A kit for detecting total RNA residues of Escherichia coli and its detection method and application
By using E. coli 16sRNA as the tag in plasmid DNA products, combined with DNA enzyme digestion in the pretreatment system, the sensitivity and accuracy of E. coli total RNA residue detection in the prior art was solved, and efficient and accurate RNA residue detection was achieved.
Patent Information
- Application Number
- CN202410125081.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-30
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2044-01-30
AI Technical Summary
The prior art shows that when detecting the total RNA residue of E. coli in plasmid DNA products, the sensitivity and accuracy are poor. During the digestion of conventional enzymes, the RNA extraction recovery rate is uncontrollable, affecting the detection accuracy.
Using E. coli 16sRNA as the tag, an E. coli total RNA residue detection kit was developed through RT-qPCR technology. Combined with the DNA enzyme digestion system in the pretreatment system, RT-qPCR was directly tested to improve the accuracy and simplicity of the detection.
Accurate and simple detection of total RNA residues of E. coli is achieved, and the specificity, accuracy, sensitivity and precision of the detection are improved, ensuring the reliability of the detection results.
Smart Images

Figure CN117987574B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of biological detection, and in particular to a kit for detecting residual total RNA of Escherichia coli and a detection method and application thereof. Background Art
[0002] Natural plasmids are DNA molecules other than chromosomes (or nucleoids) in organisms such as bacteria, yeast and actinomycetes. They exist in the cytoplasm and have the ability to replicate autonomously, so that they can maintain a constant copy number in daughter cells and express the genetic information they carry. Plasmids themselves can carry exogenous target genes for the development of plasmid DNA gene therapy drugs. They are also the basic raw materials for cell and gene therapy drugs such as CAR-T and mRNA. Moreover, with the development of science and technology, plasmids have been widely used in the fields of medicine, agriculture, environmental protection, food, etc., especially in advanced therapeutic drug technologies such as cell gene therapy and mRNA vaccines. Plasmids can be used as DNA vaccine products or one of the main components of products. They can also be used as important raw materials for viral vector or DNA vector gene therapy, and important raw materials for viral vector or non-viral vector cell immunotherapy. The RNA residues of these DNA products may affect their biological activity (such as interfering with the transfection and expression efficiency of plasmids) or cause risks (such as exogenous RNA can activate the cell interferon pathway to induce immune response). Therefore, it is necessary to establish a quantitative detection method for RNA residues of DNA products.
[0003] The industrial production of plasmids is to obtain plasmid products through E. coli fermentation, alkaline lysis, and purification. During alkaline lysis, a large amount of RNA in E. coli will be released at the same time and randomly broken into RNA fragments of different sizes. There are currently many methods for detecting total RNA residues in plasmid samples, such as ultraviolet spectrophotometry, agarose gel electrophoresis, and RT-qPCR. The use of ultraviolet spectrophotometry to detect the ratio of OD260 to OD280 of the plasmid DNA product solution can roughly detect whether there is RNA residue, but this method is affected by factors such as protein residues and RNA fragment size. Therefore, in practical applications, this method has poor sensitivity and accuracy for RNA residues. Currently, the commonly used detection methods are agarose gel electrophoresis (AGE) and reverse transcription fluorescence quantitative PCR (RT-qPCR).
[0004] The AGE method can only perform qualitative detection. The commonly used AGE nucleic acid dyes are much less sensitive to RNA than to DNA. The DNA component in the sample will seriously affect the RNA exposure imaging, and the actual RNA residues are RNA degradation fragments rather than complete RNA, which further reduces the sensitivity and accuracy of the AGE method.
[0005] Compared with the AGE method, the sensitivity and accuracy of the reverse transcription fluorescence quantitative PCR (RT-qPCR) method are improved by an order of magnitude. The general RT-qPCR method has a complex experimental process, including sample processing, reverse transcription, PCR reaction, etc. And the sample processing is relatively complicated, which has a greater impact on the test results. Therefore, this subdivision field urgently needs to develop an accurate and simple method for detecting RNA residues in plasmid DNA products or a detection kit for pharmaceutical quality monitoring. The uncontrollable factor in detecting the content of plasmid RNA based on the RT-qPCR method lies in the plasmid sample processing link, and the DNA is generally digested by enzymes before testing. However, due to the cumbersome steps of RNA extraction, the RNA extraction recovery rate will be uncontrollable, which seriously affects the accuracy of the test. In the conventional enzyme digestion process, the amount of enzyme used, the characteristics of the enzyme, and the enzyme reaction time all affect the recovery rate of the final test result. Summary of the invention
[0006] Purpose of the invention: The purpose of the present invention is to provide a kit for detecting residual total RNA of Escherichia coli using the 16sRNA gene of Escherichia coli as a label; another purpose of the present invention is to provide the application of the kit in quantitatively detecting residual total RNA of Escherichia coli; another purpose of the present invention is to provide a method for directly performing RT-qPCR detection on plasmid samples after digestion treatment to determine the residual total RNA of Escherichia coli.
[0007] Technical solution: In order to achieve the above-mentioned purpose of the invention, a kit for detecting residual total RNA of Escherichia coli of the present invention comprises an upstream primer as shown in SEQ ID NO: 1, a downstream primer as shown in SEQ ID NO: 2, a primer probe as shown in SEQ ID NO: 3, a diluent, a reverse transcriptase, an Enzyme Mix and an RNA quantitative reference substance.
[0008] The Enzyme Mix is a DNA polymerase mixture for PCR reaction, including Tag DNA polymerase and dNTPs.
[0009] Furthermore, the RNA quantitative reference substance is derived from a total RNA extract of Escherichia coli.
[0010] Furthermore, the E. coli total RNA residue detection kit also includes a pretreatment system, the pretreatment system includes DNA enzyme and quality control products, and the quality control products contain E. coli DNA, E. coli RNA and plasmid DNA.
[0011] The present invention is based on RT-qPCR technology and establishes a method for direct RT-qPCR detection using 16sRNA gene as a label; in particular, the enzyme digestion system of the pretreatment system is combined with the RT-PCR method to detect RNA residues in plasmid samples, which has good methodological performance.
[0012] The upstream primer, downstream primer, primer probe, reverse transcriptase, and necessary reverse transcription buffer can be pre-mixed and packed into an independent container as Probe Mix. The Probe Mix can also be made into corresponding products through a freeze-drying process to improve product stability and extend product shelf life.
[0013] Preferably, the kit further comprises a digestion reaction solution, wherein the digestion reaction solution comprises an RNase inhibitor and a reaction buffer.
[0014] Preferably, the DNA enzyme is DNase I. The DNA enzyme preferably contains no or very little residual protease.
[0015] Furthermore, to ensure that the DNA enzyme digestion is thorough as a quality control control, the E. coli DNA content in the quality control product is 0.1-1wt%; to ensure that the RNA sample has additional trace losses during the enzyme digestion process as a quality control control, the E. coli RNA content is 5-20pg / μL, and the preferred content is 20pg / μL; to simulate the real sample to provide a high-concentration nucleic acid background as a quality control control, the plasmid DNA content is 0.5-1mg / mL, and the preferred content is 1mg / mL.
[0016] The aforementioned E. coli total RNA residue detection kit can be used for detection of E. coli total RNA residue in plasmid samples used for production in the biopharmaceutical industry, including but not limited to. The aforementioned pre-treatment reagent can be an independent product or included in the E. coli total RNA residue detection kit.
[0017] The present invention also provides a method for detecting residual total RNA of Escherichia coli based on the above-mentioned kit, the method comprising the following steps:
[0018] (1) Digest the plasmid samples and quality control products separately;
[0019] (2) After digestion, the mixture obtained by digestion treatment is directly subjected to RT-qPCR detection.
[0020] The digestion treatment is to add 2-8U / μgDNA DNase to the plasmid sample, react at 37°C for 15-25min, react at 90°C for 8-15min, and store at 2-8°C for future use.
[0021] Furthermore, the recovery rate of the quality control product is between 70% and 130% as the quality control standard. <509> ) published on the reference standard of 50-150% recovery rate of qPCR detection accuracy, the quality control standard provided by the present invention is stricter than that of the United States Pharmacopoeia. The kit and its pretreatment system provided by the present invention make the realization of this standard feasible.
[0022] Beneficial effects: (1) The pretreatment system and corresponding detection method provided by the present invention increase the enzyme digestion quality control while performing sample digestion, control the digestion process through the digestion quality control product, and eliminate the influence of the enzyme digestion process on the detection result; at the same time, it shows better compatibility with different primers. (2) Based on the pretreatment and specific primer probe and reaction system, the present invention has been verified to have excellent specificity, accuracy, sensitivity and precision in the detection of Escherichia coli total RNA residue. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 This is the amplification curve of the Escherichia coli total RNA residue detection kit in Example 1;
[0024] Figure 2 The standard curve of the Escherichia coli total RNA residue detection kit in Example 1;
[0025] Figure 3 This is a linear graph of the specificity data of residual RNA of Escherichia coli in Example 4;
[0026] Figure 4 This is the amplification curve diagram of the specific data of Escherichia coli residual RNA in Example 4. DETAILED DESCRIPTION
[0027] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments.
[0028] Example 1
[0029] This embodiment provides a kit for detecting residual total RNA of Escherichia coli, the contents of which are shown in Table 1:
[0030] Table 1 Escherichia coli total RNA residue detection kit
[0031]
[0032]
[0033] Among them, Enzyme Mix is a DNA polymerase mixture for PCR reaction, including Tag DNA polymerase and dNTPs. Probe Mix reagent contains upstream primer, downstream primer, primer probe, reverse transcriptase and reverse transcription buffer. Among them, the nucleotide sequences corresponding to the upstream primer, downstream primer and probe are shown in Table 2 (synthesized by Shanghai Shenggong Biotechnology); reverse transcriptase was purchased from Vazyme. The diluent was 0.02mg / ml BSA (1×TE, PH 8.0). The RNA quantitative reference was 20ng / μl Escherichia coli total RNA.
[0034] Table 2 Primer and probe sequences
[0035] Primer probe name Sequence information (5'-3') SEQ ID NO. F1 AGATGAGAATGTGCCTTCGG 1 R1 ATTTCACAACACGAGCTGAC 2 O1 ACCGTGAGACAGGTGCTGCATGGC 3
[0036] The amplification curve of the kit provided in this embodiment is as follows Figure 1 As shown, the amplification efficiency is E = 100.2%, R2 = 1.000, the linear range is 2-200000 fg / μL, and the linearity is good. The standard curve used for quantification is as follows Figure 2 shown.
[0037] Example 2
[0038] This embodiment provides a kit for detecting residual total RNA of Escherichia coli comprising a pretreatment system:
[0039] Table 3 Escherichia coli total RNA residue detection kit
[0040]
[0041] The DNA enzyme was DNaseI (Takara), and the 2× digestion reaction solution contained 10× DNaseI buffer: 40mM Tris-HCl, pH 7.5 (8mM Mg 2+ , 5mM DTT), RNase inhibitor (Sigma); water was nuclease-free water (purchased from Thermo); quality control products included 1wt% Escherichia coli DNA (purchased from China National Institute for Food and Drug Control), 20pg / μL Escherichia coli RNA (purchased from Thermo) and 1mg / mL plasmid DNA (extracted and prepared in the laboratory); the sources of other materials are shown in Table 1.
[0042] Example 3
[0043] This example provides a method for detecting residual total RNA of Escherichia coli using the kit described in Example 2, comprising the following steps:
[0044] (1) Preparation of digestion reaction solution
[0045] In a biosafety cabinet, refer to the pretreatment digestion system shown in Table 4, and prepare digestion reaction solutions for quality control products and plasmid samples in PCR reaction tubes respectively;
[0046] Table 4 Pretreatment system (per 1 μg plasmid)
[0047] DnaseI 4U 10x DNaseI buffer 4μL RNase inhibitors 1μL water 30μL Plasmid samples / quality control products 1μL(1μg)
[0048] (2) Digestion reaction
[0049] Place the reaction tube in a thermal cycler at 37°C for 20 min and 90°C for 10 min to complete the digestion reaction;
[0050] (3) Testing the recovery rate of quality control products
[0051] Recovery rate R% = (quality control product test value / quality control product identification value) * 100%
[0052] Determine whether the recovery rate of quality control products meets the quality control standards:
[0053] A. The recovery rate of quality control products is 70-130%, and the sample test value is valid;
[0054] B. When the recovery rate of the quality control product is >130%, it indicates that the sample digestion is incomplete, the digestion efficiency is not up to standard, and the sample test is invalid;
[0055] C. When the recovery rate of the quality control product is <70%, it indicates that the sample digestion is incomplete, the digestion efficiency does not meet the standard, and the sample test is invalid.
[0056] (5) Preparation of RT-qPCR reaction system
[0057] Table 5 RT-qPCR reaction system
[0058] Reagents Single well reaction / μL Probe mix 10 Enzyme mix 1 Primer (10 μM) 0.8 Probe (10 μM) 0.2 10mg / mL BSA 1 DNase / RNase free water 2
[0059] (6) Direct RT-qPCR reaction
[0060] Table 6 RT-qPCR reaction procedure
[0061]
[0062]
[0063] Example 4 Specificity Experiment
[0064] This example investigates the effects of HEK293 genomic DNA and PBMC genomic DNA on the standard curve of the E. coli RNA residue detection method.
[0065] Using 0.02mg / ml BSA (TE buffer) as the RNA reference diluent, three sets of standard curves were prepared, and the highest concentration points of the standard curves were: ① 200pg / μL of Escherichia coli total RNA reference; ② 200pg / μL of Escherichia coli total RNA reference and 200pg / μL of HEK293 genomic DNA mixture (laboratory extraction and preparation); ③ 200pg / μL of Escherichia coli total RNA reference and 200pg / μL of PBMC genomic DNA mixture (laboratory extraction and preparation). These three points were used as the highest points of the three sets of standard curves, and 5 consecutive 10-fold dilutions were performed in sequence to form 6 points of the standard curve to investigate the effects of HEK293 genomic DNA and PBMC genomic DNA on the amplification efficiency of the Escherichia coli RNA residual detection standard curve and the CT values of each concentration. The experimental methods and reagents are as shown in Example 3, and no enzyme digestion treatment is involved. The results of the example show that the related interfering substances HEK239 genome and PBMC genome have no effect on the detection (Table 7, Figure 3 and Figure 4 ).
[0066] Table 7 Escherichia coli residual RNA specificity data
[0067] sample Genomic DNA concentration (ng / μl) Mean detection concentration (fg / μl) HEK293 gDNA 2.11 1.94E-3(<LOD) PBMC gDNA 1.15 4.54E-5(<LOD)
[0068] Example 5 Accuracy Experiment
[0069] Since the quality standard of residual DNA of E. coli host in plasmid samples is generally no more than 1%, and residual DNA of E. coli host interferes with RNA detection, a plasmid sample containing 1% HCD is simulated and prepared, and DnaseI digestion is performed, and high, medium and low final concentrations of 20pg / μL, 2pg / μL, and 0.2pg / μL of E. coli RNA reference products are added simultaneously before digestion, and the recovery rate of RNA after digestion is investigated for evaluating the accuracy of the method, and 3 replicates are performed for each experiment. The results of this embodiment (Table 8) show that the recovery rate of the method or kit described in this patent meets 80-120% before digestion, and the detection results are reliable.
[0070] Table 8 Escherichia coli residual RNA accuracy data
[0071]
[0072]
[0073] Example 6 Sensitivity Experiment
[0074] The total RNA reference of E. coli was diluted to 8fg / μL, 4fg / μL, 2fg / μL, and 1fg / μL. Six replicates were made for each concentration to examine the recovery rate and CV of each concentration of RNA reference. The lowest concentration with a recovery rate of 70%-130% and a CV of <20% was considered the LOQ concentration. 0.02mg / ml BSA (TE Buffer) was used as the sample diluent, and six replicates were made. The concentration corresponding to the mean + 3SD of the sample diluent detection concentration was confirmed as the method LOD concentration. The results of this embodiment (Tables 9 and 10) show that the LOQ of the method or kit described in this patent is 1fg / μL, and the LOD is 0.025fg / μL.
[0075] Table 9 Escherichia coli residual RNA LOD data
[0076]
[0077] Table 10 Escherichia coli residual RNA LOQ data
[0078]
[0079] Example 7 Precision Experiment
[0080] 1% HCD was added to the plasmid sample to prepare a plasmid sample containing 1% HCD, and DNaseI digestion was performed. Before digestion, high, medium, and low final concentrations of 20pg / μL, 2pg / μL, and 0.2pg / μL of E. coli RNA reference products were added at the same time. The CV of each concentration sample after digestion was examined to evaluate the repeatability of the method, and 6 replicates were performed for each experiment. For intermediate precision, 3 replicates were performed for each experiment, and two analysts performed 3 experiments in total for at least 2 days to examine the CV between experiments. The results of this embodiment (Table 11 and Table 12) show that the repeatability and precision of the method or kit described in this patent are less than 20%.
[0081] Table 11 Repeatability data of residual RNA of Escherichia coli
[0082]
[0083]
[0084] Table 12 Intermediate precision data of residual RNA of Escherichia coli
[0085]
[0086] Example 7 Compatibility of pretreatment systems under different primers
[0087] Prepare 1 mg / ml spiked plasmid samples (containing 1% E. coli HCD, final concentration 20 pg / μL RNA), and prepare 1 mg / ml unspiked control plasmid samples at the same time, prepare digestion reaction solutions according to the three different pretreatment systems shown in Table 13 for DNaseI digestion, and place the reaction tubes in a thermal cycler at 37°C for 20 min and 90°C for 10 min to complete the digestion reaction. Use the different primer pair detection systems listed in Table 14 to detect the two samples after the three digestion systems.
[0088] The results of the implementation of the present invention are shown in Tables 15-17. For three pairs of different detection primers, the detection efficiency of three different pre-treatment systems is different. Among them, the C system shows a very good recovery rate for all three pairs of primers, all in the range of 70-130%. The AB systems show a poor recovery rate for primer pair P3, which are 24.70% and 31.17% respectively. Among them, the B group pre-treatment system shows a poor recovery rate for both P2 and P3 primer pairs, and is the worst compatible overall. In contrast, the C pre-treatment body shows better compatibility for different primer pairs, and can show high tolerance for primers of different qualities.
[0089] Table 13 Three different pre-treatment digestion systems
[0090]
[0091] Table 13
[0092]
[0093]
[0094] Table 15 Recovery data of pretreatment system A
[0095] Primer pairs P1 P2 P3 Unspiked control (fg / μl) 0.01 0.59 0.07 Spike detection (fg / μl) 17700.00 14100.00 4940.00 Add scalar fg 20000.00 20000.00 20000.00 Recovery rate (%) 88.50 70.50 24.70
[0096] Table 16 Recovery data of pretreatment system B
[0097] Primer pairs P1 P2 P3 Unspiked control (fg / μl) 16.80 12.80 6.88 Spike detection (fg / μl) 17600.00 11500.00 6240.00 Add scalar fg 20000.00 20000.00 20000.00 Recovery rate (%) 87.92 57.44 31.17
[0098] Table 17 Recovery data of pretreatment system C
[0099] Primer pairs P1 P2 P3 Unspiked control (fg / μl) 0.12 0.69 0.91 Spike detection (fg / μl) 24200.00 14000.00 22400.00 Add scalar fg 20000.00 20000.00 20000.00 Recovery rate (%) 121.00 70.00 112
[0100] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. A kit for detecting residual total RNA of Escherichia coli, characterized in that: The method comprises an upstream primer as shown in SEQ ID NO: 1, a downstream primer as shown in SEQ ID NO: 2, a primer probe as shown in SEQ ID NO: 3, a diluent, a reverse transcriptase, an Enzyme Mix and an RNA quantitative reference substance; The kit also includes a pre-treatment system, which includes DNA enzyme and quality control products, and the quality control products include Escherichia coli DNA, Escherichia coli RNA and plasmid DNA.
2. The kit for detecting residual total RNA of Escherichia coli according to claim 1, characterized in that: The RNA quantitative reference material is derived from the total RNA extract of Escherichia coli.
3. The kit for detecting residual total RNA of Escherichia coli according to claim 1, characterized in that: The pretreatment system also includes a digestion reaction solution, and the digestion reaction solution includes an RNase inhibitor and a reaction buffer.
4. The kit for detecting residual total RNA of Escherichia coli according to claim 3, characterized in that: The DNA enzyme is DNaseI.
5. The kit according to claim 3 or 4, characterized in that: The E. coli DNA content in the quality control product is 0.1-1 wt %, the E. coli RNA content is 5-20 pg / μL, and the plasmid DNA content is 0.5-1 mg / mL.
6. Use of the kit according to any one of claims 1 to 5 for quantitatively detecting residual total RNA of Escherichia coli.
7. A method for detecting residual total RNA of Escherichia coli using the kit according to claim 1, characterized in that: (1) Digest the plasmid samples and quality control products simultaneously; (2) After digestion, the mixture obtained by digestion treatment is directly subjected to RT-qPCR detection.
8. The method according to claim 7, characterized in that: The digestion treatment is to add 2-8 U / μg DNA enzyme to the plasmid sample, and react at 37° C. for 15-25 minutes and at 90° C. for 8-15 minutes.
9. The method according to claim 7 or 8, characterized in that: The recovery rate of the quality control product is between 70-130% as the quality control standard.
Citation Information
Patent Citations
Universal method for rapidly quantifying RNA residue in DNA product
CN110389230A
Kit and method for detecting blue crab reovirus in aquaculture water
CN115305295A
E.coli residual total RNA (Ribonucleic Acid) detection kit and use method thereof
CN116926217A
Detection and quantification of viable bacteria in a sample using RPOS mRNA
WO2011109901A1
Cited By
Real-time fluorescent quantitative PCR (polymerase chain reaction) detection method for total RNA (ribonucleic acid) residual quantity of escherichia coli
CN122012677A