Application of gmtps2 protein and its encoding gene in improving soybean plant type and yield traits
Editing the soybean GmTPS2 gene using CRISPR/Cas9 technology to regulate soybean plant architecture solves the problem of unclear soybean plant architecture regulation mechanism, and achieves increased soybean plant height, reduced branching, increased number of nodes and grains per plant, and increased yield per plant.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-31
- Publication Date
- 2026-03-24
AI Technical Summary
Current technologies lack a clear understanding of the mechanisms and key genes involved in soybean plant architecture regulation, and there is a lack of effective methods to improve soybean yield per unit area.
CRISPR/Cas9 gene editing technology was used to edit the soybean GmTPS2 gene. By targeting and repairing the protein, the activity or content of GmTPS2 protein was changed, thereby regulating soybean plant architecture and increasing plant height, number of nodes, and number of pods.
It significantly increases soybean plant height and number of grains per plant, reduces the number of branches, and increases the yield per soybean plant.
Smart Images

Figure BDA0004690998050000071 
Figure HDA0004690998070000011 
Figure HDA0004690998070000012
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to the application of GmTPS2 protein and its encoding gene in improving soybean plant architecture and yield traits. Background Technology
[0002] The CRISPR / Cas9 system is an acquired immune system derived from Streptococcus spp., capable of defending against the invasion of foreign genes. It primarily consists of CRISPR and the specific Cas9 protein. CRISPR is a cluster of regularly spaced short palindromic repeats, a novel type of DNA repetitive sequence, composed of a series of short, highly conserved forward repeats interspersed with spacer sequences of similar length. The Cas9 protein is a multidomain protein composed of 1409 amino acids, containing two nuclease domains: RuvC-like and HNH. CRISPR / Cas9 technology recognizes target sites through a targeting sequence on sgRNA; the target sequence and target site recognize each other through complementary base pairing. Since its first application in gene editing in 2013, CRISPR / Cas9 technology has experienced rapid and widespread development.
[0003] The CRISPR / Cas9-based genome editing system consists of two parts: sgRNA and the Cas9 enzyme. This system can specifically recognize target sequences adjacent to the PAM (NGG) motif and cleave them 3 nt upstream to form a DSB (double strain break). Subsequently, the body repairs the damaged DNA through its own repair mechanisms, such as homologous recombination (HR) and non-homologous end joining (NHEJ). The NHEJ repair process can generate indels (including deletions and insertions), which in turn lead to frameshift mutations in the DNA coding sequence.
[0004] Crop plant architecture plays a decisive role in the morphogenesis of individual plants and crop populations, and is a crucial factor influencing plant yield, crop production level, and economic benefits. Crop plant architecture includes plant height, branching (tillering), leaf shape, and ear type (pod-setting habit). The domestication or improvement of crop plant architecture plays a vital role in achieving significant breakthroughs in crop yield. Currently, research on the regulatory mechanisms of soybean plant architecture and key regulatory genes is still in the exploratory stage, with few related research reports; the molecular mechanisms, key genes, and functional networks affecting soybean plant architecture regulation are not yet clearly defined. In particular, due to limitations in research materials, there is a lack of research on which plant architecture is more conducive to improving soybean yield under field production conditions. Therefore, further exploration of more plant architecture regulatory genes is not only of significant theoretical value for discovering superior soybean plant architecture regulatory genes and cultivating high-yielding ideal plant architectures; but also, through the creation of specific materials, it allows for the systematic evaluation and selection of ideal soybean plant architectures under production conditions, which has significant practical application value for ultimately realizing breeding applications and improving soybean yield. Summary of the Invention
[0005] The technical problem to be solved by this invention is how to improve the soybean plant type to obtain a target plant that is conducive to increasing soybean yield.
[0006] To solve the above-mentioned technical problems, the present invention first provides the application of GmTPS2 protein or expression substances of regulatory genes or substances that regulate the activity or content of said GmTPS2 protein.
[0007] The application can be any of the following:
[0008] U1) The application of GmTPS2 protein or expression substances of regulatory genes or substances that regulate the activity or content of said GmTPS2 protein in regulating soybean plant architecture.
[0009] U2) The application of GmTPS2 protein or its regulatory gene expression substance or substance regulating the activity or content of said GmTPS2 protein in the preparation of products that regulate soybean plant architecture.
[0010] U3) Application of GmTPS2 protein or expression substances of regulatory genes or substances that regulate the activity or content of said GmTPS2 protein in the cultivation of soybean plants with altered plant architecture.
[0011] U4) The application of GmTPS2 protein or expression substances of regulatory genes or substances that regulate the activity or content of said GmTPS2 protein in the preparation of products that cultivate soybean plants with altered plant architecture.
[0012] U5) Application of GmTPS2 protein or expression substances of regulatory genes or substances that regulate the activity or content of said GmTPS2 protein in soybean breeding.
[0013] The GmTPS2 protein is any one of the following proteins:
[0014] (a1) Proteins with amino acid sequences as shown in SEQ ID No. 3;
[0015] (a2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 3, which has more than 80% identity with the protein shown in a1) and has the function of regulating plant architecture.
[0016] (a3) The fusion protein obtained by attaching a tag to the end of any of the proteins defined in (a1)-(a2).
[0017] The purpose of soybean breeding may include altering soybean plant architecture.
[0018] The changes could include increasing soybean plant height and number of nodes, decreasing the number of branches, and increasing the number of pods and seeds per plant.
[0019] In the above applications, the GmTPS2 protein is derived from soybeans.
[0020] In the above applications, the substance regulating gene expression or the substance regulating the activity or content of the GmTPS2 protein is a biological material related to the protein, and the biological material is any one of the following:
[0021] B1) The nucleic acid molecule encoding the GmTPS2;
[0022] B2) Nucleic acid molecules that inhibit, reduce, or silence the expression of the gene encoding the GmTPS2 protein;
[0023] B3) An expression cassette containing the nucleic acid molecules described in B1) and / or B2);
[0024] B4) A recombinant vector containing the nucleic acid molecules described in B1) and / or B2), or a recombinant vector containing the expression cassette described in B3);
[0025] B5) Recombinant microorganisms containing the nucleic acid molecules described in B1) and / or B2), or recombinant microorganisms containing the expression cassette described in B3), or recombinant microorganisms containing the recombinant vector described in B4);
[0026] B6) A transgenic plant cell line containing the nucleic acid molecules described in B1) and / or B2), or a transgenic plant cell line containing the expression cassette described in B3);
[0027] B7) Transgenic plant tissue containing the nucleic acid molecules described in B1) and / or B2), or transgenic plant tissue containing the expression cassette described in B3);
[0028] B8) A transgenic plant organ containing the nucleic acid molecules described in B1) and / or B2), or a transgenic plant organ containing the expression cassette described in B3).
[0029] In the above applications, the nucleic acid molecule may be a gene as shown in B1) or B2) below:
[0030] B1) The nucleic acid molecule is any one of the following:
[0031] B11) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 2;
[0032] B12) The nucleotide is the cDNA molecule or DNA molecule of SEQ ID No. 1;
[0033] B2) The nucleic acid molecule may be any of the following:
[0034] B21) targets the gRNA of the gene encoding the GmTPS2 protein;
[0035] B22) DNA molecules that express the gRNA described in B21).
[0036] In this invention, the regulation can be increased, enhanced, or raised. The regulation can also be decreased, weakened, or reduced.
[0037] The present invention also provides a method for altering soybean plant architecture.
[0038] The method for altering soybean plant architecture provided by this invention includes reducing or silencing the activity and / or content of the GmTPS2 protein in the target soybean, and / or the expression level of the gene encoding the GmTPS2 protein, to alter soybean plant architecture.
[0039] In the above method, reducing or silencing the activity and / or content of the GmTPS2 protein in the target plant, or / and the expression level of the gene encoding the GmTPS2 protein, includes gene editing of the GmTPS2 gene in the starting plant using the CRISPR / Cas9 system, knocking out the gene encoding the GmTPS2 protein in the target soybean genome, and obtaining soybean plants with altered plant architecture.
[0040] In the above method, the GmTPS2 gene encodes the GmTPS2 protein.
[0041] In the above method, the target site for gene editing by the CRISPR / Cas9 system is a DNA molecule with nucleotide sequences from positions 2266 to 2285 of SEQ ID No. 1, located on the first exon.
[0042] The CRISPR / Cas9 system includes either 1) or 2):
[0043] 1) sgRNA, wherein the target sequence of the sgRNA is a DNA molecule whose nucleotide sequence is from position 2266 to 2285 of SEQ ID No. 1;
[0044] 2) DNA molecules that express the gRNA described in 1).
[0045] The gene editing involves introducing the CRISPR / Cas9 vector into the starting plant.
[0046] In the above method, the mutation that causes the GmTPS2 gene to change the soybean plant type is to delete positions 108-121 of SEQ ID No.2 while keeping other nucleotide residues unchanged.
[0047] The present invention also provides a substance for improving soybean plant architecture.
[0048] The improved soybean plant architecture material provided by this invention can be used in the CRISPR / Cas9 system for gene editing of the GmTPS2 gene; the target site for gene editing in the CRISPR / Cas9 system is positions 2266 to 2285 of SEQ ID No. 1 or positions 102 to 121 of SEQ ID No. 2.
[0049] The CRISPR / Cas9 system includes either 1) or 2):
[0050] 1) sgRNA, wherein the target sequence of the sgRNA is positions 2266 to 2285 of SEQ ID No. 1 or positions 102 to 121 of SEQ ID No. 2;
[0051] 2) A CRISPR / Cas9 vector expressing the sgRNA.
[0052] In this invention, the plant type includes plant height, branching (tillering), leaf shape, and spike type (pod-bearing habit), etc.
[0053] This invention demonstrates that modifying the soybean GmTPS2 gene using CRISPR / Cas9 gene editing technology can significantly increase soybean plant height, number of nodes per plant, and number of grains per plant, thereby increasing yield per plant. Attached Figure Description
[0054] Figure 1 The target sites for GmTPS2 gene editing and homozygous mutation types.
[0055] Figure 2 These are wild-type and homozygous mutant strains. Detailed Implementation
[0056] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0057] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.
[0058] The soybean Jack cultivated in the following examples is described in the following literature: Chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of soybean Agrobacterium-mediated transformation efficiency by adding glutamine and asparagine into the culture media. International Journal of Molecular Sciences 19, 3039. The biological material is available to the public from the applicant and is used only for repeating the experiments of this invention and shall not be used for any other purpose.
[0059] The Agrobacterium tumefaciens EHA105 used in the following examples is described in the following literature: Cai Y, Chen L, Liu X, Guo C, Sun S, Wu C, Jiang B, Han T and Hou W (2018a), CRISPR / Cas9-mediated targeted mutationnesis of GmFT2a delays flowering time in soya bean. Plant Biotechnol J16, 176-185. This biological material is available to the public from the applicant and is used only for repeating the experiments of this invention and shall not be used for any other purpose.
[0060] MS Salt: PhytoTech, catalog number: M524.
[0061] MS Organic: PhytoTech, Catalog No.: M533.
[0062] B5 Organic: Phytotech, catalog number: G219.
[0063] B5 Salt: Phytotech, Catalog No.: G768.
[0064] YEP solid medium consists of a solvent and a solute; the solutes and their concentrations in YEP solid medium are: NaCl 5 g / L, yeast extract 5 g / L, tryptone 10 g / L, and agar 15 g / L; the solvent is water. The pH of YEP solid medium is 7.0.
[0065] Germination medium (pH 5.8): 3.12 g / L B5 salt, 1 mL / L B5 organic, 20 g / L sucrose, 7.5 g / L agar, with the remainder being water.
[0066] Liquid culture medium (pH 5.4): 0.43 g / L MS salt, 1 mL / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.
[0067] Co-culture medium (pH 5.4): 0.43 g / L MS salt, 1 mL / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 7.5 g / L agar, 3.9 mg / L 2-morpholinoethanesulfonic acid, balance water.
[0068] Recovery medium (pH 5.4): 3.1 g / L B5 salt, 1 mL / L B5 organic, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 0.98 g / L 2-morpholinoethanesulfonic acid, 7.5 g / L agar, 4 mL / L FFe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.
[0069] Screening medium (pH 5.4): 3.1 g / L B5 salt, 1 mL / L B5 organic, 0.98 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 mL / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.
[0070] Elongation medium (pH 5.6): 4.0 g / L MS salt, 1 mL / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 0.1 mg / L IAA, 0.5 mg / L GA, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 mL / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.
[0071] Rooting medium (pH 5.7): 2.165 g / L MS salt, 1 mL / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 20 g / L sucrose, 7.5 g / L agar, 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.
[0072] The data in the following examples were processed using SPSS 11.5 statistical software. Experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, with P < 0.05 (*) indicating a significant difference compared to the control, and P < 0.01 (**) indicating a highly significant difference compared to the control.
[0073] Example 1: Construction of GmTPS2 gene editing CRISPR vector
[0074] I. Obtaining sgRNA
[0075] The soybean GmTPS2 genome sequence (nucleotide sequence is SEQ ID No. 1) was obtained from the Phytozome database. GmTPS2 is located on chromosome 2. The GmTPS2 sgRNA target sequence was selected using the online CRISPR-P tool (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). The target site is located in the first exon of GmTPS2, and the target sequence is: 5'-CGAGAACAATGGAGAAGCGA-3' (SEQ ID No. 1, positions 2266 to 2285), (corresponding to positions 102-121 of SEQ ID No. 2 (coding sequence)).
[0076] The vector pUC57-sgRNA-SpCas9 (nucleotide SEQ ID No. 4) was double-digested with restriction endonucleases NHeI and BbsI in a 50 μL system at 37 °C for 3 hours. The target band (approximately 3201 bp) was detected by 1% agarose gel electrophoresis and recovered. This target band contains an sgRNA expression cassette element driven by the AtU6 promoter.
[0077] Primers were synthesized according to the target sequence of the sgRNA, as follows (lowercase letters represent the target sites):
[0078] GmTPS2-Cas9-F:
[0079] 5'-TCGAAGTAGTGATTG cgagaacaatggagaagcga GTTTTAGAGCTAGAA-3';
[0080] GmTPS2-Cas9-R:
[0081] 5'-TTCTAGCTCTAAAAC tcgcttctccattgttctcg AATCACTACTTCGA-3'.
[0082] Add 5 μL each of the corresponding GmTPS2-Cas9-F and GmTPS2-Cas9-R primers (10 μM) to a centrifuge tube, and add 15 μL of ddH2O to bring the reaction volume to 25 μL. Anneal at 95℃ for 3 min, then anneal at 0.1℃ / s to 16℃, and hold at 16℃ for 10 min to complete annealing and form oligodimers. The oligodimer formed by GmTPS2-Cas9-F and GmTPS2-Cas9-R encodes an sgRNA targeting GmTPS2 (named sgRNA-GmTPS2).
[0083] Take 3.5 μL of the annealing product and 1.5 μL of the digested pUC57-sgRNA-SpCas9 carrier gel-recovered product, and use... The Ultra One Step Cloning Kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number C115-02) was used for ligation. *E. coli* DH5α was transformed using the freeze-thaw method, plated on LB+Amp solid medium, and incubated overnight at 37°C. Single colonies were picked, shaken, and sequenced. The sequencing primers were pSgRNA-CX: 5'-CGCCAGGGTTTTCCCAGTCACGAC-3'. Bacterial cultures with correct sequencing results were used for plasmid extraction. The extracted plasmid was named pUC57-sgRNA-SpCas9-GmTPS2.
[0084] Double digestion with restriction endonucleases PacI and PmeI was performed in a 50 μL system at 37°C for 3 hours. The pUC57-sgRNA-SpCas9-GmTPS2 plasmid was digested with PacI and PmeI, and the approximately 586 bp target fragment (sgRNA-SpCas9-GmTPS2) was recovered. The empty vector PTF101-SpCas9 plasmid was also digested with PacI and PmeI, and the approximately 14232 bp target fragment was recovered. Subsequently, sgRNA-SpCas9-GmTPS2 was ligated to the double-digested target fragment of the empty vector PTF101-SpCas9 plasmid (nucleotide code SEQ ID No. 5) using T4 DNA ligase (NEB, catalog number M0202V). The ligation was then performed using a freeze-thaw method to transform *E. coli* DH5α, plated on LB+Spe solid medium, and incubated overnight at 37°C. Single clones were picked, cultured, and sequenced to verify successful ligation. The sequencing primers were sgRNA-TYJC: 5'-TGGGAATCTGAAAGAAGAGAAGCA-3'. The plasmid that was verified to be correct was named pGmTPS2-sgRNA.
[0085] The recombinant plasmid pGmTPS2-sgRNA is a recombinant expression vector in which the expression cassette element of sgRNA containing the target sequence of GmTPS2 replaces the nucleotide sequence between the PacI and PmeI restriction sites on the PTF101-SpCas9 plasmid while keeping other nucleotide sequences unchanged.
[0086] Example 2: Obtaining and identifying the GmTPS2 mutant
[0087] I. Preparation of Recombinant Bacteria
[0088] The recombinant vector GmTPS2-sgRNA prepared in Example 1 was used.
[0089] Agrobacterium tumefaciens EHA105 was transformed by electroporation, and plasmids were extracted and sequenced for verification. The recombinant strain that was correctly sequenced was named EHA-GmTPS2-sgRNA.
[0090] II. Agrobacterium-mediated transformation
[0091] The constructed EHA-GmTPS2-sgRNA was transformed into the soybean variety Jack (hereinafter referred to as wild-type soybean) using Agrobacterium-mediated transformation. The specific method is as follows:
[0092] 1. Seed sterilization
[0093] 1) Take healthy, plump, uniform, and dry Jack soybean seeds that are free from pests, diseases, and spots, spread them evenly in a petri dish, and then place the petri dish in a desiccator.
[0094] 2) After completing step 1), place a 100mL beaker in the desiccator, pour 80mL of 12M sodium hypochlorite aqueous solution into the beaker, then slowly add 4mL of concentrated hydrochloric acid, and then quickly cover the desiccator, seal it with petroleum jelly, and place it for 16 hours for chlorine sterilization.
[0095] 2. Preparation of infecting bacterial solution
[0096] 1) Incubate the EHA-GmTPS2-sgRNA bacterial culture obtained above at 28℃, resuspend in liquid culture medium, and obtain OD. 600nm =0.6% of the infecting bacterial solution.
[0097] 2) Place the seeds treated in step 1 into a clean bench. Under a microscope, peel off the seed coat and separate the two cotyledons along the long axis, keeping the cotyledon with the intact hypocotyl. Make 3-5 cuts at the junction of the hypocotyl and cotyledon. Then, immerse the seeds in a 28°C incubator for 2 hours.
[0098] 3) Place the cotyledons with the inner (smooth) side up on a co-culture medium lined with sterile filter paper, and incubate in the dark at 22°C for 5 days.
[0099] 4) After 5 days of co-culture, the hypocotyl of the explants elongated to 2 cm. Part of the hypocotyl was cut off, leaving 0.5 cm. The treated explants were then placed in recovery medium and cultured at 28°C under 16 h light / 8 h dark conditions for 7 days.
[0100] 5) Remove the explants from the recovery medium, remove the new shoots, cut off part of the hypocotyl, leaving 0.5 cm of the hypocotyl, and then transfer the trimmed explants into the selection medium and culture them at 28℃ for 21 days under 16h light / 8h dark conditions.
[0101] 6) After 21 days of selection and induction, the explants produced a large number of adventitious buds. The cotyledons and brown leaves were removed, and the remaining parts were transferred to elongation medium for culture at 28°C under 16h light / 8h dark conditions.
[0102] 7) In the elongation medium, when the clustered buds produce 5-8cm young stems, cut them off from the base of the adventitious buds; dip the stem base in 1mg / LIBA solution for 1min, and then transfer it to the rooting medium for culture. Culture at 28℃ under 16h light / 8h dark conditions for one week. After a large number of roots are produced at the base of the stem, transplant them into pots. The resulting plants are T0 generation transformed soybeans.
[0103] III. Molecular Detection of Edited Plants
[0104] DNA was extracted from leaves of T0 generation transformed soybeans as a template for PCR molecular detection, with wild-type soybeans as a control.
[0105] PCR primers were designed near the target site of the GmTPS2 gene. Soybean genomic DNA was used as a template for PCR amplification and sequencing. Primers FMA-F (5'-CGGCAACTCCAGCAACATTC-3') and FMA-R (5'-TCATGATGACCGCCACTTACC-3') amplified the GmTPS2 gene. The PCR reaction mixture consisted of 12.5 μL of 2×PhantaMax Buffer, 0.5 μL of dNTP Mix (10 mM), 1 μL of DNA (200 ng / μL), 1 μL of FMA-F (10 pmol / μL), 1 μL of FMA-R (10 pmol / μL), 0.5 μL of Super-Fidelity DNA Polymerase, and 8.5 μL of ddH2O, for a total volume of 25 μL. The amplification reaction was performed at 95℃ for 3 min; followed by 35 cycles of 95℃ for 30 sec, 58℃ for 30 sec, and 72℃ for 1 min; and then 72℃ for 5 min. The PCR products were sent to the company for sequencing verification.
[0106] The plants exhibiting overlapping peaks near the target location were identified as heterozygous edited plants and named T0 generation GmTPS2 soybeans.
[0107] After sowing T0 generation GmTPS2 soybeans, seeds of T1 generation GmTPS2 soybeans were harvested and cultivated to obtain T1 generation GmTPS2 soybeans.
[0108] The T1 generation of GmTPS2 transgenic soybeans was detected using the above-mentioned PCR molecular detection method. Sequencing results showed that in the T1 generation of GmTPS2 transgenic soybeans, the mutant plants (GmTPS2) had the following mutation near the target site, causing premature termination of protein translation. Only one type of GmTPS2 gene mutation was found in the mutant plants, with a deletion of 14 bp. Figure 1 ).
[0109] Compared to wild-type soybean, the T1 generation gmtps2 soybean mutant plants exhibited the following mutation in the GmTPS2 gene (encoding gene of the GmTPS2 protein) on both homologous chromosomes: nucleotides 2272 to 2285 of SEQ ID No. 1 were deleted, while the other nucleotides of SEQ ID No. 1 remained unchanged. This GmTPS2 gene mutation type is -14 bp. Nucleotides 2272 to 2285 of SEQ ID No. 1 correspond to positions 108-121 of SEQ ID No. 2 (the coding sequence of the GmTPS2 gene), causing premature termination of translation and thus knocking out the GmTPS2 gene.
[0110] The T1 generation soybean mutant plants with homozygous mutation of the above gmtps2 gene were further cultured and screened to obtain T2 generation gmtps2 plants without transgenic elements, and phenotypic identification was performed.
[0111] IV. Mutant strain type identification
[0112] Potted plants can be grown outdoors in Beijing during the summer under natural sunlight. Each mutant strain should have 8-10 plants.
[0113] Plant type traits (plant height, number of nodes, number of branches) and the number of seeds produced by wild-type plants (control) and T2 generation soybean gmtps2 homozygous mutant (hereinafter referred to as mutant) were counted separately.
[0114] The results (Table 1) show that, in terms of plant type, compared with the control plant height of 98.4 cm, the mutant plant height averaged 102.8 cm, indicating a significant increase in height. Regarding branching phenotype, the control plant had 2.6 branches, while the mutant plant averaged 1.2 branches, showing a significant decrease in branching. Regarding the number of nodes, the control plant had 20.7 nodes, while the mutant plant averaged 21.6 nodes, indicating an increase in node number. In terms of pod and seed count, the control plant had 89.4 pods and 210.7 seeds, while the mutant plant had 101.2 pods and 243.9 seeds, showing a significant increase in both pod and seed count per plant.
[0115] Table 1. Statistics on soybean plant type data
[0116]
[0117] The results indicate that modifying the soybean GmTPS2 gene using CRISPR / Cas9 gene editing technology can significantly increase soybean plant height, reduce the number of branches, and increase the number of nodes.
[0118] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. The use of a substance that knocks out the expression of the GmTPS2 protein-encoding gene or reduces the activity or content of said GmTPS2 protein in any of the following: Application of U1 in regulating soybean plant architecture; Application of U2 in the preparation of products that regulate soybean plant architecture; Application of U3 in cultivating soybean plants with altered plant architecture; U4) Application in the preparation of products from soybean plants with altered plant architecture; Application of U5 in soybean breeding; The GmTPS2 protein is a protein with an amino acid sequence as shown in SEQ ID No. 3; The regulation of soybean plant architecture involves reducing the number of soybean branches and increasing the number of nodes, pods, grains, and plant height. The plant type change is a decrease in the number of soybean branches, and / or an increase in the number of plant nodes, pods, grains, and plant height; The purpose of the breeding is to select soybean varieties with reduced branching number and / or increased number of nodes, pods, grains, and plant height.
2. The application according to claim 1, characterized in that, The substance is a biomaterial related to the protein, and the biomaterial is any one of the following: B1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the GmTPS2 protein as described in claim 1; B2) An expression cassette containing the nucleic acid molecule described in B1); B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B4); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2); B7) A transgenic plant organ containing the nucleic acid molecule described in B1), or a transgenic plant organ containing the expression cassette described in B2).
3. The application according to claim 2, characterized in that, B1) The nucleic acid molecule is any one of the following: B11) Target the gRNA of the gene encoding the GmTPS2 protein as described in claim 1; B12) is a DNA molecule that expresses the gRNA described in B11).
4. A method for altering soybean plant architecture, characterized in that, This includes reducing the activity and / or content of the GmTPS2 protein as described in claim 1 in the target plant, or / and reducing the expression level of the gene encoding the GmTPS2 protein as described in claim 1, to alter the soybean plant type; the alteration of the soybean plant type is to reduce the number of soybean branches, or / and increase the number of plant nodes, pods, seeds, and plant height; the plant is soybean.
5. The method according to claim 4, characterized in that: This includes using the CRISPR / Cas9 system to analyze the starting plant. GmTPS2 Genes are edited, and the stated GmTPS2 A gene mutation causes premature termination of protein translation; introducing the mutated gene into the recipient plant... GmTPS2 Genes were used to obtain a target plant with a soybean plant type superior to the recipient plant; GmTPS2 The gene encodes the GmTPS2 protein as described in claim 1.
6. The method according to claim 5, characterized in that, The gene editing target of the CRISPR / Cas9 system is positions 2266 to 2285 of SEQ ID No. 1 or positions 102 to 121 of SEQ ID No. 2; The CRISPR / Cas9 system includes either 1) or 2): 1) sgRNA, wherein the target sequence of the sgRNA is positions 2266 to 2285 of SEQ ID No. 1 or positions 102 to 121 of SEQ ID No. 2; 2) A CRISPR / Cas9 vector expressing the sgRNA; The gene editing involves introducing the CRISPR / Cas9 vector into the starting plant.
7. The method according to claim 5 or 6, characterized in that, Make the GmTPS2 The mutation that causes premature termination of protein translation is as follows: deletion of positions 2272 to 2285 of SEQ ID No. 1, while keeping other nucleotide residues unchanged.