A method for preparing a weight-increasing strain of the bright-spotted flathorn soldier fly and its nucleic acid construct
By performing CRISPR/Cas9 gene editing for the fat droplet storage related protein editing gene (Lsd1) of black soldier fly, the problem of how to improve the individual quality of larvae and crude protein/greasing content was solved, and a significant weight gain effect was achieved.
Patent Information
- Application Number
- CN202310722779.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-19
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2043-06-19
AI Technical Summary
In germplasm development, there are still challenges in how to accelerate the development of bright spotted flat-horned soldier fly larvae, increase the individual quality of larvae, and improve the crude protein/greasage content of insects.
By selecting the protein-editing genes related to lipid droplet storage (Lsd1) as the target, the knockout of the Lsd1 gene is performed using CRISPR/Cas9 gene editing technology to achieve the development of the weight-enhancing strain of the black soldier fly larvae.
The weight and crude protein/greasage content of the black soldier fly larvae were successfully improved, achieving significant weight gain effect.
Smart Images

Figure CN117965621B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and specifically relates to a method for preparing a weight-increasing strain of a bright-spotted flathorn soldier fly and a nucleic acid construct thereof. Background Art
[0002] Hermetia illucens, commonly known as the black soldier fly, belongs to the order Diptera, family Schizontidae, and is an important resource insect. The larvae feed on decaying organic matter and animal feces in nature. This diet has great application value in the management of artificial environments. The growth and development cycle of black soldier flies is 40-45 days, and their reproductive and adaptability are very strong, making them easy to breed on a large scale for efficient treatment of organic waste such as kitchen waste and livestock and poultry feces. In addition, when feeding on organic waste, black soldier fly larvae can significantly reduce the pathogens in it, while effectively inhibiting the reproduction of houseflies.
[0003] Black soldier fly larvae can assimilate and enrich the protein and oil in organic waste during the conversion process, and have high nutritional value. The dry weight protein content of the 5th-instar black soldier fly larvae that feed on food waste is 37%-44%, and the dry weight oil content is 30%-37%. At the same time, residual pesticides and antibiotics in the waste are not easy to accumulate in the larvae. These characteristics make black soldier flies an alternative source of feed for livestock and aquaculture, and can partially replace traditional animal and plant proteins such as fish meal and soybean meal. At the same time, the insect feces produced by black soldier flies in the process of treating organic waste are rich in nitrogen and have high utilization value as a soil conditioner.
[0004] Based on its broad application prospects in treating organic waste and realizing the economic cycle of waste, black soldier flies have entered the field of vision of more and more researchers and have made significant progress in many aspects, but progress in germplasm development is still slow. How to speed up the development of larvae, how to increase the individual quality of larvae, and how to increase the crude protein / oil content of insect bodies are germplasm development issues that need to be solved urgently. CRISPR-based gene editing technology is a powerful tool for targeted trait improvement of species, and the selection of target genes is the core difficulty after the maturity of editing technology. At present, there are few successful implementation cases based on gene editing technology to develop better strains with economic traits. Therefore, suitable target genes for improving the economic traits of black soldier flies are urgently needed by the market. Summary of the invention
[0005] After extensive research and screening, the inventors found that lipid droplet storage-related protein editing genes are effective targets for improving the economic traits of black soldier flies. The first condition for candidates is that the mutant traits are relatively stable, the development cycle changes little, and the target gene with little impact on reproductive capacity is small. On this basis, effectively improving the insect body weight and crude protein / oil content is the second condition for candidates. Lipid droplet storage-related proteins are involved in lipid droplet fusion. In black soldier flies, their mutants affect lipid droplet utilization and can promote growth and development. Therefore, the present invention provides a lipid droplet storage-related protein editing gene (Lsd1) as a target for the development of black soldier fly weight-increasing strains, thereby completing the present invention.
[0006] Therefore, in order to achieve the development of a weight-gaining strain of black soldier flies by targeted gene editing, the purpose of the present invention is to provide a lipid droplet storage-related protein editing gene (Lsd1) as a target and the nucleic acid construct used, and the phenotype of the strain is weight gain of individual larvae.
[0007] The technical scheme of the present invention is as follows: a method for preparing a weight-increasing strain of a bright-spotted flathorn soldier fly and a nucleic acid construct thereof, comprising the following steps:
[0008] (1) constructing a Lsd1 gene knockout nucleic acid construct, performing PCR with the template primer sgRNA-F and the universal reverse primer, and recovering and purifying the PCR product to obtain the template sgRNA, wherein the sequence of the template primer sgRNA1-F is shown in SEQ NO.2 in the sequence list, the sequence of sgRNA2-F is shown in SEQ NO.3 in the sequence list, the sequence of sgRNA3-F is shown in SEQ NO.4 in the sequence list, the sequence of sgRNA4-F is shown in SEQ NO.5 in the sequence list, and the sequence of the universal reverse primer is shown in SEQ NO.6 in the sequence list;
[0009] (2) amplifying the sgRNA template described in step (1) in vitro to obtain a single-stranded sgRNA, that is, a knockout nucleic acid construct;
[0010] (3) co-transfecting the knockout nucleic acid construct and Cas9 protein described in step (2) into fresh insect eggs of the bright-spotted flathorn soldier fly, hatching to obtain the G0 generation, detecting the presence of mutations, and selfing to obtain the G1 generation;
[0011] (4) The G1 generation mutant heterozygote is self-pollinated for 2-3 generations, and a homozygote is obtained by detection, and then the homozygote is obtained and sub-generation breeding is performed.
[0012] In step (1), the PCR is conventional, preferably, the PCR reaction system is as follows: 5 μL of 10x KODPlus buffer; 5 μL of 2 mM dNTP mixture; 25 nM MgSO 43μL; template primer 2μL; universal reverse primer 2μL, KOD Plus enzyme 0.5μL; sterile double distilled water 32.5μL. Preferably, the reaction conditions of PCR in step (1) are as follows: 94℃2min; 94℃15s, 55℃30s, 68℃10s, 20 cycles; 68℃5min.
[0013] In step (2), the in vitro large-scale amplification is conventional, preferably performed using a kit. Preferably, the sequence of the single-stranded sgRNA is as shown in SEQ NO.7, SEQ NO.8, SEQ NO.9 or SEQ NO.10 in the sequence table.
[0014] The Cas9 protein in step (3) is conventional, preferably purchased from Thermo Fisher. Preferably, the final concentrations of the sgRNA and Cas9 protein are 100-200 ng / μL respectively. Preferably, the co-transfection in step (3) is performed in a microinjection instrument. Preferably, the incubation temperature in step (3) is 25-28°C
[0015] The heterozygous mutant in step (4) is preferably a genotype that causes premature termination of expression.
[0016] The present invention also provides a template primer for knocking out the Lsd1 gene of a black soldier fly, the sequence of which is shown in SEQ NO.2, SEQ NO.3, SEQ NO.4 or SEQ NO.5 in the sequence table.
[0017] The present invention also provides an sgRNA for knocking out the Lsd1 gene of a black soldier fly, the sequence of which is shown in SEQ NO.7, SEQ NO.8, SEQ NO.9 or SEQ NO.10 in the sequence table.
[0018] The present invention uses gene editing technology to achieve successful knockout of the Lsd1 gene, and detects mutations in two corresponding target sites at the genome level. The correctness of the mutant genotype can be determined by PCR amplification and sequencing; the phenotype of the mutant can be determined by weighing individual 5th instar larvae and lipid droplet staining. The target Lsd1 gene provided by the present invention has a significant effect on the weight of black soldier fly larvae and can be used as a target gene for the development of weight-increasing strains. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 The genotype detection results of the homozygous mutant. The red in the sequence indicates the PAM sequence base, the bold indicates the sgRNA sequence, the non-bold indicates the non-target sequence, the lowercase indicates the insertion or replacement sequence, the numbers in brackets indicate the number of missing bases before and after the target site, WT indicates the wild type, and lsd1-M1-M2 indicates the obtained homozygous mutant
[0020] Figure 2 The average fresh weight of mutants and wild-type individuals during development to the pupal stage is shown. The mutants showed a significant increase in weight in the middle and late fifth instar (295h), with an increase of 9.72%-15.74%. DETAILED DESCRIPTION
[0021] Preferred embodiments are given below and combined with the accompanying drawings to more clearly and completely illustrate the present invention.
[0022] The primer synthesis and sequencing in this article were completed by Sangon Biotechnology (Shanghai) Co., Ltd.
[0023] The molecular biology experiments in this article, including plasmid construction, competent cell preparation, transformation, etc., mainly refer to the Molecular Cloning Experiment Guide (4th edition, edited by MR Green, J. Sambrook (USA), translated by He Fuchu et al., Science Press, Beijing, 2017). Reverse transcription and sgRNA amplification can be performed according to the instructions of the relevant kits.
[0024] Example 1 Acquisition of primers
[0025] 1) Total RNA from the third instar larvae of black soldier fly was extracted and reverse transcribed into cDNA. The lipid droplet storage protein encoding gene Lsd1 was cloned using primers Lsd1-F: ATGGTTAAGCAACAGATAAAACG and Lsd1-R: TCAATAAACTCCATTTAAATTGTTC, and the cDNA was connected to the pJET1.2 vector for sequencing verification. The obtained gene sequence is shown in SEQ NO.1 in the sequence table.
[0026] 2) Select a target with a sequence length of 23 bp and a PAM sequence of NGG (5'-3') on the exon of the Lsd1 gene. The two target sequences selected are target 1 (sgRNA1: 5'AGCAGCGTTGCTCGCGACCGTGG 3') and target 2 (sgRNA2: 5'GGAGTACATGTCAGATCGCTTGG 3')
[0027] 3) Design primers to synthesize the corresponding sgRNA template. The primer sequences are as follows:
[0028] sgRNA1-F, as shown in SEQ NO.2 in the sequence list;
[0029] sgRNA2-F, as shown in SEQ NO.3 in the sequence list;
[0030] The reverse primer is universal primer R, as shown in SEQ NO.6 in the sequence table.
[0031] The primers were synthesized by Bioengineering.
[0032] Example 2 sgRNA template acquisition
[0033] The template primers sgRNA1-F and sgRNA2-F in Example 1 were respectively annealed and extended with a universal reverse primer by PCR to obtain a template.
[0034] The reaction system is as follows: 10x KOD Plus buffer 5 μL; 2mM dNTP mixture 5 μL; 25nM MgSO 4 3μL; template primer 2μL; universal reverse primer 2μL, KOD Plus enzyme 0.5μL; sterile double distilled water 32.5μL;
[0035] PCR reaction conditions: 94°C for 2 min; 94°C for 15 s, 55°C for 30 s, 68°C for 10 s, 20 cycles; 68°C for 5 min. The obtained PCR product was recovered and purified to obtain the template sgRNA.
[0036] The sequence of the template sgRNA is:
[0037] sgRNA-1: as shown in SEQ NO.7 in the sequence list
[0038] sgRNA-2: as shown in SEQ NO.8 in the sequence list
[0039] Example 3 Large-scale synthesis of sgRNA
[0040] The sgRNA template obtained in Example 2 was amplified in vitro using a kit to obtain a single-stranded sgRNA.
[0041] , using MAXIscript TM T7 Transcription Kit (Thermo Fisher). The reaction system is as follows: 0.5 μL ATP solution, 0.5 μL CTP solution, 0.5 μL GTP solution, 0.5 μL UTP solution, 1 μL template sgRNA (500 ng), 0.5 μL enzyme, 0.5 μL 10x reaction buffer, 1 μL enzyme-free water. After mixing, react at 37°C for 12 hours and purify to obtain sgRNA
[0042] Example 4 Black soldier fly egg microinjection
[0043] The sgRNA (single-stranded sgRNA-1 and sgRNA-2) obtained in Example 3 and Cas9 protein (ThermoFisher) were mixed to a final concentration of 100 ng / μL, 100 ng / μL, and 200 ng / μL, respectively, and injected into newly produced black soldier fly fertilized eggs using a microinjector. The injected eggs were incubated at 26°C to form the G0 generation.
[0044] Example 5 Target mutation detection
[0045] Take 30 newly hatched larvae to extract the genome, design primers upstream and downstream of the target site, and use PCR to detect the genome sequence to determine the mutant genotype. The mutation detection primers are:
[0046] lsd1-TS1-F: as shown in SEQ NO.11 in the sequence list
[0047] lsd1-TS1-R: as shown in SEQ NO.12 in the sequence list
[0048] lsd1-TS2-F: as shown in SEQ NO.13 in the sequence list
[0049] lsd1-TS2-R: as shown in SEQ NO.14 in the sequence list
[0050] Select Taq enzyme for PCR amplification, connect the target band to pJET1.2 for sequencing, and compare to confirm the mutation type. Generally, effective mutations in the G0 generation show double peaks in the sequencing peak graph. The appearance of double peaks in sequencing indicates that the target is successfully hit.
[0051] Example 6 Self-pollination screening homozygotes
[0052] The G0 generation that was successfully targeted in Example 5 was fed with wheat bran with a moisture content of 60% (w / w) at 28°C until 75% of the insect body entered the prepupal stage, and feeding was stopped. After natural pupation and emergence, the insects were allowed to mate freely, and the egg masses were collected and placed at 26°C for hatching, which was the G1 generation; 30 newly hatched larvae were taken to extract the genome, and primers were designed upstream and downstream of the target to detect the genomic sequence by PCR to determine the mutant genotype. Generally, the effective mutation in the G1 generation was heterozygous, and the heterozygous genotype that caused premature termination of translation was selected for feeding. After emergence, self-pollination was carried out again. According to the law of genetic segregation, a certain proportion of homozygous bodies will appear in the G2 generation, which is manifested as the wild-type genotype signal peak in the sequencing peak diagram of mutation detection becoming smaller, while the mutant genotype signal peak becomes larger; self-pollination was continued, and when the G3 generation laid eggs, 20-30 egg masses were collected, and each egg mass was tested for mutation to obtain a homozygous mutant, lsd1-M1 (-6, -7).
[0053] Figure 1The genotype detection results of the homozygous mutant. The red in the sequence indicates the PAM sequence base, the bold indicates the sgRNA sequence, the non-bold indicates the non-target sequence, the lowercase indicates the insertion or replacement sequence, the numbers in brackets indicate the number of missing bases before and after the target site, WT indicates the wild type, and lsd1-M1 (-6, -7) indicates the homozygous mutant obtained in this example.
[0054] Example 7 Growth Test
[0055] The homozygous mutant lsd1-M1 (-6, -7) obtained in Example 6 was placed in wheat bran with a moisture content of 60% (w / w) for feeding, the ambient temperature was set at 28°C, 30 heads per group, and 3 groups were tested in parallel; at the same time, the wild type was set as a control group under the same conditions; the total mass of all insects in each group and the total number of surviving insects were counted from 96 hours after hatching to obtain the average fresh weight of the insects. The statistics were performed until the pupation rate of each group reached more than 90%.
[0056] Figure 2 Shows the change in average fresh weight of mutant individuals and wild-type individuals during development to the pupal stage.
[0057] It can be seen that the mutant lsd1-M1 (-6, -7) showed a significant increase in body weight in the middle and late fifth instar (295h): the average body weight of the wild type was 0.216g, and the mutant body weight was 0.250g, an increase of 15.74%.
[0058] Example 8 Acquisition of Primers
[0059] 1) Select a target with a sequence length of 23 bp and a PAM sequence of NGG (5'-3') on the exon of the Lsd1 gene. The two target sequences selected are target 1 (sgRNA3: 5'GGTAGAGCAACGTGTTCCAGCGG 3') and target 2 (sgRNA4: 5'GATTGTAAAGGATCCAAAACAGG 3')
[0060] 2) Design primers to synthesize the corresponding sgRNA template. The primer sequences are as follows:
[0061] sgRNA3-F, as shown in SEQ NO.4 in the sequence list;
[0062] sgRNA4-F, as shown in SEQ NO.5 in the sequence list;
[0063] The reverse primer is universal primer R, as shown in SEQ NO.6 in the sequence table.
[0064] The primers were synthesized by Bioengineering.
[0065] Example 9 sgRNA template acquisition
[0066] The template primers sgRNA3-F and sgRNA4-F in Example 8 were respectively annealed and extended with a universal reverse primer by PCR to obtain a template.
[0067] The reaction system is as follows: 10x KOD Plus buffer 5 μL; 2mM dNTP mixture 5 μL; 25nM MgSO 4 3μL; template primer 2μL; universal reverse primer 2μL, KOD Plus enzyme 0.5μL; sterile double distilled water 32.5μL;
[0068] PCR reaction conditions: 94°C for 2 min; 94°C for 15 s, 55°C for 30 s, 68°C for 10 s, 20 cycles; 68°C for 5 min. The obtained PCR product was recovered and purified to obtain the template sgRNA.
[0069] The sequence of the template sgRNA is:
[0070] sgRNA-3: as shown in SEQ NO.9 in the sequence list
[0071] sgRNA-4: as shown in SEQ NO.10 in the sequence list
[0072] Example 10: Large-scale synthesis of sgRNA
[0073] The sgRNA template obtained in Example 9 was amplified in vitro using a kit to obtain single-stranded sgRNA, and MAXIscript was used. TM T7 Transcription Kit (Thermo Fisher). The reaction system is as follows: 0.5 μL ATP solution, 0.5 μL CTP solution, 0.5 μL GTP solution, 0.5 μL UTP solution, 1 μL template sgRNA (500 ng), 0.5 μL enzyme, 0.5 μL 10x reaction buffer, 1 μL enzyme-free water. After mixing, react at 37°C for 12 hours and purify to obtain sgRNA
[0074] Example 11 Black soldier fly egg microinjection
[0075] The sgRNA (single-stranded sgRNA-3 and sgRNA-4) obtained in Example 10 and Cas9 protein (ThermoFisher) were mixed to a final concentration of 100 ng / μL, 100 ng / μL, and 200 ng / μL, respectively, and injected into newly produced black soldier fly fertilized eggs using a microinjector. The injected eggs were incubated at 26°C to form the G0 generation.
[0076] Example 12 Target mutation detection
[0077] Take 30 newly hatched larvae to extract the genome, design primers upstream and downstream of the target site, and use PCR to detect the genome sequence to determine the mutant genotype. The mutation detection primers are:
[0078] lsd1-TS3-F: as shown in SEQ NO.11 in the sequence list
[0079] lsd1-TS3-R: as shown in SEQ NO.12 in the sequence list
[0080] lsd1-TS4-F: as shown in SEQ NO.15 in the sequence list
[0081] lsd1-TS4-R: as shown in SEQ NO.16 in the sequence list
[0082] Select Taq enzyme for PCR amplification, connect the target band to pJET1.2 for sequencing, and compare to confirm the mutation type. Generally, effective mutations in the G0 generation show double peaks in the sequencing peak graph. The appearance of double peaks in sequencing indicates that the target is successfully hit.
[0083] Example 13 Self-pollination screening homozygotes
[0084] The G0 generation that was successfully targeted in Example 12 was fed with wheat bran with a moisture content of 60% (w / w) at 28°C until 75% of the insect body entered the prepupal stage, and feeding was stopped. After natural pupation and emergence, the insects were allowed to mate freely, and the egg masses were collected and placed at 26°C for hatching, which was the G1 generation; 30 newly hatched larvae were taken to extract the genome, and primers were designed upstream and downstream of the target to detect the genomic sequence by PCR to determine the mutant genotype. Generally, the effective mutation in the G1 generation was heterozygous, and the heterozygous genotype that caused premature termination of translation was selected for feeding. After emergence, self-pollination was carried out again. According to the law of genetic segregation, a certain proportion of homozygous bodies will appear in the G2 generation, which is manifested as the wild-type genotype signal peak in the sequencing peak diagram of mutation detection becoming smaller, while the mutant genotype signal peak becomes larger; self-pollination was continued, and when the G4 generation laid eggs, 20-30 egg masses were collected, and each egg mass was subjected to mutation detection to obtain a homozygous mutant, lsd1-M1 (-2, -2).
[0085] Figure 1 The genotype detection results of the homozygous mutant. The red in the sequence indicates the PAM sequence base, the bold indicates the sgRNA sequence, the non-bold indicates the non-target sequence, the lowercase indicates the insertion or replacement sequence, the numbers in brackets indicate the number of missing bases before and after the target site, WT indicates the wild type, and lsd1-M2 (-2, -2) indicates the homozygous mutant obtained in this example.
[0086] Example 14 Growth Test
[0087] The homozygous mutant lsd1-M2 (-2, -2) obtained in Example 13 was placed in wheat bran with a moisture content of 60% (w / w) for feeding, the ambient temperature was set at 28°C, 30 heads per group, and 3 groups were tested in parallel; at the same time, the wild type was set as a control group under the same conditions; the total mass of all insects in each group and the total number of surviving insects were counted from 96 hours after hatching to obtain the average fresh weight of the insects. The statistics were performed until the pupation rate of each group reached more than 90%.
[0088] Figure 2 Shows the change in average fresh weight of mutant individuals and wild-type individuals during development to the pupal stage.
[0089] It can be seen that the mutant lsd1-M2 (-2, -2) showed a significant increase in body weight in the middle and late fifth instar (295h): the average body weight of the wild type was 0.216g, and the mutant body weight was 0.237g, an increase of 9.72%.
[0090] Therefore, the present invention provides a method for preparing a weight-gaining strain of the bright-spotted flathorn soldier fly and a nucleic acid construct thereof, by selecting the lipid droplet storage protein editing gene (Lsd1) as a target, using CRISPR / Cas9 to knock out homozygous mutants, and achieving significant weight gain of the 5th instar larvae.
[0091] It should be understood that after reading the above teachings of the present invention, those skilled in the art may make various changes or modifications to the present invention, and these equivalent forms also fall within the protection scope of the present invention.
Claims
1. A method for preparing a weight-increasing strain of the bright-spotted flathorn soldier fly, It is characterized in that The steps are as follows: (1) constructing a Lsd1 gene knockout nucleic acid construct, performing PCR with the template primer sgRNA-F and the universal reverse primer, and recovering and purifying the PCR product to obtain the template sgRNA, wherein the template primer sgRNA-F is selected from the model primers sgRNA3-F and sgRNA4-F; the sequence of the template primer sgRNA3-F is shown in SEQ NO. 4 in the sequence listing, the sequence of sgRNA4-F is shown in SEQ NO. 5 in the sequence listing, and the sequence of the universal reverse primer is shown in SEQ NO. 6 in the sequence listing; (2) amplifying the template sgRNA described in step (1) in vitro to obtain a single-stranded sgRNA, thereby obtaining a knockout nucleic acid construct; the target sequence of the knockout nucleic acid construct is shown in SEQ NO. 9 or SEQ NO. 10 in the sequence list; (3) co-transfecting the knockout nucleic acid constructs and Cas9 protein of the target sequence in step (2) into fresh eggs of the bright-spotted flat-horned soldier fly, hatching them to obtain the G0 generation, detecting the presence of mutations, and self-pollinating to obtain the G1 generation; (4) The G1 generation mutant heterozygote is self-pollinated for 2-3 generations, and a homozygote is obtained by detection.
2. The method according to claim 1, It is characterized in that The PCR reaction conditions described in step (1) are as follows: 94°C for 2 min; 94°C for 15 s, 55°C for 30 s, 68°C for 10 s, 20 cycles; 68°C for 5 min.
3. The method according to claim 1, It is characterized in that The final concentrations of the knockout nucleic acid construct and Cas9 protein described in step (3) are 100-200 ng / μL respectively.
4. The method according to claim 1, It is characterized in that The co-transfection described in step (3) is performed in a microinjection apparatus.
5. The method according to claim 1, It is characterized in that The incubation temperature in step (3) is 25-28°C.
6. The method according to claim 1, It is characterized in that The detection of the presence of mutation in step (3) is performed by PCR detection using detection primers.
Citation Information
Patent Citations
Marker gene of CRISPR / Cas9 gene editing system applied to hermetia illucens
CN112111526A