An SNP chip, its preparation method and application
By using modified primers and restriction enzyme cleavage technology in SNP chips, high-density SNP chips are prepared, which solves the problems of small throughput and high cost in the prior art, and achieves high-throughput and low-cost SNP site detection.
Patent Information
- Application Number
- CN202410230122.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2023-05-30
- Filing Date
- 2024-02-29
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2044-02-29
AI Technical Summary
The existing SNP chips have small flux and high cost in plant genome breeding, making it difficult to meet the needs of large-throughput detection.
A solid phase vector modified with two primers was used to fix the oligonucleotide probe cluster prepared by primers to fix multiple library sequences, and a high-density SNP chip was formed by restriction enzyme cleavage, and SNP sites were detected in combination with sequencing technology.
The preparation of high-density SNP chips is realized, which can detect more than 10 million SNP sites, significantly increase the flux and reduce the cost through scale effect.
Smart Images

Figure CN118006735B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a SNP chip, a preparation method thereof, and an application thereof. Background Art
[0002] A gene chip, also called a single nucleotide polymorphism (SNP) microarray, arranges millions of DNA marker sequences regularly on a glass slide or a special silicon wafer and fixes them to form a DNA or SNP probe array. Its working principle is to accurately identify gene information through the base pairing reaction between the DNA marker sequences fixed on the chip and the target genome. The most widely used SNP chip in plant breeding is to detect a large number of SNP variation sites in biological individuals through the SNP probes on the chip, so as to infer the genotype of the genome and key genetic variations. The SNP chip specially designed for genomic breeding is called a "genomic breeding chip". At present, there are two American biotechnology companies, Illumina and Affymetrix, in the market that provide genomic breeding chip manufacturing technologies. Illumina mainly manufactures SNP chips based on the Infinium platform technology, while Affymetrix uses the Axiom platform technology to manufacture SNP chips. The Illumina Infinium chip is a high-density chip based on optical fiber beads, which couples specific gene probe sequences with beads with a diameter of 3 μm and then self-assembles in the micropores of the matrix to form a bead chip. The Affymetrix Axiom chip uses in-situ photolithography technology to in-situ synthesize gene probe sequences on the substrate. These two types of chips have been widely used in human and animal genomic variation research and have also been applied in plant genomic breeding in recent years.
[0003] Currently, the SNP chips conventionally manufactured can detect at most more than 5 million SNP sites, with relatively low throughput and high costs. In plant genomic breeding, SNP chips with high throughput are required. How to achieve a higher-throughput SNP chip remains to be further developed. Summary of the Invention
[0004] Based on this, the purpose of the present invention is to provide a SNP chip, a preparation method thereof, and an application thereof. The preparation method of the present invention can be used to manufacture a high-density SNP chip that can detect more than 10 million SNP sites, with higher throughput, and at the same time reduce costs through economies of scale.
[0005] The technical solutions for achieving the above purpose are as follows.
[0006] In the first aspect of the present invention, there is provided an SNP chip, which comprises a solid-phase carrier modified with two primers, and clusters of oligonucleotide probes prepared from multiple library sequences are fixed on the solid-phase carrier through the primers. The oligonucleotide probes sequentially include a P7 sequence, an adaptor sequence 1, a specific hybridization sequence, and a sequence of at least four nucleotides generated after enzymatic digestion of the library sequence from the 5'-end to the 3'-end, and the nucleotides are arbitrarily selected from A, T, C, and G.
[0007] In the second aspect of the present invention, there is provided a method for preparing any of the above SNP chips, comprising the following steps:
[0008] S1. Design at least one library sequence, which sequentially includes a P7 sequence, an adaptor sequence 1, a specific hybridization sequence, a restriction endonuclease cleavage site sequence, an adaptor sequence 2, and a P5 sequence from the 5'-end to the 3'-end. The restriction endonuclease cleavage site sequence is a sequence that can generate at least four arbitrary nucleotides at the 3'-end after enzymatic digestion.
[0009] S2. Mix at least one library sequence, load it onto a solid-phase carrier, and perform amplification and sequencing. The solid-phase carrier is fixed with a library sequence cluster, wherein the P7 sequence hybridizes with the primer on the solid-phase carrier to amplify the library on the chip surface.
[0010] S3. Perform enzymatic digestion. After enzymatic digestion of the library sequence, a cluster of oligonucleotide probes fixed on the solid-phase carrier is formed, and then dried to obtain the product.
[0011] In some embodiments, the restriction endonuclease is an endonuclease that can generate at least four arbitrary nucleotides at the 3'-end after enzymatic digestion of the cleavage site sequence. In some preferred embodiments, it is BaeⅠ or BarⅠ.
[0012] In some embodiments, the at least four arbitrary nucleotides are 4-6 nucleotides, and the nucleotides are arbitrarily selected from A, T, C, and G.
[0013] In some embodiments, the dosage ratio of each library sequence during mixing is equal.
[0014] In some embodiments, the amplification and sequencing in step S2 are performed in a single-end sequencing manner.
[0015] In the third aspect of the present invention, there is provided the application of any of the above SNP chips in detecting SNP variation sites in plant breeding.
[0016] In the fourth aspect of the present invention, there is provided a method for detecting SNP variation sites in a species, comprising the following steps:
[0017] S1) Obtain any of the above SNP chips;
[0018] S2) Hybridize the sample to be tested with the SNP chip. After hybridization is completed, the probe captures the corresponding gene, and a single-base extension reaction is carried out using the gene as a template. The dNTP used for extension is a blocked dNTP with a fluorescent group. After the extension is completed, the chip is photographed to obtain the base types polymerized in each capture region.
[0019] In some embodiments, the species is a plant or an animal.
[0020] The fifth aspect of the present invention is to provide a kit for detecting SNP mutation sites of a species, which includes any one of the above SNP chips.
[0021] In some embodiments, it further includes a restriction endonuclease, preferably the restriction endonuclease is BaeⅠ or BarⅠ.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] The present invention manufactures an SNP chip based on a sequencing chip, generates a variety of probes by the amplification method during the sequencing process, and obtains the position information of the probes by sequencing; the capture probes are obtained by the method of restriction endonuclease digestion. Since various different genes need to be detected at the SNP sites on the chip and the probe sequences in each different cluster region are different, the endonuclease used must produce a 3'-end NNNN sequence after digestion, such as BaeⅠ, BarⅠ, etc. The SNP chip obtained by the present invention can detect up to 70 - 80 samples simultaneously when detecting the same number of SNP sites, or can detect up to 20 - 25 million SNP sites when detecting the same number of samples. The throughput is significantly improved, and it can be used for detecting SNP mutation sites in plant genome breeding in a large throughput manner, and the cost is reduced through the scale effect. Description of the Drawings
[0024] Figure 1 It is a schematic diagram of the composition of the library sequence.
[0025] Figure 2 It is a schematic diagram of amplification, sequencing and digestion during the preparation of the SNP chip.
[0026] Figure 3 It is a schematic diagram of the result of scanning and photographing the chip prepared in Example 1 by the Salus Pro sequencer.
[0027] Figure 4 It is a schematic diagram of the result of calculating the digestion efficiency of the chip prepared in Example 1 by fluorescence signal.
[0028] Figure 5It is a schematic diagram of the position information of cluster points generated by each library of SEQ ID NO.1 - SEQ ID NO.4 on the chip.
[0029] Figure 6 It is a detection diagram of SNP base information. Detailed implementation manners
[0030] For ease of understanding the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure of the present invention more thorough and comprehensive.
[0031] For the experimental methods without specific conditions noted in the following examples, they are generally carried out under conventional conditions. For example, the fourth edition of "Molecular Cloning: A Laboratory Manual" edited by Green and Sambrook was published in 2013, or according to the conditions recommended by the manufacturer. All common chemical reagents used in the examples are commercially available products.
[0032] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not used to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.
[0033] In some embodiments of the present invention, a method for preparing an SNP chip and a detection method using the SNP chip are provided, including the following steps:
[0034] Designing the library: The library sequence is mainly divided into 5 parts. Among them, P5 and P7 are the sequences for amplification on the substrate (a solid-phase carrier modified with two primers) that constitutes the chip before sequencing. Adaptor 1 and Adaptor 2 are two fixed sequences. Adaptor 2 is the primer for sequencing the probe (specific hybridization sequence) to obtain the probe position information, and the probe is used to hybridize with the DNA of the SNP site to be detected in the sample to be tested. There is a restriction enzyme cleavage site between Adaptor 2 and the probe. The restriction enzyme can be any one that generates a 3'-end NNNN (N is any nucleotide selected from A, T, C, G) after cleavage, such as BaeⅠ, BarⅠ, etc., so as to expose the probe end after sequencing. The composition of the library sequence is referred to Figure 1 .
[0035] Wherein, the "solid support" refers to any insoluble substrate or matrix to which nucleotide molecules can be attached, such as latex beads, dextran beads, polystyrene surfaces, polypropylene surfaces, polyacrylamide gels, gold surfaces, glass surfaces, and silicon wafers. The solid support can be a flat glass surface. The solid support can be installed inside a flow cell to allow various reagent solutions to interact. The solid support constitutes the substrate of the chip.
[0036] In certain embodiments, the solid support may comprise an inert substrate or matrix that has been "functionalized", for example, by adding an intermediate material layer or coating, the intermediate material comprising reactive groups that allow covalent attachment to molecules such as polynucleotides. As a non-limiting example, such a support may include a polyacrylamide hydrogel layer on an inert substrate such as glass. In such embodiments, the polynucleotide can be directly covalently attached to the intermediate layer (such as the hydrogel), but the intermediate layer itself may be non-covalently attached to other layers of the substrate or matrix (such as a glass substrate). Thus, covalent attachment to the solid support should be interpreted to cover such designs.
[0037] Amplification, sequencing, and digestion: Amplification and sequencing are performed in a single-end sequencing manner. The designed library is loaded onto the chip surface, which is modified with complementary sequences of P7 and P5, so that the library hybridizes to the chip surface. Then, a cycle process of polymerase extension, denaturation, polymerase extension, and denaturation is carried out until amplification is completed. Subsequently, sequencing is performed to obtain the position information of each probe region on the chip surface. Then, digestion is carried out to obtain the chip that can finally capture samples. See Figure 2 .
[0038] Hybridization and detection: The chip is hybridized with the sample to be detected (such as a DNA sample to be detected). After hybridization is completed, the probe captures the corresponding gene. Using the gene as a template, a one-base extension reaction is carried out. The dNTP used for extension is a blocked dNTP with a fluorescent group. After the extension is completed, the chip is photographed to obtain the base types polymerized in each capture region. At the same time, it is registered with the photo of the first sequencing. In this way, both the probe position information and the polymerized base information are obtained, and thus the SNP information of the gene can be analyzed.
[0039] The present invention will be further described in detail below with reference to specific embodiments.
[0040] Example 1: Fabrication of SNP Chip and Detection of Digestion Efficiency
[0041] The following four library sequences were synthesized by GenScript Biotech Corporation. The synthesized sequence dry powder was diluted to 4 nM with Low TE buffer according to the concentration marked on the synthesis tube. Then, 2 μl of each of the four libraries was mixed in equal proportions, and 1992 μl of 3XSSC solution was added and shaken well to obtain a 2 ml mixed library solution.
[0042] The following four library sequences, respectively, from the 5'-end to the 3'-end, sequentially include the P7 sequence, adapter sequence 1, specific hybridization sequence (underlined part), restriction endonuclease cleavage site sequence, adapter sequence 2, and P5 sequence.
[0043] SEQ ID NO.1:
[0044] CAAGCAGAAGACGGCATACGAGATTCACTGCGATGCTGGATGTTTGCACTCTGG ATTCATCTCTGTTT TTCTTTAAGTT ttcacNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNNCCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC.
[0045] SEQ ID NO.2:
[0046] CAAGCAGAAGACGGCATACGAGATGCAGCCTGCTATCTGTTTACGTATCTCCTT CAAGTTTCTAAGTC AGTGTGGCAAG cccaaNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNNCCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC.
[0047] SEQ ID NO.3:
[0048] CAAGCAGAAGACGGCATACGAGATATTTTTCCTGAAACAATCAAGGGATAGAAA AGAAAAACATGTGA TACAAATCTCC tcattNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNNCCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC.
[0049] SEQ ID NO.4:
[0050] CAAGCAGAAGACGGCATACGAGATGAGCTGTGTACCCCGTATGCCATCTCAAAATGGTTGAGGGACGTAATGGTTTATAttcatNNNNNNNNNNACNNNNGTAYCNNNNNNNNNNNNCCCGTTCGCAACATGTCTGGCGTCATATCTTGTGACTACAGCACCCTCGACTCTCGC。
[0051] Among them, N represents any one of A, T, C, and G, and Y represents any one of C and T.
[0052] Add the 2 ml of the mixed solution in the first step to the sample well of the Salus Pro sequencing reagent kit (SRM-SE75). The sequencing reagent kit includes a sequencing kit and a sequencing chip (a solid-phase carrier modified with two primers, which are the P5 sequence and the P7 sequence respectively). The SNP capture chip is made based on the sequencing chip. Subsequently, refer to the sequencing kit instructions to perform SE75 sequencing on the sequencing chip on the Salus Pro sequencer. The sequencing results are shown in Table 1.
[0053] Obtain the position information of the cluster points ([[]] Figure 5 ) generated by each library of SEQ ID NO.1 - SEQ ID NO.4 on the chip through the basecall algorithm on the Salus Pro sequencer (each library of SEQ ID NO.1 - SEQ ID NO.4 corresponds to Figure 5 and Figure 6 the SEQ 1 library, SEQ 2 library, SEQ 3 library, and SEQ 4 library in
[0054] Table 1. Sequencing results:
[0055]
[0056] 3) After sequencing, there are two channels on the sequencing chip, namely Channel 1 and Channel 2. Wash the chip with 200 ul of wash buffer. Subsequently, take 100 ul of BaeI (10 ul of rCutSmart buffer, 5 ul of BaeI, 85 ul of Nuclease-free water) solution and add it to Channel 2 of the chip for BaeⅠ or BarⅠ digestion. Place the chip in an oven at 37 °C and react for 30 min.
[0057] 4) After the reaction is completed, add 100 μl of formamide to the two flow channels of the sequencing chip, react at 55 °C for 10 min, and then wash the chip with 200 μl of wash buffer. The SNP capture chip is completed. At this time, flow channel 1 of the chip is used as the control group, and the library sequence on flow channel 2 of the chip has been digested and the probe end (red mark) is exposed, as shown below;
[0058] SEQ ID NO.5:
[0059] CAAGCAGAAGACGGCATACGAGATTCACTGCGATGCTGGATGTTTGCACTCTGG ATTCATCTCTGTTT TTCTTTAAGTTTTCAC。 Among them, TTCAC is the random sequence at the 3'-end left on the oligonucleotide probe after digestion.
[0060] SEQ ID NO.6:
[0061] CAAGCAGAAGACGGCATACGAGATGCAGCCTGCTATCTGTTTACGTATCTCCTT CAAGTTTCTAAGTC AGTGTGGCAAGCCCAA。 Among them, CCCAA is the random sequence at the 3'-end left on the oligonucleotide probe after digestion.
[0062] SEQ ID NO.7:
[0063] CAAGCAGAAGACGGCATACGAGATATTTTTCCTGAAACAATCAAGGGATAGAAA AGAAAAACATGTGA TACAAATCTCCTCATT。 Among them, TCATT is the random sequence at the 3'-end left on the oligonucleotide probe after digestion.
[0064] SEQ ID NO.8:
[0065] CAAGCAGAAGACGGCATACGAGATGAGCTGTGTACCCCGTATGCCATCTCAAAA TGGTTGAGGGACGT AATGGTTTATATTCAT。 Among them, TTCAT is the random sequence at the 3'-end left on the oligonucleotide probe after digestion.
[0066] 5) Synthesize the following fluorescent primers (SEQ ID NO.9) by Sangon Biotech (Shanghai). Dilute the synthesized dry fluorescent primers to 100 μM with LowTE buffer according to the concentration marked on the synthesis tube. Then, take 2 μL of the diluted primers and dissolve them in 198 μL of 3XSSC solution. Inject 100 μL of the solution into each of the two flow channels of the chip. Subsequently, react at 55 °C for 3 min and then at 25 °C for 3 min. After the reaction is completed, wash the chip with 200 μL of washbuffer, and place it on the Salus Pro sequencer for scanning and photographing. The photographing results are as Figure 3 shown. In flow channel 1, since no digestion was performed, the signal of the hybridized SEQ ID NO.9 fluorescent primer is strong. In flow channel 2, after digestion to expose the probe end, the sequence that can hybridize with the fluorescent primer has been excised, resulting in a weakened fluorescent signal.
[0067] Calculate the digestion efficiency through the fluorescent signal, which is approximately 65%, as Figure 4 shown.
[0068] SEQ ID NO.9: Cy5-TATGACGCCAGACATGTTGCGAACGGG.
[0069] 6) Conduct sample detection: Add 100 μL of the DNA sample to be detected for SNP sites to the chip and react at 42 °C for 10 min. Then, use the sequencing kit described in step 2 to perform an additional 1-base extension. Obtain the fluorescence emitted by each cluster point in the picture through the sequencer photographing, so as to judge the base information of the SNP site. At the same time, compare the picture taken this time with the sequencing picture in step 2 to obtain the gene information corresponding to each cluster point, and complete the SNP detection ( Figure 6 ); Take the probe formed after digestion of the SEQ ID NO.1 library as an example. After the SE75 sequencing in step 2, obtain the position information of the SEQ ID NO.1 probe on the chip. Then, perform an additional 1-base extension after hybridizing and detecting the sample. Through the sequencing picture, the base information extended at the corresponding position can be obtained. Figure 6 If the corresponding cluster point on the [position] emits light in the A-base channel, it indicates that the SNP site base of the gene detected by SEQ ID NO.1 in this sample is the A base; by the same token, it can be inferred that the SNP site of the gene detected by SEQ ID NO.2 is the C base, the SNP site of the gene detected by SEQ ID NO.3 is the T base, and the SNP site of the gene detected by SEQ ID NO.4 is the G base. This shows that the probes formed by these 4 libraries capture the SNP base information of the corresponding genes in the sample. After obtaining this information, it can be applied to downstream bioinformatics analysis.
[0070] Compared with the prior art, the present invention has a higher detection throughput, can detect more SNP sites in the same sample, or detect multiple samples simultaneously. With a higher throughput, the detection cost can be significantly reduced through economies of scale. Taking the SNP chips of Illumina and Affymetrix as examples, the chips can detect at most more than 5 million SNP sites and can detect 8 - 24 samples simultaneously. From the results in Table 1, it can be deduced that the Raw Q30 in Table 1 indicates the sequencing quality, and the total reads indicate the number of 4 libraries on the chip. On average, each library is about 21,230K; if 50K sites of a sample need to be detected, then 50K libraries are required, and each library is repeated 80 times, so a total of 4,000K libraries are needed. According to the quantity of 84,919K in Table 1, dividing by 4,000K indicates that one flow cell can detect at least 20 samples, and a chip can be made into 4 flow cells, so one chip can detect 80 samples; if the number of samples is reduced, and one flow cell only detects 4 samples, then 250K sites of a sample can be detected, which can be corresponded to the information listed above. It can be seen that the present invention can detect up to 70 - 80 samples simultaneously when detecting the same number of SNP sites, or can detect 20 - 25 million SNP sites when detecting the same number of samples, and the throughput is significantly improved.
[0071] The above-described embodiments merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.
Claims
1. A preparation method of an SNP chip, characterized in that Comprising the following steps: S1. Design at least one library sequence, which sequentially includes a P7 sequence, an adaptor sequence 1, a specific hybridization sequence, a restriction endonuclease cleavage site sequence, an adaptor sequence 2, and a P5 sequence from the 5'-end to the 3'-end. The restriction endonuclease cleavage site sequence is a sequence that can generate at least 5 arbitrary nucleotides at the 3'-end of the specific hybridization sequence after cleavage; S2. Mix at least one library sequence, load it onto a solid support, amplify and sequence it. There are library sequence clusters fixed on the solid support. Among them, the P7 sequence hybridizes with the primer in the library sequence clusters on the solid support to amplify the library on the chip surface; S3. Perform restriction endonuclease cleavage. After cleavage, the library sequence forms oligonucleotide probe clusters fixed on the solid support. The oligonucleotide probe sequentially includes a P7 sequence, an adaptor sequence 1, a specific hybridization sequence, and a sequence of 5 arbitrary nucleotides generated at the 3'-end of the specific hybridization sequence after cleavage of the library sequence. The nucleotides in the sequence of 5 arbitrary nucleotides are arbitrarily selected from A, T, C, G. Dry it to obtain; The restriction endonuclease is BaeⅠ or BarⅠ; The P7 sequence is as shown in CAAGCAGAAGACGGCATACGAGAT; The adaptor sequence 1 is as shown in TCTTTCCCTACACGACGCTCTTCCGATCT; The adaptor sequence 2 is as shown in CCCGTTCGCAACATGTCTGGCGTCATA; The P5 sequence is as shown in TCTTGTGACTACAGCACCCTCGACTCTCGC; 2. The method for preparing the SNP chip according to claim 1, wherein When mixing, the dosage ratio of each library sequence is equal.
3. The preparation method of the SNP chip according to any one of claims 1-2, characterized in that, The amplification and sequencing in step S2 are carried out in a single-end sequencing manner.
4. An SNP chip obtained by the preparation method according to any one of claims 1-3.
5. Use of the SNP chip according to claim 4 in detecting SNP variant sites in plant breeding.
6. A kit for detecting SNP mutation sites of a species, characterized in that, Comprising the SNP chip according to claim 4.
7. A method for detecting SNP mutation sites of a species, characterized in that, Comprising the following steps: S1) Obtain the SNP chip according to claim 4; S2) Hybridize the sample to be tested with the SNP chip. After hybridization, the probe captures the corresponding gene, and a single-base extension reaction is carried out using the gene as a template. The dNTP used for extension is a blocked dNTP with a fluorescent group. After the extension is completed, the chip is photographed to obtain the base types aggregated in each capture area.
8. The method according to claim 7, characterized in that, The species is a plant or an animal.
Citation Information
Patent Citations
Kit for genotyping
CN114144529A
Cited By
Preparation method of DNA (deoxyribonucleic acid) sample for SNP (single nucleotide polymorphism) chip detection
CN122303381A