Application of a corn amino acid transporter and its coding gene in plant disease resistance
By regulating the activity and expression of the maize amino acid transporter ZmLHT1 and using the CRISPR-Cas9 system for gene editing, the environmental pollution problems caused by chemical control have been solved, and a highly efficient disease-resistant maize variety has been cultivated, enhancing the disease resistance and yield of maize.
Patent Information
- Application Number
- CN202211382642.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-11-07
- Publication Date
- 2026-04-07
- Estimated Expiration
- 2042-11-07
AI Technical Summary
Existing technologies for controlling maize leaf spot disease have environmental pollution and food safety issues caused by chemical control, and lack effective disease-resistant gene resources, which affects maize yield.
By regulating the activity and expression of the maize amino acid transporter ZmLHT1, gene editing using the CRISPR-Cas9 system can reduce or increase the expression of the ZmLHT1 gene, thereby breeding disease-resistant maize varieties and enhancing the plant's disease resistance.
It significantly improved corn's resistance to leaf spot disease, reduced the use of chemical pesticides, ensured high and stable corn yields, and did not affect yields under normal conditions.
Smart Images

Figure HDA0003929127320000011 
Figure HDA0003929127320000012 
Figure HDA0003929127320000021
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of a maize amino acid transporter protein and its encoding gene in plant disease resistance. Background Technology
[0002] Maize (Zea mays) is one of the world's most important cereal crops, with a wide range of uses, playing a crucial role in maintaining food security, promoting livestock development, and meeting industrial raw material needs. In recent years, southern leaf blight (SLB) has frequently occurred during maize cultivation, leading to a sharp decline in maize yields and seriously affecting the normal development of the grain industry. SLB is a saprophytic foliar fungal disease caused by *Bipolaris maydis*, and is one of the most prevalent diseases in summer maize producing areas of my country. Currently, the control of SLB in my country mainly relies on chemical control and planting disease-resistant varieties. However, the extensive use of chemical fungicides can cause a series of problems such as environmental pollution and food safety issues. Developing SLB-resistant maize varieties is the most economical and effective means to reduce the impact of SLB on maize yields.
[0003] Therefore, the discovery and identification of disease resistance-related genes can provide important genetic resources for breeding new disease-resistant plant varieties, fundamentally control the damage of maize leaf spot disease, promote the commercialization of maize breeding, and are of great significance for ensuring maize quality and high and stable yield. It has wide application value in the field of maize molecular breeding. Summary of the Invention
[0004] The technical problem to be solved by this invention is how to regulate plant disease resistance, and / or how to improve plant disease resistance. The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.
[0005] To address the aforementioned technical problems, the present invention first provides the application of proteins or substances that regulate the activity and / or content of said proteins, wherein the application may be any of the following:
[0006] A1) The application of proteins or substances that regulate the activity and / or content of said proteins in regulating plant disease resistance;
[0007] A2) The use of proteins or substances that regulate the activity and / or content of said proteins in the preparation of products that regulate plant disease resistance;
[0008] A3) The application of proteins or substances that regulate the activity and / or content of said proteins in the cultivation of disease-resistant plants;
[0009] A4) The use of proteins or substances that regulate the activity and / or content of said proteins in the preparation of products for cultivating disease-resistant plants;
[0010] A5) The application of proteins or substances that regulate the activity and / or content of said proteins in plant breeding or plant germplasm resource improvement;
[0011] The protein is named ZmLHT1 and can be any of the following:
[0012] B1) The amino acid sequence of this protein is that of SEQ ID No. 3;
[0013] B2) A protein that has more than 80% identity with and has the same function as the protein shown in B1) obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in SEQ ID No. 3.
[0014] B3) A fusion protein with the same function is obtained by attaching a tag to the N-terminus and / or C-terminus of B1) or B2).
[0015] In the above applications, the protein ZmLHT1 can be derived from maize (Zea mays).
[0016] Furthermore, the protein ZmLHT1 may be an amino acid transporter protein, and the protein ZmLHT1 has amino acid transport function.
[0017] Furthermore, the protein ZmLHT1 may be a maize disease resistance-related protein, specifically a maize resistance to Southern leaf blight-related protein.
[0018] To facilitate the purification or detection of proteins in B1), a tag protein can be attached to the amino or carboxyl terminus of the protein, which consists of the amino acid sequence shown in SEQ ID No. 3 in the sequence listing.
[0019] The tagged proteins include, but are not limited to: GST (glutathione thiotransferase) tagged protein, His6 tagged protein (His-tag), MBP (maltose-binding protein) tagged protein, Flag tagged protein, SUMO tagged protein, HA tagged protein, Myc tagged protein, eGFP (enhanced green fluorescent protein), eCFP (enhanced cyan fluorescent protein), eYFP (enhanced yellow-green fluorescent protein), mCherry (monomer red fluorescent protein), or AviTag tagged protein.
[0020] Those skilled in the art can readily mutate the nucleotide sequence encoding the protein ZmLHT1 of this invention using known methods, such as directed evolution or point mutation. Any artificially modified nucleotides that possess 75% or more of the nucleotide sequence identity with the protein ZmLHT1 isolated by this invention, provided they encode and function as protein ZmLHT1, are derived from and equivalent to the nucleotide sequence of this invention.
[0021] The aforementioned 75% or higher degree of identity can be 80%, 85%, 90%, or 95% or higher degree of identity.
[0022] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of amino acid sequences, then the identity value (%) can be obtained.
[0023] In this document, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0024] In this article, the substance that regulates the activity and / or content of the protein may be a substance that regulates gene expression, wherein the gene encodes the protein ZmLHT1.
[0025] In the above text, the substance regulating gene expression may be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (including regulation of modification, splicing, and / or processing of the transcript of the gene); 3) regulation of RNA transport of the gene (including regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; 6) post-translational regulation of the gene (including regulation of the activity of the protein translated by the gene, such as regulation of protein precursor processing, protein transport, protein degradation, and / or protein folding).
[0026] The substance that regulates gene expression can be any of the biological materials described in E1)-E4) of this document.
[0027] Furthermore, the substance regulating gene expression can be a substance (including nucleic acid molecules or vectors) that inhibits, reduces, or downregulates the expression of the gene encoding the protein ZmLHT1. The substance inhibiting, reducing, or downregulating the expression of the gene encoding ZmLHT1 can be a knockout agent for the gene (ZmLHT1 gene), such as a CRISPR-Cas9 knockout agent or a homologous recombination knockout agent. The agent inhibiting or reducing gene expression can contain a polynucleotide targeting the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.
[0028] Furthermore, the substance regulating gene expression may also be a substance (including nucleic acid molecules or vectors) that increases or upregulates the expression of the gene encoding the protein ZmLHT1.
[0029] The present invention also provides applications of biomaterials related to the protein ZmLHT1, wherein the applications may be any of the following:
[0030] D1) Application of biomaterials related to the protein ZmLHT1 in regulating plant disease resistance;
[0031] D2) Application of biomaterials related to the protein ZmLHT1 in the preparation of products that regulate plant disease resistance;
[0032] D3) Application of biomaterials related to the protein ZmLHT1 in the cultivation of disease-resistant plants;
[0033] D4) Application of biomaterials related to the protein ZmLHT1 in the preparation of products for cultivating disease-resistant plants;
[0034] D5) Application of biomaterials related to the protein ZmLHT1 in plant breeding or plant germplasm resource improvement;
[0035] The biomaterial may be any one of the following E1) to E6):
[0036] E1) is a nucleic acid molecule that encodes the protein ZmLHT1;
[0037] E2) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the protein ZmLHT1;
[0038] E3) contains an expression cassette containing the nucleic acid molecules described in E1) and / or E2);
[0039] E4) A recombinant vector containing the nucleic acid molecules described in E1) and / or E2), or a recombinant vector containing the expression cassette described in E3);
[0040] E5) Recombinant microorganisms containing the nucleic acid molecules described in E1) and / or E2), or recombinant microorganisms containing the expression cassette described in E3), or recombinant microorganisms containing the recombinant vector described in E4);
[0041] E6) A recombinant host cell containing the nucleic acid molecules described in E1) and / or E2), or a recombinant host cell containing the expression cassette described in E3), or a recombinant host cell containing the recombinant vector described in E4).
[0042] In the above applications, the nucleic acid molecule described in E1) can be any of the following:
[0043] F1) The coding sequence is a DNA molecule of SEQ ID No. 2;
[0044] F2) The nucleotide sequence is the DNA molecule of SEQ ID No. 2;
[0045] The F3 nucleotide sequence is the DNA molecule of SEQ ID No. 1.
[0046] The DNA molecule shown in SEQ ID No. 2 may be the coding sequence (CDS) of the ZmLHT1 gene.
[0047] The expression of the ZmLHT1 gene can be induced by maize leaf spot pathogens (such as Bipolarismaydis), and the ZmLHT1 gene can be a maize leaf spot resistance-related gene.
[0048] The DNA molecule shown in SEQ ID No. 2 encodes the amino acid sequence of the protein ZmLHT1 in SEQ ID No. 3.
[0049] The DNA molecule shown in SEQ ID No. 1 may be the genomic nucleotide sequence of the ZmLHT1 gene.
[0050] E1) The nucleic acid molecule may also include a nucleic acid molecule obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No.2.
[0051] E1) The nucleic acid molecules also include nucleic acid molecules that have a nucleotide sequence identity of more than 95% with the nucleotide sequence shown in SEQ ID No. 2 or SEQ ID No. 1 and originate from the same species.
[0052] The coding sequence (CDS) of the ZmLHT1 protein gene described in this invention can be any nucleotide sequence capable of encoding the ZmLHT1 protein. Considering the degeneracy of codons and the codon preferences of different species, those skilled in the art can use codons suitable for expression in specific species as needed.
[0053] Furthermore, E2 can be a nucleic acid molecule that reduces the expression level of the gene encoding the protein ZmLHT1.
[0054] The nucleic acid molecule described in E2) may be sgRNA, microRNA, siRNA, shRNA and / or antisense oligonucleotide.
[0055] Furthermore, the sgRNA, microRNA, siRNA, shRNA, and / or antisense oligonucleotides are used to suppress the expression of the ZmLHT1 gene.
[0056] Furthermore, the nucleic acid molecule described in E2) may be sgRNA.
[0057] Furthermore, the target sequence of the sgRNA may be SEQ ID No. 14 and SEQ ID No. 15.
[0058] Furthermore, the sgRNA is used to knock out the ZmLHT1 gene.
[0059] As is well known to those skilled in the art, in addition to using gene editing technology to inhibit the expression of the ZmLHT1 gene, gene knockdown technology can also be used to inactivate or silence the ZmLHT1 gene at the post-transcriptional or translational level. The gene knockdown technology includes, but is not limited to, RNA interference, Morpholino interference, antisense nucleic acid, ribozymes, or dominant-negative repressive mutations. Furthermore, using shRNA or siRNA expressed by viruses (such as lentiviruses or adeno-associated viruses) to inhibit the expression of the ZmLHT1 gene and thus silence it is also well known to those skilled in the art.
[0060] The expression cassette described herein includes a promoter, a nucleic acid molecule encoding the protein ZmLHT1, and a terminator. The promoter may be a CaMV35S promoter, a NOS promoter, or an OCS promoter, and the terminator may be a NOS terminator or an OCSpolyA terminator.
[0061] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.
[0062] The vectors described herein refer to vectors capable of delivering exogenous DNA or target genes into host cells for amplification and expression. These vectors can be cloning vectors or expression vectors, including but not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, and viral vectors (such as retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, etc.). In one or more embodiments of this invention, the vectors are pCBC-MT1T2, pBUE411, pDR196, pCAMBIAsuper1300-mCherry, and / or pEZS-NL.
[0063] The microorganisms described herein may be bacteria, fungi, actinomycetes, protozoa, algae, or viruses. Among them, the bacteria may originate from genera such as *Escherichia sp.*, *Erwinia sp.*, *Agrobacterium sp.*, *Flavobacterium sp.*, *Alcaligenes sp.*, *Pseudomonas sp.*, and *Bacillus sp.*, but are not limited to these. For example, the bacteria may be *Escherichia coli*, *Bacillus subtilis*, or *Bacillus pumilus*. The fungus may be a yeast, and the yeast may come from genera such as *Saccharomyces cerevisiae*, *Kluyveromyces* (e.g., *Kluyveromyces lactis*), *Pichia pastoris* (e.g., *Pichia pastoris*), *Schizosaccharomyces pombe* (e.g., *Schizosaccharomyces pombe*), and *Hansenula* (e.g., *Hansenula polymorpha*), but is not limited thereto. The fungus may also come from genera such as *Fusarium* sp., *Rhizoctonia* sp., *Verticillium* sp., *Penicillium* sp., *Aspergillus* sp., and *Cephalosporium* sp., but is not limited thereto. The actinomycetes may originate from genera such as *Streptomycess*, *Nocardia*, *Micromonospora*, *Streptosporangium*, *Actinoplanes*, and *Thermoactinomyces*, but are not limited to these. The algae may originate from genera such as *Fucus*, *Achnanthes*, *Amphiprora*, *Amphora*, *Ankistrodesmus*, *Asteromonas*, and *Boekelovia*, but are not limited to these. The viruses may be rotavirus, herpesvirus, influenza virus, adenovirus, etc., but are not limited to these.In one or more embodiments of the present invention, the microorganism is Agrobacterium tumefaciens EHA105, yeast mutant 22Δ10a, yeast strain 23344c and / or Agrobacterium tumefaciens GV3101.
[0064] The host cell (also called the recipient cell) described herein may be a plant cell or an animal cell. The term "host cell" can be understood not only to refer to a specific recipient cell, but also to the offspring of such a cell, which may not necessarily be identical to the original parent cell due to natural, accidental, or intentional mutations and / or alterations, but are still included within the scope of the host cell. Suitable host cells are those known in the art, including: plant cells such as Arabidopsis thaliana, tobacco (Nicotiana tabacum), maize (Zea mays), rice (Oryza sativa), wheat (Triticum aestivum), etc., but not limited to these; animal cells such as mammalian cells (e.g., Chinese hamster ovary cells (CHO cells), African green monkey kidney cells (Vero cells), young hamster kidney cells (BHK cells), mouse breast cancer cells (C127 cells), human embryonic kidney cells (HEK293 cells), human HeLa cells, fibroblasts, bone marrow cell lines, T cells or NK cells, etc.), avian cells (e.g., chicken or duck cells), amphibian cells (e.g., African clawed frog (Xenopus laevis) cells or giant salamander (Andrias davidianus) cells), fish cells (e.g., grass carp, carp, rainbow trout or catfish cells), insect cells (e.g., Sf21 cells or Sf-9 cells), etc., but not limited to these.
[0065] The recombinant vectors mentioned in this article refer to recombinant DNA molecules constructed by linking exogenous target genes with vectors in vitro.
[0066] The recombinant microorganisms (or recombinant host cells) described herein refer to recombinant microorganisms (or recombinant host cells) whose functions have been altered by manipulating and modifying the genes of a target microorganism (or target host cell). Examples include recombinant microorganisms (or recombinant host cells) obtained by introducing exogenous target genes or recombinant vectors into a target microorganism (or target host cell), or recombinant microorganisms (or recombinant host cells) obtained by directly editing the endogenous genes of a target microorganism (or target host cell). The term "recombinant microorganism" (or recombinant host cell) can be understood to refer not only to a specific recombinant microorganism (or recombinant host cell), but also to its offspring. Due to natural, accidental, or intentional mutations and / or alterations, the offspring need not be completely identical to the original parent cell, but are still included within the scope of recombinant microorganisms (or recombinant host cells).
[0067] E4) The recombinant vector may be recombinant vector pBUE411-ZmLHT1, recombinant vector pDR196-ZmLHT1, recombinant vector pCAMBIAsuper1300-mCherry-ZmLHT1 and / or recombinant vector pEZS-ZmLHT1.
[0068] The recombinant vector pBUE411-ZmLHT1 contains two editing target sites (SEQ ID No. 14 and SEQ ID No. 15) and the gene encoding the Cas9 protein. After being introduced into the recipient, the two transcribed guide RNAs can target the target sequence near the PAM of the recipient genome through base complementarity, that is, the ZmLHT1 gene. The Cas9 protein causes DNA double-strand breaks upstream and downstream of the ZmLHT1 gene. Through the organism's own DNA damage repair response mechanism, the sequences at both ends of the break are connected, thereby achieving the knockout of the ZmLHT1 gene.
[0069] The preparation method of the recombinant vector pBUE411-ZmLHT1 includes the following steps: using the intermediate vector pCBC-MT1T2 as a template, four-primer PCR amplification is performed using primers Spacer 1-F (SEQ ID No. 4), primer Spacer 1-R (SEQ ID No. 5), primer Spacer 2-F (SEQ ID No. 6), and primer Spacer 2-R (SEQ ID No. 7). The obtained PCR product (containing dual target sites of SEQ ID No. 14 and SEQ ID No. 15) is cloned into the vector pBUE411 to obtain the ZmLHT1 gene editing vector, namely the recombinant vector pBUE411-ZmLHT1, which is used for gene knockout.
[0070] The recombinant vector pDR196-ZmLHT1 is obtained by replacing a small fragment between the EcoRI and XhoI recognition sites of the pDR196 vector with a DNA fragment whose nucleotide sequence is the DNA fragment of SEQ ID No. 2 in the sequence listing, while keeping the other nucleotide sequences of the pDR 196 vector unchanged. After being introduced into the host, the recombinant vector pDR196-ZmLHT1 expresses the ZmLHT1 protein with the amino acid sequence shown in SEQ ID No. 3.
[0071] The recombinant vector pCAMBIAsuper1300-mCherry-ZmLHT1 is obtained by replacing the fragment (small fragment) between the XmaI and KpnI recognition sites of the pCAMBIAsuper1300-mCherry vector with the DNA fragment whose nucleotide sequence is SEQ ID No. 2 in the sequence listing, while keeping the other nucleotide sequences of the pCAMBIAsuper1300-mCherry vector unchanged.
[0072] The recombinant vector pEZS-ZmLHT1 is obtained by replacing the fragment (small fragment) between the HindIII and BamHI recognition sites of the pEZS-NL vector with the DNA fragment whose nucleotide sequence is SEQ ID No. 2 in the sequence listing, while keeping the other nucleotide sequences of the pEZS-NL vector unchanged.
[0073] E5) The recombinant microorganism may be recombinant Agrobacterium tumefaciens EHA105 / pBUE411-ZmLHT1, recombinant bacteria 22Δ10a / pDR196, recombinant bacteria 22Δ10a / pDR196-ZmLHT1 and / or recombinant bacteria 23344c / pDR196.
[0074] The EHA105 / pBUE411-ZmLHT1 is a recombinant microorganism obtained by introducing the recombinant vector pBUE411-ZmLHT1 into Agrobacterium tumefaciens EHA105.
[0075] The 22Δ10a / pDR196-ZmLHT1 is a recombinant microorganism obtained by introducing the recombinant vector pDR196-ZmLHT1 into the yeast mutant 22Δ10a.
[0076] The 23344c / pDR196 is a recombinant microorganism obtained by introducing the recombinant vector pDR196 into yeast strain 23344c.
[0077] The 22Δ10a / pDR196 is a recombinant microorganism obtained by introducing the recombinant vector pDR196 into the yeast mutant 22Δ10a.
[0078] The recombinant microorganism may also be a recombinant microorganism obtained by introducing the recombinant vector pCAMBIAsuper1300-mCherry-ZmLHT1 or the recombinant vector pEZS-ZmLHT1 into Agrobacterium tumefaciens GV3101.
[0079] The introduction can be achieved through recombination methods, including but not limited to Agrobacterium-mediated transformation, bio-projectile methods, electroporation, in-planta technology, freeze-thaw methods, etc.
[0080] The present invention also provides a method for cultivating disease-resistant plants, the method comprising reducing the content and / or activity of the protein ZmLHT1 in the target plant to obtain a disease-resistant plant with higher disease resistance than the target plant.
[0081] In the above method, reducing the content and / or activity of the protein ZmLHT1 in the target plant can be achieved by reducing the expression level and / or activity of the gene encoding the protein ZmLHT1 in the target plant.
[0082] In the above method, reducing the expression level and / or activity of the gene encoding the protein ZmLHT1 in the target plant can be achieved by using gene mutation, gene knockout, gene editing or gene knockdown techniques to reduce or inactivate the gene encoding the protein ZmLHT1 in the genome of the target plant.
[0083] In the above method, the reduction or inactivation of the gene encoding the protein ZmLHT1 in the genome of the target plant using gene editing technology can be performed using a CRISPR / Cas9 system. The CRISPR / Cas9 system includes a vector expressing sgRNA that targets the gene encoding the protein, and the target sequence of the sgRNA can be SEQ ID No. 14 and SEQ ID No. 15.
[0084] The method for cultivating disease-resistant plants according to the present invention may include the following steps: inhibiting the expression of nucleic acid molecules capable of expressing ZmLHT1 protein in the target plant to obtain transgenic plants; the transgenic plants exhibit improved disease resistance compared to the target plants. The inhibition of ZmLHT1 protein expression in the target plant can be achieved by any technical means capable of this purpose, such as specific cleavage of the nucleic acid molecules by sequence-specific nucleases (e.g., CRISPR / Cas9 nucleases), thereby reducing their expression in the target plant. The method for cultivating disease-resistant plants can be achieved through hybridization or transgenic methods.
[0085] In one embodiment of the present invention, the method for cultivating disease-resistant plants includes the following steps:
[0086] (1) Construct CRISPR / Cas9 gene editing vectors targeting SEQ ID No. 14 and SEQ ID No. 15;
[0087] (2) The CRISPR / Cas9 gene editing vector constructed in step (1) is introduced into the target plant;
[0088] (3) Disease-resistant plants with higher disease resistance than the target plant were obtained through screening and identification.
[0089] In the above method, the CRISPR / Cas9 gene editing vector can be the recombinant vector pBUE411-ZmLHT1.
[0090] In the above method, the target plant can be maize, specifically maize inbred line B73-329.
[0091] In the above methods, the introduction includes, but is not limited to: transfecting plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, and Agrobacterium-mediated transformation, and then cultivating the transfected plant cells or tissues into plants.
[0092] In the above method, the importation can specifically be Agrobacterium-mediated method.
[0093] The present invention also provides a method for preparing maize with improved disease resistance, the method comprising the following steps: mutating the ZmLHT1 gene shown in SEQ ID No. 1 of the maize genome sequence listing to a ZmLHT1 / +2bp gene, a ZmLHT1 / -8bp gene, or a ZmLHT1 / -25bp gene to obtain maize with improved disease resistance; the nucleotide sequence of the ZmLHT1 / +2bp gene is shown in SEQ ID No. 16, the nucleotide sequence of the ZmLHT1 / -8bp gene is shown in SEQ ID No. 17, and the nucleotide sequence of the ZmLHT1 / -25bp gene is shown in SEQ ID No. 18.
[0094] The present invention also provides the application of the ZmLHT1 / +2bp gene, ZmLHT1 / -8bp gene, or ZmLHT1 / -25bp gene, or the ZmLHT1 / +2bp gene, ZmLHT1 / -8bp gene, or ZmLHT1 / -25bp gene in improving maize disease resistance.
[0095] The nucleotide sequence of the ZmLHT1 mutant ZmLHT1 / +2bp gene is shown in SEQ ID No. 16, which is a mutation in the ZmLHT1 gene with the insertion of two bases "A and T" (corresponding to positions 40 and 65 of SEQ ID No. 2).
[0096] The nucleotide sequence of the ZmLHT1 mutant ZmLHT1 / -8bp gene is shown in SEQ ID No. 17. It is a deletion of 8 bases "GCA and TATTC" in the first exon of the ZmLHT1 gene (corresponding to positions 39-41 and 62-66 of SEQ ID No. 2).
[0097] The nucleotide sequence of the ZmLHT1 mutant ZmLHT1 / -25bp gene is shown in SEQ ID No. 18. It is a deletion of 25 bases "AAGGGCCGCCAGCCGCCAGCTATTC" (corresponding to positions 41-65 of SEQ ID No. 2) on the first exon of the ZmLHT1 gene.
[0098] In this article, the plant may be a crop (such as an agricultural crop).
[0099] In this article, the plant may be any of the following:
[0100] G1) Monocotyledonous or dicotyledonous plants;
[0101] G2) Gramineae plants;
[0102] G3) Plants of the genus *Zea*.
[0103] The *Zea* species may be maize, such as maize inbred line B73-329 and / or maize inbred line B73.
[0104] The present invention also provides the application of the method for cultivating disease-resistant plants in the creation of disease-resistant plants and / or plant breeding.
[0105] The ZmLHT1 gene described in this article may be a gene related to resistance to maize leaf spot disease.
[0106] The plant breeding described in this article can be crop disease resistance breeding, specifically maize resistance to small leaf spot disease. The purpose of this breeding is to select maize varieties with improved resistance to small leaf spot disease.
[0107] The plant breeding described in this article can be a molecular breeding method that utilizes the ZmLHT1 gene and / or protein ZmLHT1 described in this invention to improve crop disease resistance.
[0108] The disease resistance mentioned in this article may refer to resistance to small spot disease, and the disease resistance mentioned may refer to resistance to small spot disease.
[0109] The regulation of plant disease resistance described in this article can be achieved by increasing (upregulating) or decreasing (downregulating) plant disease resistance.
[0110] Specifically, the regulation of plant disease resistance described in this article can be the regulation of plant resistance to small spot disease, including increasing (upregulating) or decreasing (downregulating) plant resistance to small spot disease.
[0111] The small spot disease described in this article may be caused by Bipolaris maydis.
[0112] In this article, the term "disease-resistant plant" is understood to include not only the first-generation transgenic plants obtained by knocking out the ZmLHT1 gene, but also their progeny. The disease-resistant plant includes seeds, callus tissue, intact plants, and cells.
[0113] This invention discloses the application of the maize amino acid transporter gene ZmLHT1 in disease resistance gene engineering. The maize amino acid transporter gene ZmLHT1 participates in the regulation of maize short leaf spot resistance, and its expression is induced by the maize short leaf spot pathogen.
[0114] This invention obtains a maize ZmLHT1 mutant (ZmLHT1 mutant) by knocking out the ZmLHT1 gene in maize using a CRISPR-Cas9 system. 2bp ZmLHT1 8bp and ZmLHT1 25bp (Strains). Further disease resistance identification and field disease severity assessment of the ZmLHT1 mutant were conducted. Experiments showed that after inoculation with race O of maize leaf spot, compared with wild-type maize without ZmLHT1 gene knockout, the disease severity of ZmLHT1 gene knockout maize (ZmLHT1 mutant) was significantly higher, demonstrating excellent resistance to leaf spot. The disease resistance of ZmLHT1 gene knockout maize plants was significantly enhanced. Furthermore, under normal conditions, the ZmLHT1 gene mutation did not cause yield loss, while under leaf spot conditions, the ZmLHT1 gene mutation significantly increased maize yield. DAB staining analysis revealed that the leaves of ZmLHT1 gene knockout maize (ZmLHT1 mutant) accumulated a large amount of reactive oxygen species (ROS), indicating that the ZmLHT1 gene mainly participates in the scavenging of ROS, thus contributing to maize susceptibility. It is evident that knocking out the ZmLHT1 gene using CRISPR / Cas9 technology significantly enhances resistance to maize leaf spot disease, and the ZmLHT1 gene can be applied to disease-resistant breeding of maize leaf spot disease.
[0115] The ZmLHT1 gene and its encoded ZmLHT1 protein identified in this invention can regulate plant disease resistance (such as resistance to small leaf spot). Disease resistance in target plants can be significantly improved by reducing the content and / or activity of the ZmLHT1 protein (e.g., by gene knockout of the ZmLHT1 gene). Disease resistance in target plants can be significantly reduced by increasing the content and / or activity of the ZmLHT1 protein (e.g., by overexpression of the ZmLHT1 gene). The nucleotide sequence of the ZmLHT1 genome is shown in SEQ ID No. 1, with a full length of 2803 bp. The nucleotide sequence of the coding sequence (CDS) of the ZmLHT1 gene is shown in SEQ ID No. 2, with a length of 1419 bp, encoding 472 amino acids. The encoded amino acid sequence is shown in SEQ ID No. 3. The protein encoded by the ZmLHT1 gene is named ZmLHT1 protein (SEQ ID No. 3).
[0116] This invention is the first to discover the application of the ZmLHT1 gene and its encoded protein in improving maize disease resistance. It is of great significance and has broad application prospects for breeding new maize varieties resistant to small leaf spot, overcoming the shortcomings of traditional breeding, promoting the commercialization of maize breeding, and ensuring high and stable maize yields. Attached Figure Description
[0117] Figure 1 Identification of ZmLHT1 mutant lines.
[0118] Figure 2 Analysis of resistance and yield of ZmLHT1 mutant lines and wild-type maize leaf spot disease. Figure 2 Analysis of resistance to maize leaf spot disease in lines A and B of ZmLHT1 mutant and wild-type maize; Figure 2 In the middle, C and D represent the yield analysis of ZmLHT1 mutant lines and wild-type maize under normal conditions (without small leaf spot disease); Figure 2 E and F represent yield analyses of mutant lines and wild-type maize under conditions of small leaf spot disease.
[0119] Figure 3 To identify the amino acid transport function of ZmLHT1 in yeast mutants.
[0120] Figure 4 Quantitative fluorescence analysis of the ZmLHT1 gene after inoculation with maize leaf spot pathogen.
[0121] Figure 5 Subcellular localization identification of the protein encoded by the ZmLHT1 gene.
[0122] Figure 6 DAB staining analysis of ZmLHT1 mutant lines and wild-type maize after inoculation with maize leaf spot disease. Figure 6zmlht1 8 bp represents the ZmLHT1 mutant line ZmLHT1 8bp . Detailed Implementation
[0123] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0124] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0125] The vectors pCBC-MT1T2 and pBUE411 used in the following examples are described in the following literature: Xing HL, et al. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC plant biology, 2014, 14(1):1-12.
[0126] The following examples use GraphPad statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The t-test method is used. P < 0.05 (*) indicates statistical difference, P < 0.01 (**) indicates statistically significant difference, and P < 0.001 (***) indicates extremely significant difference.
[0127] Unless otherwise specified, the quantitative experiments in the following examples were all repeated three times, and the results were averaged.
[0128] Example 1: Sequence of the maize ZmLHT1 gene
[0129] Obtaining the ZmLHT1 gene from maize: Through extensive and in-depth research, the inventors of this application identified a gene, Zm00001d035162, using the maize genome database website maizeGDB for sequence analysis. This gene was named ZmLHT1. The nucleotide sequence of the ZmLHT1 genome is shown in SEQ ID No. 1, with a full length of 2803 bp. The coding sequence (CDS) of the ZmLHT1 gene is shown in SEQ ID No. 2, with a length of 1419 bp, encoding 472 amino acids. The encoded amino acid sequence is shown in SEQ ID No. 3. The protein encoded by the ZmLHT1 gene is named ZmLHT1 protein (SEQ ID No. 3).
[0130] Example 2: Creation and Identification of ZmLHT1 Mutant Plants
[0131] 1. Creation of ZmLHT1 mutant plants
[0132] ZmLHT1 mutant materials were created using CRISPR / Cas9 technology. First, based on the ZmLHT1 gene sequence, target sequences containing NGG or CCN structures were designed using the CRISPR / Cas9 system.
[0133] Target 1: 5'-TGGAGATGACGACGCAGCAAGGG-3' (SEQ ID No. 14)
[0134] Target 2: 5'-GCCAGCCGCCAGCTATTCTCCGG-3' (SEQ ID No. 15).
[0135] Target 1 and target 2 were constructed into the pBUE411 vector, and the primers were designed as follows:
[0136] Spacer 1-F:
[0137] 5'-AATAATGGTCTCAGGCGGGAGATGACGACGCAGCAA (SEQ ID No. 4),
[0138] Spacer 1-R:
[0139] 5'-ATTATTGGTCTCTAAACGAGAATAGCTGGCGGCTGG (SEQ ID No. 5),
[0140] Spacer 2-F:
[0141] 5'-gGGAGATGACGACGCAGCAAgttttagagctagaaatagca (SEQ ID No. 6),
[0142] Spacer 2-R:
[0143] 5'-GAGAATAGCTGGCGGCTGGcgcttcttggtgccgc (SEQ ID No. 7).
[0144] Using pCBC-MT1T2 as a template, four-primer PCR amplification was performed, and the PCR product (containing dual targets) was purified and recovered. A Golden-gate enzyme digestion-ligation system was established, and the PCR product was transformed into the final expression plasmid pBUE411 containing Cas9 to obtain the ZmLHT1 gene editing vector (i.e., recombinant vector, used for gene knockout), named pBUE411-ZmLHT1.
[0145] The recombinant vector pBUE411-ZmLHT1 contains two editing target sites (SEQ ID No. 14 and SEQ ID No. 15) and the gene encoding the Cas9 protein. After being introduced into the recipient, the two transcribed guide RNAs can target the target sequence near the PAM of the recipient genome through base complementarity, that is, the ZmLHT1 gene. The Cas9 protein causes DNA double-strand breaks upstream and downstream of the ZmLHT1 gene. Through the organism's own DNA damage repair response mechanism, the sequences at both ends of the break are connected, thereby achieving the knockout of the ZmLHT1 gene.
[0146] The correctly sequenced recombinant vector pBUE411-ZmLHT1 was transformed into Agrobacterium tumefaciens EHA105 using the freeze-thaw method, resulting in recombinant Agrobacterium tumefaciens EHA105 / pBUE411-ZmLHT1.
[0147] ZmLHT1 CRISPR / Cas9 mutant plants (i.e. T0 generation gene-edited plants) were obtained by infecting maize inbred line B73-329 embryos with Agrobacterium (EHA105 / pBUE411-ZmLHT1).
[0148] 2. Identification of ZmLHT1 mutant plants
[0149] An upstream primer, 5′-TTAACAAACCAAGCTGAGATGC-3′ (SEQ ID No. 8), and a downstream primer, 5′-CAGCACGAAGTGGCAGGA-3′ (SEQ ID No. 9), were designed near the ZmLHT1 gene editing site. Leaves were collected from transgenic maize T0 generation seedlings, and genomic DNA was extracted. PCR amplification was performed using the genomic DNA as a template. The amplified products were sequenced and compared with wild-type sequences to identify the effective mutant lines, which were named ZmLHT1. 2bp ZmLHT1 8bp and ZmLHT1 25bp .in:
[0150] ZmLHT1 2bp Inserting two bases, "A" and "T" (corresponding to positions 40 and 65 of SEQ ID No. 2), into the first exon of the ZmLHT1 gene causes premature termination coding, thereby knocking out the ZmLHT1 gene and obtaining the mutant ZmLHT1 / +2bp. The nucleotide sequence of the ZmLHT1 / +2bp mutant gene is shown in SEQ ID No. 16.
[0151] ZmLHT1 8bp The ZmLHT1 gene was knocked out by deleting eight bases, "GCA and TATTC" (corresponding to positions 39-41 and 62-66 in SEQ ID No. 2), resulting in premature termination of coding and thus the ZmLHT1 gene being knocked out, resulting in the mutant ZmLHT1 / -8bp. The nucleotide sequence of the ZmLHT1 / -8bp mutant gene is shown in SEQ ID No. 17.
[0152] ZmLHT1 25bp A 25-base deletion of “AAGGGCCGCCAGCCGCCAGCTATTC” (corresponding to positions 41-65 of SEQ ID No. 2) in the first exon of the ZmLHT1 gene causes premature termination coding, thereby knocking out the ZmLHT1 gene and obtaining the mutant ZmLHT1 / -25bp. The nucleotide sequence of the ZmLHT1 / -25bp mutant gene is shown in SEQ ID No. 18.
[0153] The identification results of the ZmLHT1 mutant line are as follows: Figure 1 As shown.
[0154] Example 3: Field phenotypic verification of ZmLHT1 mutant plants
[0155] The tested plants were:
[0156] 1. Wild-type maize: Maize inbred line B73-329;
[0157] 2. ZmLHT1 mutant plants: ZmLHT1 2bp T3 generation plants of the strain, ZmLHT1 8bp T3 generation plants of the strain, ZmLHT1 25bp T3 generation plants of the strain (at least 100 plants per strain).
[0158] Field disease severity assessment of ZmLHT1 mutant
[0159] Wild-type maize and ZmLHT1 mutant plants were planted at the transgenic experimental base of the Agricultural Experiment Station in Caoxinzhuang Village, Yangling Town, Yangling District, Xianyang City, Shaanxi Province (34°18'27"N, 108°5'58"E). The O race of maize leaf spot disease, which had been isolated in the laboratory, was propagated using PDA medium. The mixture was cultured in a light incubator for 12 hours in the light and 12 hours in the dark (temperature 25℃). After the mycelium developed well, the conidia were washed off from the PDA medium to prepare a spore suspension. Sorghum grains were soaked for two days and then placed in 1000ml conical flasks for sterilization. The spore suspension was then inoculated, mixed well, and cultured at 26℃. The sorghum grains were shaken vigorously once a day to prevent clumping. After the sorghum grains were covered with mycelium, they were dried in the dark for later use. When the maize reached the 6-leaf stage, the infected sorghum grains were injected into the corn tassels (about 25 grains per plant). Phenotypic surveys (investigating the disease status of maize leaves) were conducted one week before and one week after silking. The disease severity level was referenced in the following literature: Sermons SM, et al. Large scale field inoculation and scoring of maize southern leaf blight and other maize foliar fungal diseases. Bio-protocol, 2018, 8(5):e2745. The results showed that the disease severity level of the ZmLHT1 mutant was significantly higher than that of the wild type. Figure 2 The results (A and B) showed excellent resistance to small leaf spot disease, indicating that the disease resistance of maize plants after the ZmLHT1 gene knockout was significantly enhanced.
[0160] Production analysis of ZmLHT1 mutant under inoculation and non-inoculation conditions
[0161] Wild-type maize and ZmLHT1 mutant plants were planted at the transgenic experimental base of the Agricultural Experiment Station in Caoxinzhuang Village, Yangling Town, Yangling District, Xianyang City, Shaanxi Province (34°18'27"N, 108°5'58"E). Planting was done on flat land without ridges, with rows 3 meters long, 13 plants per row, a row spacing of 0.6 meters, and a plant spacing of 0.24 meters. After maturity, the plants were harvested and inoculated (…). Figure 2 (E and F) and non-inoculated environment ( Figure 2 Yield analysis was performed on ears under conditions C and D. The results showed that under normal conditions (without inoculation), mutation of the ZmLHT1 gene did not cause yield loss, while under conditions of small leaf spot disease, mutation of the ZmLHT1 gene significantly increased maize yield.
[0162] Example 4: Identification of amino acid transport function of the ZmLHT1 gene in yeast mutants
[0163] The tested plants were maize inbred line B73.
[0164] To determine the amino acid transport function of the protein ZmLHT1 encoded by the ZmLHT1 gene, functional complementation experiments were performed in yeast mutants. The steps are as follows:
[0165] 1. Total RNA was extracted from B73 leaves and reverse transcribed to obtain cDNA.
[0166] 2. Using the cDNA obtained in step 1 as a template, PCR amplification was performed using primer pair consisting of primer 5′-CGCTCTCCAATCTCCCATT-3′ (SEQ ID No. 10) and primer 5′-ACGGCAAAGAACTCGCACT-3′ (SEQ ID No. 11) to obtain the PCR amplification product (ZmLHT1 gene).
[0167] 3. The ZmLHT1 gene was inserted into the yeast expression vector pDR196 to obtain the recombinant vector pDR196-ZmLHT1.
[0168] The recombinant vector pDR196-ZmLHT1 is obtained by replacing the small fragment between the EcoRI and XhoI recognition sites of the pDR196 vector with the DNA fragment whose nucleotide sequence is the DNA fragment of SEQ ID No. 2 in the sequence listing, while keeping the other nucleotide sequences of the pDR196 vector unchanged. After being introduced into the host, the recombinant vector pDR196-ZmLHT1 expresses the ZmLHT1 protein with the amino acid sequence shown in SEQ ID No. 3.
[0169] 4. Recombinant vectors pDR196-ZmLHT1 and pDR196 were transformed into yeast mutant 22Δ10a using the LiAc / ss carrier DNA / PEG method, yielding recombinant strains 22Δ10a / pDR196-ZmLHT1 and 22Δ10a / pDR196. Recombinant strain 23344c / pDR196, obtained by transforming yeast strain 23344c with recombinant vector pDR196, served as a positive control yeast strain, while 22Δ10a / pDR196 served as a negative control yeast strain.
[0170] 5. The transformed recombinant bacteria 22Δ10a / pDR196-ZmLHT1, 22Δ10a / pDR196 and 23344c / pDR196 were cultured in YNB solid and liquid media containing 1mM of Ala, Arg, Gln, Glu, GABA, Phe, Pro, Leu or ammonium sulfate (at 30℃).
[0171] The results showed that when cultured in solid and liquid media containing different amino acids, the growth rate of the positive strain overexpressing the ZmLHT1 gene (recombinant strain 22Δ10a / pDR196-ZmLHT1) was significantly different from that of the empty vector control (recombinant strain 22Δ10a / pDR196). Figure 3 This indicates that ZmLHT1 has amino acid transport function.
[0172] Example 5: Quantitative fluorescence analysis of the ZmLHT1 gene after inoculation with maize leaf spot pathogen.
[0173] The tested plant was maize inbred line B73.
[0174] Maize inbred line B73, cultured in a greenhouse for 28 days, was used to propagate race O of maize leaf spot disease on PDA medium. The spores cultured on the elution medium were then used to prepare a spore suspension (spore concentration 5 × 10⁻⁶). 4 / ml), when the corn reaches the four-leaf stage, the spore suspension is evenly sprayed onto both sides of the corn leaves (the fourth leaf) using an air pump for inoculation. RNA is then extracted from the leaves and reverse transcribed to synthesize the first strand of cDNA. Based on qRT-PCR primer design requirements, Primer Premier 5.0 software was used to design quantitative real-time primers for the ZmLHT1 gene: qRT-LHT1-F: 5′-TACTGGGCTTTCGGCGATA-3′ (SEQ ID No. 12), qRT-LHT1-R: 5′-TGAACATTGTGAACGCAACG-3′ (SEQ ID No. 13). The expression of the ZmLHT1 gene in the leaves after inoculation with the corn leaf blight pathogen was detected using a quantitative real-time analyzer. The results showed that the expression level of the ZmLHT1 gene rapidly increased after inoculation with corn leaf blight race O, reaching its highest level at two hours, then decreased, and then increased again at 16 hours post-inoculation. Figure 4 This indicates that the expression of the ZmLHT1 gene is induced by the corn leaf blight pathogen, and the ZmLHT1 gene is a resistance-related gene for corn leaf blight.
[0175] Example 6: Subcellular localization identification of the ZmLHT1 gene-encoded protein
[0176] The tobacco used in this embodiment is Nicotiana benthamiana.
[0177] The coding sequence of the ZmLHT1 gene (SEQ ID No. 2) was amplified from the cDNA of maize B73 leaves. The coding sequence of the ZmLHT1 gene was then inserted into the expression vectors pCAMBIAsuper1300-mCherry and pEZS-NL, respectively, to obtain the recombinant vectors pCAMBIAsuper1300-mCherry-ZmLHT1 and pEZS-ZmLHT1.
[0178] The recombinant vector pCAMBIAsuper1300-mCherry-ZmLHT1 is obtained by replacing the fragment (small fragment) between the XmaI and KpnI recognition sites of the pCAMBIAsuper1300-mCherry vector with the DNA fragment whose nucleotide sequence is SEQ ID No.2 in the sequence listing, while keeping the other nucleotide sequences of the pCAMBIAsuper1300-mCherry vector unchanged.
[0179] The recombinant vector pEZS-ZmLHT1 is obtained by replacing the fragment (small fragment) between the HindIII and BamHI recognition sites of the pEZS-NL vector with the DNA fragment whose nucleotide sequence is SEQ ID No. 2 in the sequence listing, while keeping the other nucleotide sequences of the pEZS-NL vector unchanged.
[0180] The pCAMBIAsuper1300 fusion expression vector (i.e., the recombinant vector pCAMBIAsuper1300-mCherry-ZmLHT1) was transformed into Agrobacterium tumefaciens GV3101 via a freeze-thaw method. Subsequently, the ZmLHT1-mCherry fusion protein was transiently expressed in tobacco leaves using an Agrobacterium-mediated method.
[0181] Transient expression of the ZmLHT1-mCherry fusion protein was achieved by transforming the pEZS fusion expression vector (i.e., the recombinant vector pEZS-ZmLHT1) into maize protoplasts using a polyethylene glycol (PEG)-mediated transformation method. Fluorescence microscopy revealed that the ZmLHT1 protein was localized on the cell membrane of tobacco leaf and maize protoplast cells. Figure 5 ).
[0182] Example 7: DAB staining analysis of ZmLHT1 mutant lines and wild-type maize after inoculation with maize leaf spot disease.
[0183] The tested plants were:
[0184] 1. Wild-type maize: Maize inbred line B73-329;
[0185] 2. ZmLHT1 mutant plants: ZmLHT1 2bp T3 generation plants of the strain, ZmLHT1 8bp T3 generation plants of the strain, ZmLHT1 25bp T3 generation plants of the strain (at least 10 plants per strain).
[0186] Plants produce large amounts of reactive oxygen species (ROS) to enhance their immunity when infected by pathogens. We used DAB staining to detect the changes in ROS content in ZmLHT1 mutant plants and wild-type maize after inoculation with maize leaf spot disease. Maize seedlings were cultured in a greenhouse for 14 days. After inoculation with the O race of maize leaf spot disease, leaves of ZmLHT1 mutant plants and wild-type maize were collected for DAB staining (staining method reference: Daudi A, et al. Detection of hydrogen peroxide by DAB staining in Arabidopsis leaves. Bio-Protocol, 2012, 2(18):e263. The results showed that there was almost no ROS accumulation in the leaves of wild-type maize, while the leaves of ZmLHT1 mutant plants accumulated a large amount of ROS. Figure 6 This indicates that the ZmLHT1 gene is mainly involved in the clearance of ROS, which causes maize to become susceptible to disease.
[0187] In summary, the ZmLHT1 gene and its encoded ZmLHT1 protein identified in this invention can regulate plant disease resistance (such as resistance to small leaf spot). Reducing the content and / or activity of ZmLHT1 protein in target plants (e.g., by gene knockout of the ZmLHT1 gene) can significantly improve the disease resistance of the target plants. Conversely, increasing the content and / or activity of ZmLHT1 protein in target plants (e.g., by overexpressing the ZmLHT1 gene) can significantly reduce the disease resistance of the target plants.
[0188] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The application of proteins, characterized in that, The application is any one of the following: A1) Application in improving resistance to maize leaf spot disease; A2) Application in breeding maize resistant to small leaf spot; A3) Application in breeding maize for resistance to small leaf spot or in improving maize germplasm resources to enhance resistance to small leaf spot; The amino acid sequence of the protein is shown in SEQ ID No. 3; the application is achieved by knocking out the protein in the target corn.
2. The application of biomaterials, characterized in that, The application is any one of the following: D1) Application in improving resistance to maize leaf spot; Application of D2 in breeding maize resistant to small leaf spot; D3) Application in breeding maize for resistance to small leaf spot or in improving maize germplasm resources to enhance resistance to small leaf spot; The biomaterial is any one of the following: E1) A nucleic acid molecule that inhibits or reduces the expression of the gene encoding the protein of claim 1; wherein the nucleic acid molecule is sgRNA, and the target sequences of the sgRNA are SEQ ID No. 14 and SEQ ID No. 15; E2) An expression cassette containing the nucleic acid molecules described in E1); E3) A recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) Recombinant microorganisms containing the nucleic acid molecules described in E1), or recombinant microorganisms containing the expression cassette described in E2), or recombinant microorganisms containing the recombinant vector described in E3); E5) A recombinant host cell containing the nucleic acid molecule described in E1), or a recombinant host cell containing the expression cassette described in E2), or a recombinant host cell containing the recombinant vector described in E3).
3. A method for breeding maize resistant to small leaf spot disease, characterized in that, The method involves knocking out the protein described in claim 1 in the target corn to obtain corn resistant to leaf spot disease with higher resistance than the target corn.
4. The method according to claim 3, characterized in that, The knockout is performed using a CRISPR / Cas9 system, which includes a vector expressing sgRNA that targets the gene encoding the protein, the target sequences of which are SEQ ID No. 14 and SEQ ID No.
15.
5. A method for preparing maize with enhanced resistance to small leaf spot disease, characterized in that, The method includes the following steps: extracting maize genome sequences as shown in SEQ ID No. 1 of the sequence listing. ZmLHT1 Gene mutation ZmLHT1 / +2bp Gene, ZmLHT1 / -8bp Gene or ZmLHT1 / -25bp Genes were used to obtain maize with improved resistance to small leaf spot disease; ZmLHT1 / +2bp The nucleotide sequence of the gene is shown in SEQ ID No.
16. ZmLHT1 / -8bp The nucleotide sequence of the gene is shown in SEQ ID No.
17. ZmLHT1 / -25bp The nucleotide sequence of the gene is shown in SEQ ID No. 18.
Citation Information
Patent Citations
Corn sheath blight anti-disease gene GRMZM2G127328 and application thereof
CN104498503A