A tilapia igt monoclonal antibody and application thereof

Abstract

The application discloses a tilapia IgT monoclonal antibody and application thereof, and relates to the technical field of biology.The application specifically discloses a tilapia IgT heavy chain constant region CH2 gene sequence, an amino acid sequence, and a method for preparing a tilapia IgT monoclonal antibody by immunizing mice with a recombinant protein.The tilapia IgT monoclonal antibody is secreted by a hybridoma cell strain 2B11 (the preservation number is CCTCC NO: C2023390), the monoclonal antibody can specifically recognize a band with a size of about 42kDa in tilapia mucus, and the size is consistent with that of a natural IgT, which indicates that the mouse anti-tilapia IgT monoclonal antibody is successfully prepared, and lays a foundation for tilapia mucosal immune research.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and particularly relates to a tilapia IgT monoclonal antibody and application thereof. BACKGROUND

[0002] Tilapia (Oreochromis mossambicus) has the characteristics of fast growth, strong adaptability and high nutritional value, and is one of the important economic fish species in China, and is also a popular species for immunological research of bony fish. The immune system of vertebrates is divided into innate immunity and adaptive immunity, and adaptive immunity is the main defense line against pathogenic microorganisms. Immunoglobulin is a key effector molecule of adaptive immunity.

[0003] A typical immunoglobulin is composed of two heavy chains and two light chains, and is connected by disulfide bonds to form a "Y"-shaped tetramer structure. Immunoglobulins of mammals are mainly divided into five types: IgG, IgM, IgA, IgE and IgD, which perform specific functions in humoral immunity and cellular immunity. Bony fish is the oldest vertebrate, and the main immunoglobulin is divided into three types, namely IgM, IgD and IgT / IgZ. Different types of immunoglobulin have specific functions in the body. IgM is the earliest immunoglobulin found in bony fish, and early studies believe that it is the only immunoglobulin in the systemic and mucosal immunity. Until 2005, Hanse and Danilova discovered IgT in rainbow trout (Oncorhynchus mykiss) and zebrafish (Barchydanio rerio var), respectively. In bony fish, IgM is the main immunoglobulin in serum, and IgT, similar to IgA in mammals, plays a major role in mucosal immunity. With the rapid development of research on immunoglobulin molecules of bony fish, IgT genes of different species of bony fish have been cloned, such as rainbow trout, zebrafish, largemouth bass (Micropterus salmoides), large yellow croaker (Larimichthys crocea) and tilapia. However, there are still many deficiencies in the structure of IgT protein and its production and distribution in different fish. The research on the function of IgT is based on the successful preparation of anti-IgT polyclonal antibodies and monoclonal antibodies. Due to the lack of antibodies, the research on the function of IgT is very limited at present, and mainly focuses on rainbow trout and zebrafish. Therefore, it is necessary to prepare anti-tilapia IgT antibodies. Monoclonal antibodies have the characteristics of strong specificity, high affinity and high uniformity, and have become a powerful tool for immunological research. The preparation of anti-tilapia IgT monoclonal antibodies can provide a favorable tool for evaluating the infection and antibody production of tilapia after vaccination, and also lays a foundation for the research on mucosal immune response of tilapia. SUMMARY

[0004] The present application aims to solve the above-mentioned problems existing in the prior art, and provides a tilapia IgT monoclonal antibody and an application thereof.

[0005] To achieve the above-mentioned purpose, the present application provides the following technical solutions.

[0006] In a first aspect, the present application provides a tilapia IgT monoclonal antibody, wherein the tilapia IgT heavy chain constant region CH2 gene sequence is shown as SEQ ID NO. 1, and the tilapia IgT heavy chain constant region CH2 amino acid sequence is shown as SEQ ID NO. 2.

[0007] Further, the upstream primer sequence of the tilapia IgT heavy chain constant region CH2 is IgT-F, shown as SEQ ID NO. 3, and the downstream primer sequence of the tilapia IgT heavy chain constant region CH2 is IgT-R, shown as SEQ ID NO. 4.

[0008] Further, the heavy chain of the tilapia IgT monoclonal antibody is of the IgG3 type, and the light chain is of the Kappa type.

[0009] In a second aspect, the present application provides a hybridoma cell strain for producing the tilapia IgT monoclonal antibody, wherein the hybridoma cell strain is hybridoma cell strain 2B11, and the preservation number of the hybridoma cell strain is CCTCC NO: C2023390.

[0010] In a third aspect, the present application provides an application of the tilapia IgT monoclonal antibody in preparing a kit or a detection reagent.

[0011] Further, the kit or the detection reagent is used for detecting specific antibodies in tilapia mucus.

[0012] The biological material preservation information is as follows: the hybridoma cell strain 2B11 Hybridoma cell line 2B11 provided by the present application has a preservation number of CCTCC NO: C2023390, and was preserved in the China Center for Type Culture Collection on December 7, 2023, at an address of No. 299, Baoyi Road, Wuchang District, Wuhan, Hubei Province, inside the campus of Wuhan University.

[0013] The present application has the following beneficial effects:

[0014] The application discloses a tilapia IgT heavy chain constant region CH2 gene sequence, an amino acid sequence, and a method for preparing a tilapia IgT monoclonal antibody by immunizing mice with a recombinant protein. The tilapia IgT monoclonal antibody is secreted by a hybridoma cell strain 2B11, and the monoclonal antibody can specifically recognize a band with a size of about 42 kDa in tilapia mucus, indicating that the mouse anti-tilapia IgT monoclonal antibody is successfully prepared, the size of the monoclonal antibody is consistent with that of a natural IgT, and the monoclonal antibody lays a foundation for tilapia mucosal immunity research.

[0015] Monoclonal antibodies have high specificity and affinity, and are important tools for immunological methods. The tilapia IgT monoclonal antibody prepared in the application can be used for identification of immune cells, and is also important for evaluation of antibody production after infection and vaccination, early diagnosis of diseases and the like. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 It is a total RNA electrophoretogram of a tilapia spleen;

[0017] Figure 2 It is an IgT target fragment PCR amplification;

[0018] Figure 3 It is a Pet32a-IgT plasmid double enzyme digestion map;

[0019] Figure 4 It is an SDS-PAGE of Pet32a-IgT expression in E. coli BL21;

[0020] Figure 5 It is an SDS-PAGE of recombinant IgT protein purification;

[0021] Figure 6 It is a Western blot map of the IgT recombinant protein (His tag);

[0022] Figure 7 It is identification of the tilapia IgT monoclonal antibody;

[0023] Figure 8 It is an SDS-PAGE of the tilapia IgT monoclonal antibody purification. DETAILED DESCRIPTION

[0024] In order to further illustrate the technical means and effects taken to achieve the predetermined object of the application, the technical solutions in the embodiments of the application will be described more completely in combination with the drawings. Obviously, the described embodiments are only some of the embodiments of the application, rather than all the embodiments. Based on the embodiments in the application, all other embodiments obtained by those skilled in the art without creative work fall within the protection scope of the application.

[0025] Embodiment 1

[0026] 1. Amplification and prokaryotic expression vector construction of Tilapia IgT heavy chain gene

[0027] 1.1 Total RNA extraction

[0028] The spleen of Tilapia infected with Streptococcus agalactiae was used as a sample, and the OMEGA total RNA extraction kit was used to extract the total RNA according to the instructions. The obtained RNA was mixed with 10xLoading Buffer and added to a 1% agarose gel, and electrophoresis was performed at 150V for 30min to verify the integrity of the extracted RNA. As shown in FIG. 1, the extracted total RNA showed three obvious bands of 28S, 18S and 5S, indicating that the extracted RNA was not significantly degraded and could be used for subsequent experiments. Figure 1

[0029] 1.2 cDNA synthesis

[0030] The extracted total RNA was used as a template, and a reverse transcription kit (Novozyme) was used to reverse transcribe the cDNA, and the steps were referred to the instructions.

[0031] 1.3 PCR amplification of the target band

[0032] According to the IgT heavy chain gene of Tilapia (sequence number: KX214533.1) in NCBI, a pair of specific primers was designed in the heavy chain constant region CH2 using Primer 5, and the upstream primer was inserted into the BamH I restriction site, and the downstream primer was inserted into the SaC I restriction site. IgT-F: CGC ATG TGT GTC ATG TTA CGG GAG, as shown in SEQ ID NO. 3, IgT-R: CTC AGC TGA TAA TAT GCT ATG AAG A, as shown in SEQ ID NO. 4. The cDNA was used as a template to amplify the target fragment using specific primers. The reaction system is shown in Table 1: GGATCC GAGCTC Table 1

[0033]

[0034]

[0035]

[0036] Reaction procedure: 98℃, 30s, 55℃, 30s, 72℃, 40s; 30 cycles. The obtained PCR product was detected by 1% agarose gel.

[0037] According to the specific primers designed in the IgT heavy chain constant region, a 546bp fragment was amplified, as shown in FIG. 2. Figure 2 ​​​As shown, M in the figure is DL 2000 DNA marker; 1 is IgT sequence amplification product. After sequencing, it is uploaded to GenBank for BLAST comparison analysis to confirm that it is the heavy chain sequence of Tilapia IgT, and the sequence is as follows: the heavy chain CH2 cDNA sequence of Tilapia IgT is shown as SEQ ID NO. 1:

[0038] ATGTGTACATTTACGGGAGGCCAAAGTGCATCTTTGAATAAAACTGACAGAGACAACACACTAGATGTTTCCACAACTTCCGATCCGAAAAACAGGCCAACGGTGACAGTTCACATCCTCCCACAGCTGCACACTGACCAGTTAAATCCTCAGGATGAAATCACTCTGGTGTGTCTGGTCACCAGTGCTGTGAAAAAGATGTATCAAATCGAATGGTCAGAAAGTTATGGACGAAATTCTGGACGTTATGTTACAGGCACCAACGTCCCTGCACAGCAGAGCAAAAATGACAAGAAATGGCGAAGCATGAGTCTTTACACCACCAGTAAGGCAAACTGGTACAAAAAAGATCCAACCAAAACGTTCACCTGCCATGTCCGATCTGAAAATATTCACAAAACAGTGTCCAGCACCCATGATGATCTTTGTGATCTGAGTTGGGACAATGTCATCGCTGAAGAGGATTTTAGCAGCCTGTGGTCCACAGCTTCCTCCTTCATATTCCTCTTCATATTCTCTCTCTTCTATAGCATAATTATCAGCTGA.

[0039] The predicted amino acid sequence of the heavy chain CH2 of Tilapia IgT is shown as SEQ ID NO. 2:

[0040] Met Cys Thr Phe Thr Gly Gly Gln Ser Ala Ser Leu Asn Lys Thr Asp ArgAsp Asn Thr Leu Asp Val Ser Thr Thr Ser Asp Pro Lys Asn Arg Pro Thr Val ThrVal His Ile Leu Pro Gln Leu His Thr Asp Gln Leu Asn Pro Gln Asp Glu Ile ThrLeu Val Cys Leu Val Thr Ser Ala Val Lys Lys Met Tyr Gln Ile Glu Trp Ser GluSer Tyr Gly Arg Asn Ser Gly Arg Tyr Val Thr Gly Thr Asn Val Pro Ala Gln GlnSer Lys Asn Asp Lys Lys Trp Arg Ser Met Ser Leu Tyr Thr Thr Ser Lys Ala AsnTrp Tyr Lys Lys Asp Pro Thr Lys Thr Phe Thr Cys His Val Arg Ser Glu Asn IleHis Lys Thr Val Ser Ser Thr His Asp Asp Leu Cys Asp Leu Ser Trp Asp Asn ValIle Ala Glu Glu Asp Phe Ser Ser Leu Trp Ser Thr Ala Ser Ser Phe Ile Phe LeuPhe Ile Phe Ser Leu Phe Tyr Ser Ile Ile Ile Ser*.

[0041] 1.4 PCR product recovery

[0042] Expand the reaction system to 50 μL as described in section 1.3, and perform agarose gel electrophoresis on the PCR products at 150 V for 30 min. Under UV light, quickly cut the gel containing the target band with a blade and transfer it to a 1.5 mL EP tube. Recover the PCR products using the OMEGA agarose gel extraction kit, following the manufacturer's instructions.

[0043] 1.5 Construction of Cloning Vectors

[0044] Refer to Takara pMD TM18-T Vector Cloning Kit instruction, the recovered target fragment was ligated with pMD TM 18-T Vector.

[0045] 1.6 Transformation of the cloning vector into Trans5a Chemically Competent Cell

[0046] (1) Take the competent cells from -80°C refrigerator, and place on ice for 5 min.

[0047] (2) Use a pipette to take 5 μL of the cloning vector and 50 μL of the competent cell suspension in a 1.5 mL sterile centrifuge tube, mix gently, and place on ice for 30 min.

[0048] (3) After the ice bath, place the EP tube in a water bath at 42°C for 1 min, and then place on ice for 2 min.

[0049] (4) Add 500 μL of LB medium to the bacterial solution, and incubate in a constant temperature shaker incubator at 37°C and 220 r / min for 2 h. Transfer the bacterial solution to a sterile clean bench, and take 100 μL of the bacterial suspension, 8 μL of IPTG (100 mg / mL), and 8 μL of x-gal (100 mg / mL) to Amp + resistant LB solid medium, and use a sterile coating rod to evenly spread the bacterial solution on the surface of the solid medium. After the surface bacterial solution is dry, place the culture dish in a 37°C biochemical incubator and incubate overnight.

[0050] 1.7 Subculture

[0051] Transfer the long plate to a sterile clean bench, take a 15 mL sterile centrifuge tube, add 10 mL of LB medium and 10 μL of ampicillin solution (100 mg / mL), use a sterile white small gun head to pick a single white colony in the medium, seal the gas-permeable film, and incubate the centrifuge tube in a constant temperature shaker incubator at 37°C and 220 r / min overnight.

[0052] 1.8 Plasmid extraction

[0053] According to the Omega Plasmid Mini Kit II D6945 plasmid small extraction kit instruction, the bacterial solution was subjected to plasmid extraction.

[0054] 1.9 Double enzyme digestion identification and sequencing

[0055] According to the Takara Company BamHI and SaCI restriction enzyme reagent instructions, IgT-18T plasmid was stepwise double enzyme cutting, and the enzyme cutting product was detected by 1% agarose gel electrophoresis. The plasmid with correct enzyme cutting was sent to Huada Gene Company for sequencing.

[0056] 1.10 IgT-18T plasmid and Pet32A plasmid double enzyme cutting and purification

[0057] According to the Takara Company BamHI and SaCI restriction enzyme reagent instructions, IgT-18T plasmid, Pet32A plasmid were stepwise double enzyme cutting, and the enzyme cutting product was detected by 1% agarose gel electrophoresis, 150V electrophoresis for 30min, and the target band was recovered according to step 1.4.

[0058] 1.11 Construction of expression vector

[0059] According to the Takara Company T4 DNA ligase reagent instructions, IgT gene was connected to Pet32A expression vector.

[0060] 1.12 Expression vector transformation to Trans5a Chemically Competent Cell

[0061] According to step 1.6, the ligation product was transformed into Trans5a Chemically Competent Cell competent cells, and coated on Amp + resistant LB solid medium for culture.

[0062] 1.13 Expansion culture

[0063] According to step 1.7, white single colony was picked to Amp + resistant LB liquid medium for expansion culture.

[0064] 1.14 Plasmid extraction

[0065] According to step 1.8, Pet32A-IgT bacterial solution was extracted.

[0066] 1.15 Enzyme cutting identification and sequencing

[0067] According to step 1.9, Pet32A-IgT was double enzyme cutting, and the enzyme cutting product was detected by 1% agarose gel electrophoresis. The plasmid with correct enzyme cutting was sent to Huada Gene Company for sequencing.

[0068] The target fragment was connected with Pet32a vector after enzyme cutting, and Pet32a-IgT recombinant plasmid was constructed. Sequencing verification showed that the plasmid construction was successful. As Figure 3Figure 1 is a double enzyme digestion map of the Pet32A-IgT plasmid, where M is a DL 5000 DNA marker and 1 is the double enzyme digestion product of the Pet32A-IgT plasmid.

[0069] 2. Expression and purification of the recombinant protein

[0070] 2.1 Transformation of the expression vector into BL21(DE3)

[0071] The Pet32A-IgT plasmid was transformed into BL21(DE3) according to the procedure of step 1.6 and spread onto Amp + resistant LB solid medium for culture.

[0072] 2.2 Subculture

[0073] The Pet32A-IgT single colony was picked according to step 1.7 and spread into Amp + resistant LB liquid medium for subculture for 12-16 h.

[0074] 2.3 Induction of expression

[0075] (1) A 50 mL centrifuge tube was added with 20 mL of LB medium, 200 μL of the subcultured Pet32A-IgT bacterial solution, and 20 μL of ampicillin (100 mg / mL), and covered with a gas-permeable membrane, and then incubated in a constant-temperature shaker incubator at 37°C and 220 r / min for subculture.

[0076] (2) After 3.5 h of culture, the constant-temperature shaker incubator was removed, and the OD 600 value of the bacterial suspension was determined using a spectrophotometer. If the OD 600 value reached 0.6-0.8, the culture was terminated; if the OD 600 value did not reach 0.6, the culture was continued, and the OD600 value was determined every 30 min until it reached 0.6-0.8.

[0077] (3) The bacterial solution was divided into two portions, one of which was added with isopropyl-β-D-thiogalactopyranoside (IPTG) to a final concentration of 1.0 mmol / L, and the other was not added with IPTG.

[0078] (4) The constant-temperature shaker incubator was set to 25°C and 180 r / min for induction of expression for 12 h.

[0079] The recombinant plasmid was transformed into BL21, and a fusion protein with a size of about 38.3 kDa was expressed by induction, which was consistent with the expectation, as shown in Figure 4Figure 1 shows SDS-PAGE of expression of Pet32A-IgT in E. coli BL21, M in the figure is protein molecular weight marker; 2, 3, 4 are whole bacteria, supernatant and precipitate induced by 1 mmol / L IPTG; 5, 6, 7 are whole bacteria, supernatant and precipitate induced by 0.5 mmol / L IPTG; 8, 9, 10 are whole bacteria, supernatant and precipitate induced by 0.2 mmol / L IPTG. As can be seen from the figure, the recombinant protein mainly exists in the precipitate and is not found in the supernatant, indicating that the protein is expressed in the form of inclusion body.

[0080] 2.4 Identification of recombinant protein by SDS-PAGE

[0081] (1) Preparation of gel: assemble the gel preparation mold, prepare 12% separation gel according to the formula, mix well, then add to the gel plate, and then add methanol to eliminate foam and flatten the gel surface. When the separation gel solidifies, pour out the methanol and absorb the residual methanol with a water absorption paper. Prepare 5% stacking gel according to the formula, mix well, add to the gel plate and insert a 1.5 mm sample comb. When the upper gel solidifies, transfer to the electrophoresis tank. Add 1x Tris-Gly electrophoresis buffer to the upper and lower tanks, and remove the sample comb. The separation gel and stacking gel formulas are shown in Table 2 below:

[0082] Table 2

[0083]

[0084] (2) Sample preparation: take 1 mL of induced and uninduced bacterial solution respectively, centrifuge at 5 000 rpm for 10 min to collect the bacterial body, and resuspend the bacterial body with 200 μL PBS. Take the induced bacterial solution, centrifuge to collect the bacterial body, resuspend with PBS, and break the bacterial body with an ultrasonic cell disruptor. Use No. 2 amplitude bar, set the breaking program as follows: turn on the ultrasonic for 3 s, turn off the ultrasonic for 3 s, power 220 w, and work for 10 min. After completion, centrifuge the bacterial solution at 10 000 rpm for 10 min to collect the supernatant and precipitate, and resuspend the precipitate with 200 μL PBS. Add 5x Loading Buffer to the prepared sample, mix well, and then place in a metal bath at 100°C for protein denaturation. After 10 min, take out.

[0085] (3) Take 20 μL of sample to the gel sample well respectively, and run the electrophoresis program: voltage 80 V, run for 1.5 h until the sample position reaches the boundary between the stacking gel and the separation gel; voltage changes to 110 V, run for 2.5 h until the protein marker bands are completely separated, and stop the electrophoresis.

[0086] (4) Peel off the separation gel from the clamp plate respectively, and soak in R-250 Coomassie brilliant blue solution for 1 h of staining on a horizontal shaker.

[0087] (5) Immerse the stained separating gel in the decolorizing solution and decolorize it on a horizontal shaker. Stop decolorizing when you can see light blue protein bands on the separating gel. Transfer the separating gel to a gel image analysis system to take pictures and store them.

[0088] 2.5 Recombinant Protein Purification

[0089] The protein expression system was scaled up to 1 L, and the induction method was the same as in 2.3. The cells were collected by centrifugation at 5000 rpm for 20 min at 4℃ for purification. The purification procedure followed the instructions for purification of Ni-Agarose Resin inclusion bodies from Kangwei Century.

[0090] 2.6 Identification of Recombinant Proteins

[0091] 2.6.1, SDS-PAGE

[0092] The purified recombinant protein was then examined for size and purity via electrophoresis as described in step 2.4. Figure 5 The image shows an SDS-PAGE image of purified recombinant IgT protein. M represents the protein molecular weight standard; 1 is the supernatant before purification; 2 is the column buffer; 3 is the washing buffer; and 4, 5, and 6 are the elution buffers for each segment. The results indicate that the purified recombinant protein was the expected size and had high purity.

[0093] 2.6.2 Western blot detection

[0094] (1) Preparation of protein samples: Dilute the purified Pet32A-IgT recombinant protein, add 5× reducing loading buffer, vortex to mix, place in a 100℃ metal bath for 10 min, and store at -20℃ for later use.

[0095] (2) SDS-PAGE: Prepare a 10% Tris-glycine polyacrylamide lower separating gel and a 5% upper stacking gel. Load 20 μL of sample into each well for electrophoresis at 80V for 30 min. When the marker reaches the separating gel, electrophoresis is performed at 110V for 1 h.

[0096] (3) Transfer: The filter paper and NC membrane were soaked in the transfer solution beforehand. After electrophoresis, the separating gel was removed from the gel plate and soaked in the transfer solution. The gels were stacked in the order of filter paper-NC membrane-gel-filter paper from bottom to top. Air bubbles were removed between each layer with a glass rod. The gels were rotated at 20V for 25 minutes in a semi-dry state.

[0097] (4) Sealing: Transfer the NC membrane to a petri dish containing 5% skim milk powder solution and place it in a decolorizing shaker at 40 r / min at room temperature for 2 h.

[0098] (5) Primary antibody incubation: Discard the blocking solution, add anti-His-tagged mouse monoclonal antibody diluted with PBST solution at a ratio of 1:8000, and incubate overnight at 4°C.

[0099] (6) Secondary antibody incubation: Discard the primary antibody, wash the membrane with PBST for 3 times, 5 min each time. Dilute the HRP labeled goat anti-mouse IgG (H+L) antibody with TBST solution at a ratio of 1:8 000, incubate at room temperature for 2 h.

[0100] (7) ECL developing: Discard the secondary antibody, wash the membrane with PBST for 3 times, 5 min each time. Prepare an appropriate amount of ECL developing solution at a ratio of 1:1, add the developing solution dropwise to the membrane, and after sufficient contact, analyze and take a photo using a chemiluminescence imager.

[0101] The purified recombinant protein was subjected to immunoblotting analysis, as shown in Fig. 1, which is a Western blotting diagram of IgT recombinant protein (His tag), M in the diagram is a protein marker, and lane 1 is the purified recombinant protein. The results show that the recombinant protein can bind to the anti-His tag mouse monoclonal antibody, and the size is consistent with the protein size, indicating that the Tilapia IgT recombinant protein has been successfully expressed. Figure 6

[0102] 2.7 Protein dialysis and concentration

[0103] The purified recombinant protein was subjected to dialysis and concentration to reduce the salt concentration of the protein solution, and the specific operation steps are as follows:

[0104] (1) Dialysis bag activation: ① A solution: add 500 mL distilled water, 2% NaHCO3 (10 g), and 1 mM / L EDTA (0.18612 g) to a 1 000 mL beaker, and adjust the pH to 8 with NaOH solution and HCL. ② B solution: add 500 mL distilled water and 1 mM / L EDTA (0.18612 g) to a 1 000 mL beaker, and adjust the pH to 8 with NaOH and HCL. ③ Cut the dialysis bag to a suitable length of 20-30 cm, boil it in the A solution for 10 min, rinse it with deionized water, and then boil it in the B solution for 10 min. After the liquid cools down, store it in the 4℃ refrigerator.

[0105] (2) Rinse the activated dialysis bag with deionized water, fix it on a 500 mL beaker, and add the purified recombinant protein solution into the dialysis bag. Add 4℃ pre-cooled protein dialysis PBS solution outside the dialysis bag so that the PBS liquid level is level with the protein liquid level inside the dialysis bag, and place it in the 4℃ refrigerator for 2 h.

[0106] (3) Discard the PBS in the beaker, add 4℃ pre-cooled PBS solution outside the dialysis bag so that the PBS liquid level is level with the protein liquid level inside the dialysis bag, and place it in the 4℃ refrigerator for 2 h.

[0107] (4) Repeat step (3) for 3 times. ​

[0108] (5) Transfer the dialysis tape to a 500mL beaker containing PEG 6000 and store it in a 4℃ freezer. After concentrating to the required protein concentration, aspirate the protein from the dialysis bag and dispense it into 1.5mL sterile EP tubes. Take a small portion of the purified protein and determine the protein concentration according to the instructions of the BCA protein concentration assay kit. Store the remaining protein frozen at -80℃.

[0109] Preparation of mouse anti-tilapia IgT monoclonal antibody

[0110] 3.1 Mouse Immunization

[0111] Female BALB / c mice aged 6–8 weeks were immunized with purified recombinant protein IgT. For the first immunization, recombinant protein (100 μg) was emulsified with Freund's complete adjuvant at a 1:1 ratio and administered subcutaneously. For the second and third immunizations, recombinant protein (100 μg) was emulsified with Freund's non-complete adjuvant at a 1:1 ratio and administered subcutaneously. For the booster immunization, recombinant protein (50 μg) was administered intraperitoneally 3 days before fusion.

[0112] 3.2 Serum titer determination

[0113] The serum antibody titer level of immunized mice was detected using an indirect ELISA method. The specific steps are as follows;

[0114] (1) Coating: Dilute the purified recombinant protein IgT to 1 μg / mL with coating buffer, add 100 μL to each well of the microplate, and coat overnight at 4°C;

[0115] (2) Washing: Discard the coating solution, wash with PBST three times per 200 μL well for 5 min each time, and pat dry;

[0116] (3) Blocking: Prepare 5% skim milk powder with coating buffer, 200 μL / well, and block at 37℃ for 2 h;

[0117] (4) Washing: Discard the blocking solution, wash with PBST three times per 200 μL well for 5 min each time, and pat dry;

[0118] (5) Primary antibody: Dilute mouse positive serum at 1:10000 to 1:168000, add 100 μL to each well of the ELISA plate, and set up unimmunized mouse serum as a negative control. Incubate at 37°C for 1 h.

[0119] (6) Washing: Discard the primary antibody, wash three times with PBST at 200 μL / well for 5 min each time, and pat dry;

[0120] (7) Secondary antibody: Dilute HRP-labeled goat anti-mouse IgG (H+L) antibody with PBST at a ratio of 1:5000, 100 μL per well, and incubate at 37°C for 1 h;

[0121] (8) Wash: Discard the secondary antibody, wash with 200 μL / well of PBST for 3 times, 5 min each time, and pat dry;

[0122] (9) Color development: Add 100 μL of TMB color developing solution (freshly prepared) to each well, and incubate at 37°C in the dark for 20 min;

[0123] (10) Reaction termination: Add 50 μL of termination solution to each well;

[0124] (11) Reading: Read the OD450nm absorbance value by an enzyme labeler, and determine the results.

[0125] Blood was collected from the tail vein of the mice after the third immunization, and the titer of the mice was determined by indirect ELISA. The results showed that the titers of the 5 immunized mice were all above 1:1280 000, and the mice could be used for the following fusion.

[0126] Table 3 Titers of mouse serum determined by indirect ELISA

[0127]

[0128] 3.3 Resuscitation and culture of myeloma cells

[0129] The mouse myeloma cells (SP2 / 0) were resuscitated two weeks before the fusion. The SP2 / 0 cells were taken out from liquid nitrogen, and were quickly thawed in a 37°C water bath, during which the cryopreservation tube was constantly shaken, and the liquid surface should not immerse the cryopreservation tube opening. The completely thawed cells were transferred to 5 mL of 37°C preheated RPMI1640 medium, centrifuged at 1 000 rpm for 5 min, the supernatant was discarded, 5 mL of complete medium containing 10% fetal bovine serum was added, mixed, and then transferred to a cell culture bottle, and was placed in a 37°C, 5% CO2 cell incubator for culture. The medium was timely replaced on the second day. When the cells grew to 80% of the culture bottle, the culture was timely expanded. Generally, 3 T75 cell culture bottles of cells were needed for one fusion, and the cells in good growth state and in logarithmic growth phase were selected for fusion.

[0130] 3.4 Preparation of feeder cells

[0131] The day before fusion, take healthy non-immune Kunming mouse abdominal cavity cells as feeder cells. The specific operation is as follows: the mouse is killed by breaking the neck and soaked in 75% alcohol for 10 min. In the clean bench, the mouse is drained and fixed on the sterilized foam plate; the abdominal skin is cut open with sterilized scissors and forceps to expose the peritoneum: the abdomen is wiped with alcohol cotton ball, 2 mL of pre-cooled RPMI1640 medium is sucked with a sterile syringe, the peritoneum is extracted with forceps, the needle is inserted into the abdominal cavity to avoid piercing the organs, the medium is injected into the abdominal cavity, one hand holds the syringe, the other hand holds the alcohol cotton ball and gently presses the abdomen for 1-2 min, and the medium is sucked back into a 10 mL centrifuge tube. Repeat 2-3 times. Centrifuge the cell suspension at 1 000 rpm for 5 min, discard the supernatant. Resuspend with 40 mL of 1×HAT medium containing 20% fetal bovine serum, and plate 100 μL per well in a 96-well cell culture plate. Place in a 37°C, 5% CO2 cell incubator, and observe for contamination the next day.

[0132] 3.5 Cell fusion

[0133] (1) Take the mouse immunized for 3 days, extract the eyeball to collect the serum, and place the collected serum at room temperature for 2 h, then transfer it to 4℃ overnight, the next day centrifuge at 5 000 rpm for 5 min, collect the serum, and store it at -20℃.

[0134] (2) The mouse is killed by breaking the neck and soaked in 75% alcohol for 10 min.

[0135] (3) Spleen cell preparation: transfer to the clean bench, drain the mouse, fix it on the foam plate, cut the skin with sterilized scissors and forceps; wipe the abdomen with alcohol cotton ball, change the sterilized scissors and forceps to open the chest and take out the spleen, put it into a sterile dish containing RPMI1640 medium, cut off the connective tissue on the surface; transfer the spleen to another sterile dish containing RPMI1640 medium, suck the medium with a 1 mL syringe, pierce the spleen with a needle, inject the medium, and wash the spleen cells. Repeat this step until most of the spleen cells are washed down. Suck the spleen cell suspension into a 50 mL centrifuge tube, centrifuge at 1 000 rpm for 5 min; discard the supernatant, add 5 mL of red blood cell lysis solution, stand at 4℃ for 5 min, add 10 mL of RPMI1640 medium to terminate the reaction, centrifuge at 1 000 rpm for 5 min, discard the supernatant; resuspend the spleen cells with appropriate medium, count.

[0136] (4) Tumor cell collection: the day before fusion, change the medium with complete medium containing 20% fetal bovine serum. Select well-conditioned cells, rinse with RPMI1640 medium for 2 times, add medium, scrape the cells with a cell scraper, collect in a 50 mL centrifuge tube, centrifuge at 1 000 rpm for 5 min, discard the supernatant; resuspend with appropriate medium, count.

[0137] (5) Cell fusion: Tumor cells and spleen cells were mixed in a 50 mL centrifuge tube at a ratio of 1:8, centrifuged at 1,000 rpm for 10 min, and the supernatant was discarded. The bottom of the centrifuge tube was tapped with a finger to loosen the cells. The centrifuge tube was placed in a beaker containing 37°C distilled water, and 1 mL of preheated fusion agent was added dropwise within 1 min, stirring simultaneously. After 1 min, 20% fetal bovine serum-containing complete medium was added, 1 mL in the first 30 s, 3 mL in the next 30 s, and then 20 mL within 1 min.

[0138] (6) Centrifugation at 1,000 rpm for 10 min, discard the supernatant, resuspend with 40 mL of HAT medium containing 20% fetal bovine serum, and add 4 pieces of feeder cell-containing 96-well cell culture plates with 100 μL per well. Incubate in a 37°C, 5% CO2 cell incubator.

[0139] (7) On the 5th day of fusion, half the volume of HAT medium was replaced, and on the 8th day, the entire volume was replaced. On the 10th day, HT medium was used for one week, and then normal RPMI1640 complete medium was used.

[0140] 3.6 Screening of positive hybridoma cell lines and subcloning

[0141] When the fusion cells cover 2 / 3 of the well, the cell supernatant is taken for indirect ELISA screening. To avoid screening hybridoma cell lines against the tag protein in the recombinant protein, tilapia mucus is used to coat the positive hybridoma cells. The mucus is collected from the back of the tilapia fin with a small knife blade, placed in an EP tube, and mixed with an equal volume of 25 mM Tris-HCL (pH 8.0) by vortexing. Centrifuge at 12,500 x g for 15 min at 4°C, collect the supernatant, filter with a 0.45 μm needle filter, and store at -80°C for later use. Dilute the tilapia mucus with coating buffer at a ratio of 1:100, add 100 μL per well to the enzyme-labeled plate, and incubate at 4°C overnight. The other steps are the same as in 3.2.

[0142] If both determinations in the same well are positive, proceed to the next step of subcloning. The specific steps are as follows:

[0143] (1) The day before, prepare feeder cells as in 3.4, and plate the feeder cells in a 96-well cell culture plate with 15% fetal bovine serum in HT, and incubate in a 37°C, 5% CO2 cell incubator.

[0144] (2) Blow the cloned cells from the small holes of the cell culture plate, and calculate the number of viable cells.

[0145] (3) Use the limited dilution method to dilute the cells with complete culture medium containing 15% fetal bovine serum to a concentration of 50 cells / mL, then make a 2-fold dilution to form 4 dilution gradients, and add 2, 2, 3, and 5 columns of 96-well cell culture plates containing feeder cells.

[0146] (4) After 7-10 days of culture, screen positive wells when the cells grow to cover 1 / 3 of the bottom of the well. Select single clone growth positive wells, clone again, generally repeat 2-3 times, until the positive well rate reaches 100%.

[0147] (5) The positive cells obtained by cloning are promptly expanded and cryopreserved.

[0148] 3.7 Large-scale preparation of monoclonal antibodies

[0149] Select 8-week-old female BALB / c mice, inject 0.5 mL of Freund's incomplete adjuvant intraperitoneally, one week later inject 1 x 10 6 / mL hybridoma cells 0.5 mL intraperitoneally. 7-10 days later, the mouse abdomen is swollen, and the ascites is collected. Centrifuge the ascites at 5 000 rpm for 20 min at 4°C, collect the supernatant and store at -20°C for standby.

[0150] 3.8 n-Octanoic acid-saturated ammonium sulfate purification of monoclonal antibodies

[0151] (1) Centrifuge the ascites at 10 000 rpm for 15 min at 4°C, remove the precipitate;

[0152] (2) Mix the ascites with acetate buffer at a volume ratio of 1:2, stir dropwise add n-octanoic acid (33 μL / mL ascites) under ice bath, stir and mix for 30 min after addition;

[0153] (3) Stand for more than 1 h at 4°C to allow sufficient precipitation;

[0154] (4) Centrifuge at 15 000 rpm for 30 min at 4°C, remove the precipitate;

[0155] (5) Filter the supernatant with qualitative filter paper, add 1 / 10 of the volume of 0.15M PBS (pH 7.4) adjusted to pH 7.2 with 5M NaOH) to the supernatant

[0156] (6) Add an equal volume of saturated ammonium sulfate to the supernatant under ice bath within 30 min, stand at 4°C overnight

[0157] (7) Centrifuge at 12 000 rpm for 30 min at 4°C, discard the supernatant;

[0158] (8) Precipitation with appropriate amount of pH 7.4 PBS containing 137 mM NaCL, 0.2 mM EDTA, 2.6 mM KCL, dialysis in PBS of 50-100 times volume at 4℃, 4h exchange once, 3-5 times during the period;

[0159] (9) Take appropriate amount of sample, BAC protein concentration determination kit to determine the antibody concentration (0.988 mg / mL), -80℃ aliquot preservation.

[0160] 3.9 Identification of mouse anti-tilapia IgT monoclonal antibody

[0161] 3.9.1 Identification of monoclonal antibody subtype

[0162] According to the operation of mouse monoclonal antibody subtype identification kit of proteintech company. Add hybridoma cell supernatant in enzyme labeled plate coated with different subtype antibodies, develop with enzyme labeled secondary antibody, and determine OD450nm value with enzyme label instrument.

[0163] According to the determination of subtype identification kit, as shown in Table 4, the prepared monoclonal antibody 2B11 heavy chain is IgG3 type and light chain is Kappa type.

[0164] Table 4 Identification of monoclonal antibody subtype

[0165]

[0166] 3.9.2 Determination of monoclonal antibody titer

[0167] The purified monoclonal antibody titer was determined by indirect ELISA method with tilapia mucus coated enzyme labeled plate. As shown in Table 5, the titer was 1:8 000.

[0168] Table 5 Monoclonal antibody titer

[0169]

[0170] 3.9.3 Western blot detection

[0171] Referring to the Western blot detection of recombinant protein, the mouse anti-tilapia IgT monoclonal antibody 2B11 was detected for reaction with tilapia mucus.

[0172] The prepared monoclonal antibody 2B11 was diluted 1:1 000 as primary antibody for incubation, and HRP labeled goat anti-mouse IgG was used as secondary antibody for reaction with tilapia mucus. The results are as follows Figure 7As shown, A in the figure is the SDS-PAGE diagram of tilapia mucus, B is the Western blot diagram of monoclonal antibody 2B11, M is a protein molecular weight marker, and 1 is tilapia mucus. The results show that the prepared monoclonal antibody can specifically react with a band with a size of about 42 kDa in the tilapia mucus, which is consistent with the expected IgT molecular weight of 41.9 kDa, indicating that the monoclonal antibody can specifically recognize natural IgT.

[0173] 3.9.4 Purification and identification of monoclonal antibody

[0174] The monoclonal antibody 2B11 ascites was purified by n-octanoic acid-saturated ammonium sulfate method, and the purified antibody was determined by BAC protein concentration determination kit to be 0.988 mg / mL. After SDS-PAGE verification, the purified antibody had two clear bands at 75 kDa and 25 kDa, which was consistent with the light and heavy chain bands of the antibody, indicating that the purified antibody had high purity. As shown in the figure, it is the purified SDS-PAGE diagram of IgT monoclonal antibody 2B11, and M in the figure is a protein molecular weight marker; 1 is mouse anti-tilapia IgT monoclonal antibody 2B11 mouse ascites; and 2 is the purified monoclonal antibody. Figure 8

[0175] The tilapia IgT monoclonal antibody of the present application can be used for detecting specific antibodies in tilapia mucus, and is particularly applied to preparing related detection reagents or kits, and has a good application prospect in detecting specific antibodies in tilapia mucus.

[0176] Although the present application has been disclosed as above with preferred embodiments, it is not intended to limit the present application, and any person skilled in the art can make some modifications and improvements without departing from the spirit and scope of the present application, so the protection scope of the present application is defined by the claims.​

Claims

1. A hybridoma cell line, characterized in that: The hybridoma cell strain is a hybridoma cell strain 2B11, and the preservation number of the hybridoma cell strain is CCTCC NO: C2023390.

2. The use of the Tilapia IgT monoclonal antibody produced by the hybridoma cell strain of claim 1 in the preparation of a kit or detection reagent, characterized in that: The kit or detection reagent is used for detecting IgT antibodies in the mucus of Tilapia mossambica.

Images