambarus clarkii* using the SNP molecular markers described in claim 1, characterized in that... Includes the following steps: 1) Extract genomic DNA from the red swamp crayfish; 2) Using the extracted genomic DNA as a template, PCR amplification is performed using the primers described in claim 2; 3) Detect the PCR amplification products. The growth performance is measured in terms of body mass.

4. The method for typing and identifying the growth performance of *Procambarus clarkii* as described in claim 3, characterized in that... The PCR amplification reaction system was as follows: 10 µL of 2× HRM Analysis PreMix; 0.6 µL of forward primer; 0.6 µL of reverse primer; 1 µL of template; and 20 µL of RNase-Free ddH2O.

5. The method for typing and identifying the growth performance of *Procambarus clarkii* as described in claim 3, characterized in that... The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 2 min; 95℃ denaturation for 10 s, 60℃ annealing for 20 s, 72℃ extension for 30 s, for 40 cycles.

6. The method for typing and identifying the growth performance of *Procambarus clarkii* as described in claim 3, characterized in that: The fluorescence signal of the amplified product was collected, and the genotype of the SNP molecular marker was analyzed by melting curve analysis. If the detected genotype was TT, it was determined to be a species of red swamp crayfish with high body weight and good growth performance.

Citation Information

Patent Citations

  • SNP (single nucleotide polymorphism) site relevant to procambarus clarkia weight, specific primer and application

    CN109439774A

  • SNP (Single Nucleotide Polymorphism) molecular marker for improving disease resistance of procambarus clarkii and application

    CN113502337A