A pharmaceutical composition for inhibiting the expression of NFKBIZ gene and its application

Through the coupling of targeted ligand molecules and nucleic acid molecules, the delivery efficiency of nucleic acid molecules on the ocular surface is improved, the delivery difficulty of existing drugs in the treatment of ophthalmic diseases is solved, and the efficient inhibition of the NFKBIZ gene is achieved, and the effective treatment of ophthalmic diseases is effectively carried out.

CN118059118BActive Publication Date: 2025-07-22YUMO BIOTECHNOLOGY (SHANGHAI) CO LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410054022.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-13
Publication Date
2025-07-22
Estimated Expiration
2044-01-13

AI Technical Summary

Technical Problem

The existing small molecule immunomodulatory drugs have poor water solubility, toxic side effects of high-frequency repeated administration, low bioavailability and poor patient compliance when treating ophthalmic diseases. The siRNA delivery efficiency targeting the NFKBIZ gene is low, making it difficult to efficiently inhibit NFKBIZ gene expression.

Method used

A pharmaceutical composition is designed to target ocular tissue-specific proteins by coupling targeting ligand molecules with nucleic acid molecules, thereby improving the efficiency of nucleic acid molecules entering ocular surface cells, including covalent coupling of nucleic acid aptamers or boric acid derivatives targeting mucins, integrins and CD44 with nucleic acid aptamers or boric acid derivatives to form a pharmaceutical composition to achieve efficient inhibition of the NFKBIZ gene.

Benefits of technology

It improves the retention and adhesion ability of nucleic acid molecules on the eye surface, increases bioavailability, reduces drug loss, achieves efficient inhibition of the NFKBIZ gene, and effectively treats ophthalmic diseases such as dry eye, keratitis and blepharitis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118059118B_ABST
    Figure CN118059118B_ABST
Patent Text Reader

Abstract

The present invention provides a pharmaceutical composition for inhibiting the expression of the NFKBIZ gene and its application, belonging to the technical field of biomedicine. The present invention designs double-stranded nucleic acid molecules capable of targeting and regulating the expression of the NFKBIZ gene. By verifying the gene regulation efficiency of the nucleic acid molecules, multiple nucleic acid molecules are screened to be able to inhibit the expression of the NFKBIZ gene, and the purpose of efficiently inhibiting the expression of IκB-ζ protein is achieved at the protein level. At the same time, the present invention verifies the application of the pharmaceutical composition formed by coupling the above nucleic acid molecules and targeting ligand molecules in ophthalmic diseases. This pharmaceutical composition can solve the problems of low delivery efficiency and poor therapeutic effect of existing small molecule immunomodulatory drugs, endow small nucleic acid drugs with tissue-targeted delivery function, and has advantages such as long drug effect time and small side effects; in addition, the composition of the pharmaceutical composition is simple and easy to synthesize, and has good prospects for translational application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a pharmaceutical composition for inhibiting the expression of NFKBIZ gene and its application. Background Art

[0002] IκB-ζ (inhibitor of nuclear factor kappa-B ζ) is an atypical member of the IkappaB protein family. IκB-ζ is distributed in the nucleus and mainly controls the expression of secondary response genes of the nuclear factor κB (NF-κB) signaling pathway. The NF-κB signaling pathway plays a key role in a variety of cellular processes, including cell growth, differentiation, and apoptosis, and particularly plays a core role in immune responses and inflammatory reactions. IκB-ζ is encoded by the NFKBIZ gene. The activation and up-regulation of the NFKBIZ gene can promote the expression and secretion of a series of cellular inflammatory factors downstream of the NF-κB signaling pathway, widely regulate the functions of various cells such as the mononuclear phagocyte system, NK cells, T cells, B cells, and epithelial cells, and has been proven to be a key regulatory gene in the inflammatory process and immune regulation. Ocular surface diseases are the most common diseases in ophthalmology, such as dry eye, keratitis, conjunctivitis, blepharitis, etc., all of which are related to inflammation and can be treated by inhibiting the expression of inflammatory factors. Therefore, regulating the expression of the NFKBIZ gene is a potential treatment method for such diseases.

[0003] Small interfering RNA (siRNA), as an important effector molecule of RNA interference (RNAi) technology, induces specific degradation of target gene mRNA in vivo through double-stranded RNA (dsRNA), thereby causing gene silencing at different levels and having great potential for treating diseases. Compared with small molecule drugs, siRNA has advantages such as rich targets, low drug resistance, long-acting, and easy synthesis and production; compared with the challenges faced by antibodies, such as high cost, potential systemic toxicity, and the generation of anti-antibodies, siRNA has the advantages of longer duration and higher safety. In addition, siRNA drugs have been favored by more and more pharmaceutical companies in recent years because of their higher probability of becoming drugs and more time-saving and convenient R & D and production processes. Therefore, targeting inflammation-related genes, such as the NFKBIZ gene, through small interfering RNA technology to achieve the purpose of immune regulation has good application prospects. However, there are few reports on siRNA targeting the NFKBIZ gene at present, and the knockout efficiency is low, which cannot meet the requirements of highly inhibiting the expression of the NFKBIZ gene.

[0004] In addition, several siRNA drugs have been approved in the field of treating liver-related diseases, yet the treatment of non-liver diseases still awaits development. As one of the most delicate organs in the human body, due to its unique anatomical and physiological characteristics, the common administration method for the eye is local administration, with eye drops, eye ointments, and ophthalmic gels being the main dosage forms. For immune-related diseases, existing small molecule immunomodulatory drugs in clinical practice have problems in drug delivery, such as poor water solubility, toxic and side effects of high-frequency repeated administration, low bioavailability, only 5% - 10% of the dose reaching the target tissue, and poor patient compliance. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide a pharmaceutical composition for inhibiting the expression of the NFKBIZ gene, which is a conjugate formed by a targeting ligand molecule and a nucleic acid molecule with gene regulation function. By using the targeting ligand molecule to target the eye tissue-specific protein, the efficiency of the nucleic acid molecule entering the ocular surface cells is improved, the expression of the NFKBIZ gene is efficiently down-regulated, thereby efficiently inhibiting the expression of the IκB-ζ protein at the protein level, ultimately solving the problem of gene drug delivery, improving the bioavailability of the drug, and achieving effective treatment of related diseases.

[0006] The present invention provides a pharmaceutical composition for inhibiting the expression of the NFKBIZ gene, comprising a nucleic acid molecule for inhibiting the expression of the NFKBIZ gene and a targeting ligand molecule targeting the eye tissue-specific protein.

[0007] Preferably, the nucleic acid molecule comprises at least one of the following nucleotide sequences:

[0008] A. The sense strand of the nucleic acid molecule is selected from at least one of the following numbered nucleotide sequences: SEQ ID NO: 1 - SEQ ID NO: 18, SEQ ID NO: 25 - SEQ ID NO: 49, SEQ ID NO: 51 - SEQ ID NO: 89, SEQ ID NO: 93 - SEQ ID NO: 108, SEQ ID NO: 113 - SEQ ID NO: 132, SEQ ID NO: 134 - SEQ ID NO: 135, SEQ ID NO: 138, SEQ ID NO: 143 - SEQ ID NO: 152, SEQ ID NO: 154 - SEQ ID NO: 161, SEQ ID NO: 169 - SEQ ID NO: 185, and SEQ ID NO: 421;

[0009] The antisense strand of the nucleic acid molecule is selected from at least one of the following numbered nucleotide sequences: SEQ ID NO: 211 to SEQ ID NO: 228, SEQ ID NO: 235 to SEQ ID NO: 259, SEQ ID NO: 261 to SEQ ID NO: 299, SEQ ID NO: 303 to SEQ ID NO: 318, SEQ ID NO: 323 to SEQ ID NO: 342, SEQ ID NO: 344 to SEQ ID NO: 345, SEQ ID NO: 348, SEQ ID NO: 353 to SEQ ID NO: 362, SEQ ID NO: 364 to SEQ ID NO: 371, SEQ ID NO: 379 to SEQ ID NO: 395, and SEQ ID NO: 422;

[0010] B. Nucleotide sequences that are continuously or discontinuously increased, deleted, or replaced by 2 to 3 bases on the basis of the nucleotide sequence in item A and have an inhibitory effect by targeting the NFKBIZ gene.

[0011] Preferably, a hanging single strand is further provided at the end of the sense strand or antisense strand of the nucleic acid molecule.

[0012] Preferably, the length of the hanging single strand is 1 to 3 nt.

[0013] Preferably, the nucleic acid molecule comprises any one or more of the following modified nucleotides: deoxynucleotides, 3'-terminal deoxythymidine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy modified nucleotides, locked nucleotides, conformationally restricted nucleotides, constrained ethyl nucleotides, abasic nucleotides, 2'-amino modified nucleotides, 2'-O-allyl modified nucleotides, 2'-C-alkyl modified nucleotides, 2'-hydroxy modified nucleotides, 2'-methoxyethyl modified nucleotides, 2'-O-alkyl modified nucleotides, morpholino nucleotides, aminophosphates, nucleotides containing unnatural bases, tetrahydropyran modified nucleotides, 1,5-anhydrohexitol modified nucleotides, cyclohexenyl modified nucleotides, nucleotides containing phosphorothioate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates, and nucleotides containing 5'-phosphate mimetics.

[0014] Preferably, the targeting ligand molecule targeting the ocular tissue-specific protein includes at least one of the following: a nucleic acid aptamer targeting the ocular tissue-specific protein, a compound modified with boric acid or its derivatives, or a compound modified with phenylboric acid or its derivatives.

[0015] Preferably, the eye tissue-specific protein includes at least one of the following: mucin, integrin, and CD44;

[0016] The mucin includes at least one of the following: MUC-1, MUC-4, and MUC-16;

[0017] The integrin includes at least one of the following: α V β1, α V β3, α V β6, α5β1, α6β1, α V β1, α V β5, α6β4, and α1β1.

[0018] Preferably, the nucleotide sequence of the aptamer targeting mucin MUC-1 is as shown in SEQ ID NO: 423;

[0019] The nucleotide sequence of the aptamer targeting mucin MUC-16 is as shown in SEQ ID NO: 424;

[0020] The nucleotide sequence of the aptamer targeting integrin α v β3 is as shown in SEQ ID NO: 425.

[0021] The nucleotide sequence of the aptamer targeting CD44 is as shown in SEQ ID NO: 426.

[0022] Preferably, the aptamer further includes an aptamer modified by enhanced stability modification;

[0023] The enhanced stability modification includes at least one of the following: phosphorothioate backbone modification, 2'-O-methyl modification, 2'-methoxyethyl modification, 2'-fluoro modification, Inverted dT modification, deoxythymidine nucleotide and polyethylene glycol terminal conjugation.

[0024] Preferably, the compound modified with boric acid or its derivative or the compound modified with phenylboric acid or its derivative is a linear or branched compound with terminal modification of boric acid or phenylboric acid;

[0025] The number of boric acid or its derivative or phenylboric acid or its derivative modifications on the linear or branched compound is 1 to 40;

[0026] Preferably, the structural formula of the compound modified with boric acid or its derivative or the compound modified with phenylboric acid or its derivative is shown as any one of Formula 1 to Formula 10:

[0027]

[0028]

[0029] In Formulas 1 to 10, A and G are each independently absent, -(CH2) h -, or -(CH2) h - in which any one or more methylene groups are replaced by an M group; h is 0 to 15; the M group includes: -O-, -S-, -C(O)-, -C(O)O-, -C(O)NH-, -CH(T C ), -, -C(T’)(T”), -NH-, -N(T N ), -, -S-S-, -C(T’)=C(T”), -C≡C-, and one or more of;

[0030] T in the M group C , T N , T’, and T” represent that any one or more hydrogen atoms on the specified atom are replaced by L, provided that the normal valence of the specified atom is not exceeded and the substitution generates a stable compound, and the specified atom includes a carbon atom or a nitrogen atom; the L group includes any one of the following: C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, hydroxy, oxo, carboxy, cycloalkyl, cycloalkenyl, heterocyclic group, heteroaryl, aryl, ketone, alkoxycarbonyl, aryloxycarbonyl, heteroaryloxycarbonyl, or halogen; the halogen includes F, Cl, Br, or I; (O) in A represents a carbonyl oxygen atom;

[0031] D, E, and H are each independently absent, -O-, -S-, -C(O)-, -NH-, -CH2-, -C(O)NH-, -NHC(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, and one or more of; (O) in the D, E, and H groups represents a carbonyl oxygen atom; the represents the connection position of the structural formula where it is located; A, G, D, E, and H are not all absent at the same time;

[0032] K represents boric acid or its derivative or phenylboronic acid and its derivative; m, n, and t are independently 1 to 15.

[0033] Preferably, the targeting ligand molecule is directly covalently coupled to the end of the nucleic acid molecule.

[0034] Preferably, when the targeting ligand molecule is a nucleic acid aptamer, the phosphate group of the nucleic acid aptamer is covalently coupled to the ribose of the nucleic acid molecule.

[0035] Preferably, when the targeting ligand molecule is a compound modified with boric acid or its derivative or a compound modified with phenylboronic acid or its derivative, the targeting ligand molecule is covalently coupled to the phosphate group or base at the end of the nucleic acid molecule;

[0036] When covalently coupled to the phosphate group at the end of the nucleic acid molecule, the targeting ligand molecule is coupled through an X group; the X group represents -O- or -S-.

[0037] Preferably, the targeting ligand molecule is covalently coupled to the nucleic acid molecule through an extension sequence connected to the end of the nucleic acid molecule.

[0038] Preferably, the extension sequence includes an extension sequence connected to the end of the nucleic acid molecule at only one end and / or an extension sequence with one end connected to the 3'-end of one strand of the nucleic acid molecule and the other end connected or not connected to the 5'-end of the complementary strand of the nucleic acid molecule to form a stem-loop structure.

[0039] Preferably, the length of the extension sequence is 1 - 40 nt; the extension sequence is a random nucleotide sequence.

[0040] Preferably, when the targeting ligand molecule is a nucleic acid aptamer, the phosphate group of the nucleic acid aptamer is covalently coupled to the ribose of the extension sequence.

[0041] Preferably, when the targeting ligand molecule is a compound modified with boric acid or its derivative or a compound modified with phenylboronic acid or its derivative, the targeting ligand molecule is covalently coupled to one or more than two phosphate groups or bases on the extension sequence;

[0042] When covalently coupled to the phosphate group of the extension sequence, the targeting ligand molecule is coupled through an X group; the X group represents -O- or -S-.

[0043] The present invention provides the application of the pharmaceutical composition in the preparation of a medicament for preventing and / or treating eye diseases.

[0044] Preferably, the eye diseases include one or more of the following: dry eye, keratitis, conjunctivitis, and blepharitis.

[0045] The present invention provides a pharmaceutical composition for inhibiting the expression of the NFKBIZ gene, comprising the nucleic acid molecule and the targeting ligand molecule. By conjugating the nucleic acid molecule and the targeting ligand molecule, the present invention can solve the problems of poor water solubility, poor compliance with high-frequency repeated administration, toxic and side effects, low bioavailability, and poor patient compliance of commonly used immunomodulatory drugs for existing ophthalmic diseases. At the same time, according to the characteristics of the eye tissue structure, the present invention screens the target molecules specifically recognized by the ocular surface tissue, which can achieve the targeted and efficient delivery of the functional nucleic acid, so as to enable the functional nucleic acid to exert its biological function efficiently. In addition, the pharmaceutical composition for inhibiting the expression of the NFKBIZ gene provided by the present invention has simple components and is easy to synthesize, and has good prospects for translational application.

[0046] Furthermore, the present invention specifically defines the sequence of the nucleic acid molecule. Using the NFKBIZ gene (GenBank accession number: NM_031419.4) as a template, 210 pairs of double-stranded ribonucleic acid molecules are obtained through siRNA design. Further, qPCR and Western-blot are used to verify the gene silencing efficiency of siRNA at the gene level and protein level, respectively. The results show that multiple siRNAs screened by the present invention can efficiently inhibit the expression of NFKBIZ mRNA, and it is confirmed at the protein level that they have the property of inhibiting the expression of IκB-ζ. It can be seen that the present invention provides a batch of nucleic acid molecules that can specifically inhibit the expression of the NFKBIZ gene and the protein IκB-ζ, which have the advantages of being not easily drug-resistant and having a long-lasting effect compared with existing small molecule immune drugs, and provide a basis for preventing and treating inflammation-related diseases by inhibiting the expression of inflammatory factors.

[0047] Furthermore, the targeting ligand molecules involved in the present invention are specifically defined into two categories, one is nucleic acid aptamer, and the other is boric acid / phenylboric acid and their derivatives. Among them, the nucleic acid aptamer is conjugated with the nucleic acid molecule. Based on the targeting effect of the nucleic acid aptamer on the ocular-specific tissue protein, the efficiency of the nucleic acid molecule entering the cell is improved, thereby improving the inhibitory effect of the NFKBIZ gene in ocular surface cells, enhancing the retention and adhesion ability of the gene pharmaceutical composition on the ocular surface, increasing the bioavailability and reducing the loss of the drug, and realizing the effective treatment of ocular surface diseases. At the same time, by conjugating boric acid / phenylboric acid and their derivatives with different valence states to the nucleic acid molecule directly or through an extended sequence, the present invention can effectively improve the entry of the nucleic acid molecule into the cell and enhance the inhibitory effect of the NFKBIZ gene, so as to realize the treatment of ocular surface diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 Schematic diagram of the pharmaceutical composition formed by the nucleic acid molecule and the targeting ligand molecule provided by the present invention;

[0049] Figure 2 Schematic diagram of the conjugation of the nucleic acid aptamer and the nucleic acid molecule through an extended sequence, where Represents a nucleic acid molecule part, and the bases can be A (adenine), G (guanine), C (cytosine), U (uracil); Represents an extension sequence part, which can be a ribonucleotide molecule or a deoxyribonucleotide molecule, and the bases can be any one of A (adenine), G (guanine), C (cytosine), T (thymine), and n is the base length of 1 - 40; Represents an aptamer part;

[0050] Figure 3 Is a schematic diagram of the covalent coupling of a nucleic acid molecule forming a stem - loop structure with a target ligand molecule;

[0051] Figure 4 Is a qPCR result graph for the screening of siRNA for inhibiting the NFKBIZ gene;

[0052] Figure 5 Is a Wester - blot result graph of the siRNA for inhibiting the NFKBIZ gene on the expression of IκB - ζ protein;

[0053] Figure 6 Is a polyacrylamide gel electrophoresis graph of the Apt - siNFKBIZ gene drug composition;

[0054] Figure 7 Is the result of the targeted uptake of the Apt - siNFKBIZ - Cy3 gene drug composition by HCEC cells; where A is the result detected by a laser confocal microscope and B is the result detected by a flow cytometer;

[0055] Figure 8 Is a qPCR result graph of the Apt - siNFKBIZ gene drug composition on the NFKBIZ gene silencing effect in HCEC cells;

[0056] Figure 9 Is a Western - blot result graph of the Apt - siNFKBIZ gene drug composition on the inhibition of IκBζ protein expression in HCEC cells;

[0057] Figure 10 Is a fluorescence imaging graph of the Apt - siNFKBIZ - M gene drug composition in mouse ocular surface retention tissue sections;

[0058] Figure 11 Is the in - vivo dry eye treatment result of the Apt - siNFKBIZ - M gene drug composition, where A is a fluorescein sodium staining graph; B is a fluorescein sodium staining score graph; C is a tear secretion volume result graph;

[0059] Figure 12 Is the synthetic route of the PBA - siNFKBIZ gene drug composition;

[0060] Figure 13 Verification results of the cellular uptake ability of the PBA-siNFKBIZ-Cy3 gene drug composition; where A is the confocal laser microscopy image; B is the quantitative graph obtained by flow cytometry;

[0061] Figure 14 Verification of the cellular gene regulation ability of the PBA-siNFKBIZ gene drug composition by qPCR;

[0062] Figure 15 Evaluation results of the in vivo dry eye treatment effect of the PBA-siNFKBIZ-M gene drug combination; where A is the data analysis of the fluorescein sodium scoring of the mouse ocular surface on the 0th, 7th, and 14th days of treatment; B is the results of the phenol red thread tear test in mice on the 0th, 7th, and 14th days of treatment;

[0063] Figure 16 Synthesis route diagram of 2PBA-MAL;

[0064] Figure 17 1H NMR spectrum of compound 3;

[0065] Figure 18 13C NMR spectrum of compound 3;

[0066] Figure 19 1H NMR spectrum of compound 4;

[0067] Figure 20 13C NMR spectrum of compound 4;

[0068] Figure 21 1H NMR spectrum of compound 5;

[0069] Figure 22 13C NMR spectrum of compound 5;

[0070] Figure 23 Synthesis route of the 2PBA-siNFKBIZ-S conjugate;

[0071] Figure 24 Verification of the synthesis of the 2PBA-siNFKBIZ gene drug composition by 20% native polyacrylamide gel;

[0072] Figure 25 Verification results of the cellular uptake ability of the 2PBA-siNFKBIZ-Cy3 gene drug composition; where A is the confocal laser microscopy image; B is the quantitative graph obtained by flow cytometry;

[0073] Figure 26 Verification of the cellular gene regulation ability of the 2PBA-siNFKBIZ drug composition by qPCR:

[0074] Figure 27Evaluation results of the in vivo dry eye treatment effect of the 2PBA-siNFKBIZ-M gene drug combination, where A is the fluorescein sodium staining map of the mouse ocular surface; B is the data analysis of the fluorescein sodium score on the mouse ocular surface on the 0th, 7th, and 14th days of treatment; C is the result of the phenol red cotton thread tear test on the mouse on the 0th, 7th, and 14th days of treatment.

[0075] Figure 28 Synthesis route of 4PBA-NH2

[0076] Figure 29 1H NMR spectrum of compound 7

[0077] Figure 30 13C NMR spectrum of compound 7

[0078] Figure 31 1H NMR spectrum of compound 8

[0079] Figure 32 13C NMR spectrum of compound 8

[0080] Figure 33 1H NMR of compound 11

[0081] Figure 34 13C NMR of compound 11

[0082] Figure 35 Synthesis route of the 4PBA-siNFKBIZ-S conjugate

[0083] Figure 36 Verification of the synthesis of the 4PBA-siNFKBIZ gene drug combination by 20% non-denaturing polyacrylamide gel

[0084] Figure 37 Evaluation of the cellular uptake ability of the 4PBA-siNFKBIZ-FAM gene drug combination; A is the confocal laser microscopy image; B is the flow cytometry quantification graph.

[0085] Figure 38 Results of the cell biology evaluation of the 4PBA-siNFKBIZ gene drug combination. A is the qPCR result graph of the regulation of the NFKBIZ gene by the 4PBA-siNFKBIZ gene drug combination; B is the Western-blot result graph of the regulation of the IκB-ζ protein by the 4PBA-siNFKBIZ gene drug combination.

[0086] Figure 39Evaluation results of the in vivo dry eye treatment effect of the 4PBA-siNFKBIZ-M gene drug combination. Among them, A is the sodium fluorescein staining map of the mouse ocular surface; B is the data analysis of the sodium fluorescein score on the mouse ocular surface on the 0th, 7th, and 14th days of treatment; C is the results of the phenol red cotton thread tear test on the mouse on the 0th, 7th, and 14th days of treatment.

[0087] Figure 40 Synthetic route of 6PBA-N3;

[0088] Figure 41 1H NMR spectrum of compound 13;

[0089] Figure 42 1H NMR spectrum of compound 15;

[0090] Figure 43 13C NMR spectrum of compound 15;

[0091] Figure 44 Synthetic route of 6PBA-siNFKBIZ-S conjugate;

[0092] Figure 45 Verification of the synthesis of 6PBA-siNFKBIZ gene drug combination by 20% native polyacrylamide gel;

[0093] Figure 46 Evaluation results of the cellular uptake ability of 6PBA-siNFKBIZ-FAM gene drug combination. Among them, A is the confocal laser scanning microscopy image; B is the quantitative graph of flow cytometry.

[0094] Figure 47 Cell biological evaluation results of 6PBA-siNFKBIZ gene drug combination. A is the qPCR result graph of the regulation of NFKBIZ gene by 6PBA-siNFKBIZ gene drug combination; B is the Western-blot result graph of the regulation of IκB-ζ protein by 6PBA-siNFKBIZ gene drug combination.

[0095] Figure 48 Evaluation results of the in vivo dry eye treatment effect of the 6PBA-siNFKBIZ-M gene drug combination. Among them, A is the sodium fluorescein staining map of the mouse ocular surface; B is the data analysis of the sodium fluorescein score on the mouse ocular surface on the 0th, 7th, and 14th days of treatment; C is the results of the phenol red cotton thread tear test on the mouse on the 0th, 7th, and 14th days of treatment.

[0096] Figure 49 For PBA 10 -siNKKBIZ-S conjugate synthesis route diagram;

[0097] Figure 50 Verification of PBA by 10% native polyacrylamide gel10 -Synthesis of siNFKBIZ gene drug composition;

[0098] Figure 51 Verification of PBA by flow cytometer 10 -Results of cellular uptake ability of siNFKBIZ-FAM gene drug composition at different times;

[0099] Figure 52 Verification of PBA by qPCR experiment 10 -Gene regulation ability of siNFKBIZ gene drug composition;

[0100] Figure 53 For PBA 10 -Results of in vivo dry eye treatment effect evaluation of siNFKBIZ-M gene drug combination, where A is the sodium fluorescein staining map of mouse ocular surface; B is the data analysis of sodium fluorescein score of mouse ocular surface on the 0th, 7th, and 14th days of treatment; C is the results of mouse phenol red cotton thread tear test on the 0th, 7th, and 14th days of treatment;

[0101] Figure 54 Synthesis route diagram of 2PBA-Br;

[0102] Figure 55 1H NMR spectrum of compound 18;

[0103] Figure 56 13C NMR spectrum of compound 18;

[0104] Figure 57 Synthesis route of PBA6-siNKKBIZ-S conjugate

[0105] Figure 58 Verification of synthesis diagram of PBA6-siNFKBIZ gene drug composition by 20% non-denaturing polyacrylamide;

[0106] Figure 59 Results of evaluation of cellular uptake ability of PBA6-siNFKBIZ-FAM gene drug composition, where A is the confocal image of HCEC cells' uptake of PBA6-siNFKBIZ-FAM gene drug composition; B is the flow cytometry quantification diagram of HCEC cells' uptake of PBA6-siNFKBIZ-FAM gene drug composition;

[0107] Figure 60 Results of cell biology evaluation of PBA6-siNFKBIZ gene drug composition, A is the qPCR result diagram of PBA6-siNFKBIZ gene drug composition's regulation of NFKBIZ gene; B is the Western-blot result diagram of PBA6-siNFKBIZ gene drug composition's regulation of NFKBIZ gene;

[0108] Figure 61 The evaluation results of the in vivo dry eye treatment effect of the PBA6-siNFKBIZ-M gene drug combination, where A is the picture of fluorescein sodium staining of the mouse ocular surface; B is the data analysis result of the fluorescein sodium score of the mouse ocular surface on the 0th, 7th, and 14th days of treatment; C is the phenol red cotton thread tear test result of the mouse on the 0th, 7th, and 14th days of treatment. Specific implementation mode

[0109] The present invention provides a drug combination for inhibiting the expression of the NFKBIZ gene, comprising a nucleic acid molecule for inhibiting the expression of the NFKBIZ gene and a targeting ligand molecule targeting an ocular tissue-specific protein.

[0110] In the present invention, the nucleic acid molecule is a double-stranded nucleic acid molecule designed based on the NFKBIZ gene (GenBank accession number: NM_031419.4) according to the siRNA design principle and having a complementary relationship with at least 15 consecutive nucleotides in the sense strand or the antisense strand of the NFKBIZ gene. In the present invention, the nucleic acid molecule comprises at least one of the following nucleotide sequences: A. The sense strand of the nucleic acid molecule is selected from at least one of the following numbered nucleotide sequences: SEQ ID NO: 1 to SEQ ID NO: 18, SEQ ID NO: 25 to SEQ ID NO: 49, SEQ ID NO: 51 to SEQ ID NO: 89, SEQ ID NO: 93 to SEQ ID NO: 108, SEQ ID NO: 113 to SEQ ID NO: 132, SEQ ID NO: 134 to SEQ ID NO: 135, SEQ ID NO: 138, SEQ ID NO: 143 to SEQ ID NO: 152, SEQ ID NO: 154 to SEQ ID NO: 161, SEQ ID NO: 169 to SEQ ID NO: 185, and SEQ ID NO: 421; the antisense strand of the nucleic acid molecule is selected from at least one of the following numbered nucleotide sequences: SEQ ID NO: 211 to SEQ ID NO: 228, SEQ ID NO: 235 to SEQ ID NO: 259, SEQ ID NO: 261 to SEQ ID NO: 299, SEQ ID NO: 303 to SEQ ID NO: 318, SEQ ID NO: 323 to SEQ ID NO: 342, SEQ ID NO: 348, SEQ ID NO: 344 to SEQ ID NO: 345, SEQ ID NO: 353 to SEQ ID NO: 362, SEQ ID NO: 364 to SEQ ID NO: 371, SEQ ID NO: 379 to SEQ ID NO: 395, and SEQ ID NO: 422; B. Nucleotide sequences that are continuously or discontinuously increased, deleted, or substituted by 2 to 3 bases on the basis of the nucleotide sequences in item A and have the effect of targeting the NFKBIZ gene to play an inhibitory role. Experiments have proved that the nucleic acid molecule protected by the present invention is a double-stranded nucleic acid molecule that can efficiently target the NFKBIZ gene sequence, and has advantages such as being less likely to develop drug resistance and having a long-lasting effect compared with existing small molecule immune drugs. The length of the nucleic acid molecule is preferably 15 to 30 bp.A total of 210 pairs of nucleic acid molecules were designed in the present invention. The inhibitory effect on the NFKBIZ gene was verified by qPCR technology, and the inhibitory effect on the expression of the IκB-ζ protein encoded by the NFKBIZ gene was verified by Western-blot technology. The results showed that the nucleic acid molecules protected by the present invention have the characteristic of high target gene silencing efficiency compared with other nucleic acid molecules designed in the same batch. The nucleic acid molecules can be synthesized by standard methods known in the art, such as by using an automated nucleic acid synthesizer. In a specific embodiment, the species source of the NFKBIZ gene preferably includes human and / or murine sources.

[0111] In the present invention, a hanging single strand is preferably further provided at the end of the sense strand or the antisense strand of the nucleic acid molecule. The length of the hanging single strand is preferably 1 to 3 nt, more preferably 2 nt. The present invention has no special limitation on the nucleotide sequence of the hanging single strand, and the sequences of the hanging single strands well-known in the art can be used. In the embodiments of the present invention, the sequence of the hanging single strand is preferably a sequence formed by oligomerization of U or T, or a sequence complementary to the downstream sequence of the nucleic acid molecule targeting region on the NFKBIZ gene template. The position of the hanging single strand is preferably at one end of the nucleic acid molecule. When the nucleic acid molecule is connected with an extension sequence, the hanging single strand and the extension sequence are preferably connected to different ends of the nucleic acid molecule respectively.

[0112] In the present invention, the nucleic acid molecule comprises any one or more of the following modified nucleotides: deoxynucleotide, 3'-terminal deoxythymidine (dT) nucleotide, 2'-O-methyl modified nucleotide, 2'-fluoro modified nucleotide, 2'-deoxy modified nucleotide, locked nucleic acid, conformationally restricted nucleotide, constrained ethyl nucleotide, abasic nucleotide, 2'-amino modified nucleotide, 2'-O-allyl modified nucleotide, 2'-C-alkyl modified nucleotide, 2'-hydroxy modified nucleotide, 2'-methoxyethyl modified nucleotide, 2'-O-alkyl modified nucleotide, morpholino nucleotide, aminophosphate, nucleotide containing unnatural base, tetrahydropyran modified nucleotide, 1,5-anhydrohexitol modified nucleotide, cyclohexenyl modified nucleotide, nucleotide containing phosphorothioate group, nucleotide containing methylphosphonate group, nucleotide containing 5'-phosphate group and nucleotide containing 5'-phosphate mimic. The modification is beneficial to improving the stability of the nucleic acid molecule.

[0113] In the present invention, the structural schematic diagram of the pharmaceutical composition is shown in Figure 1The targeting ligand molecule targeting the ocular tissue-specific protein preferably includes a nucleic acid aptamer targeting the ocular tissue-specific protein, a compound modified with boric acid or its derivative, or a compound modified with phenylboric acid or its derivative. The ocular tissue-specific protein preferably includes at least one of the following: mucin, integrin, and CD44. The mucin preferably includes at least one of the following: MUC-1, MUC-4, and MUC-16. Ocular surface mucin is a group of high-molecular-weight glycoproteins widely present on the ocular surface, which are divided into two major categories: secreted mucin and membrane-associated mucin, and play an important role in lubricating the ocular surface and maintaining the homeostasis of the ocular surface. Ocular surface mucin is closely related to various ocular surface diseases, including dry eye, infection, allergy, and immune-related diseases, etc. Mucin can bind water to form a gel to prevent tear evaporation; and can interact with various inflammatory factors and play an important role in maintaining the barrier of ocular surface epithelial cells. Mucin is divided into two major categories: secreted mucin and membrane-associated mucin. MUC1, MUC4, and MUC16 are the main membrane-associated mucins in the human eye and can be detected in the cornea, conjunctiva, and lacrimal gland. The expression levels of MUC1 and MUC16 mRNA in the conjunctiva and cornea are the same, but the expression level of MUC4 mRNA is the highest in the conjunctival epithelium and lower in the corneal epithelium. At the same time, corneal epithelial cells have been shown to express integrin and are the source of dry eye inflammatory cytokines; in addition, inflammatory Th17 cells express a large amount of α V β3 integrin, which is crucial for maintaining the Th17 inflammatory phenotype, such as the production of IL-17 and the IL-17-induced disruption of the corneal epithelial barrier in dry eye. In addition, CD44 protein is a transmembrane protein expressed on the surface of corneal epithelial cells, and CD44 protein participates in the migration and adhesion processes of injury repair. Therefore, based on improving the silencing efficiency of nucleic acid molecules targeting mucin, integrin, and CD44 protein, the present invention designs an ocular surface tissue cell-targeted nucleic acid aptamer and a gene drug composition (Apt-siNFKBIZ) that inhibits the NFKBIZ gene. The nucleotide sequence of the nucleic acid aptamer (Apt MUC1 ) targeting mucin MUC-1 is preferably as shown in SEQ ID NO: 423. The nucleotide sequence of the nucleic acid aptamer (Apt MUC16 ) targeting mucin MUC-16 is preferably as shown in SEQ ID NO: 424. The nucleotide sequence of the nucleic acid aptamer targeting integrin α v β3 is as shown in SEQ ID NO: 425. The nucleotide sequence of the nucleic acid aptamer targeting CD44 protein is as shown in SEQ ID NO: 426.

[0114] In the present invention, the aptamer preferably further comprises an aptamer modified with enhanced stability. The enhanced stability modification preferably includes at least one of the following: phosphorothioate backbone modification, 2'-O-methyl modification, 2'-methoxyethyl modification, 2'-fluoro modification, inverted thymidine modification, deoxythymidine nucleotide and polyethylene glycol terminal conjugation.

[0115] In the present invention, the compound modified with boric acid or its derivative or the compound modified with phenylboric acid or its derivative is a linear or branched compound with terminal modified boric acid or phenylboric acid. The number of boric acid or its derivative or phenylboric acid or its derivative modifications on the linear or branched compound is 1 to 40, more preferably 2 to 20, and further preferably 3 to 10. The structural formula of the compound modified with boric acid or its derivative or the compound modified with phenylboric acid or its derivative is shown in any one of Formula 1 to Formula 10:

[0116]

[0117]

[0118] In Formulas 1 to 10, A and G are each independently a group in which one or more methylene groups of absent, -(CH2) h - or -(CH2) h - are replaced by an M group; h is 0 to 15; the M group includes: -O-, -S-, -C(O)-, -C(O)O-, -C(O)NH-, -CH(T C )-, -C(T’)(T”)-, -NH-, -N(TN)-, -S-S-, -C(T’)=C(T")-, -C≡C-, and one or more of;

[0119] In the M group, T C , T N , T’, T” represent that any one or more hydrogen atoms on the specified atom are replaced by L, provided that the normal valence of the specified atom is not exceeded and the substitution generates a stable compound, and the specified atom includes a carbon atom or a nitrogen atom; the L group includes any one of the following: C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, cyano, hydroxy, oxo, carboxy, cycloalkyl, cycloalkenyl, heterocyclic group, heteroaryl, aryl, ketone, alkoxycarbonyl, aryloxycarbonyl, heteroaryloxycarbonyl or halogen; the halogen includes F, Cl, Br or I; (O) in A represents a carbonyl oxygen atom;

[0120] D, E, and H are each independently absent, -O-, -S-, -C(O)-, -NH-, -CH2-, -C(O)NH-, -NHC(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)NH-, -NHC(O)O-, and

[0121]

[0122]

[0123] one or more of; in the D, E, H groups, (O) represents a carbonyl oxygen atom; the represents the connection position of the structural formula where it is located; A, G, D, and H are not all absent at the same time; K represents boric acid or its derivatives or phenylboronic acid and its derivatives; m, n, and t are independently 1 to 15.

[0124] In the present invention, phenylboronic acid and its derivatives or boric acid and its derivatives can reversibly covalently bind to 1,2-dihydroxy compounds or 1,3-dihydroxy compounds, and can effectively recognize substances such as sialic acid and sugars. There are a large number of carbohydrates and glycoproteins and other compounds on the cell membrane surface. Phenylboronic acid can form cyclic borate esters with polyhydroxy compounds such as sugars, so it has a wide range of applications in carbohydrate and cell recognition. The ocular surface epithelial cells have a glycocalyx barrier composed of a large number of highly glycosylated glycoproteins, and its main components are transmembrane mucins MUC1, MUC4, MUC16, and galectin-3, which play lubricating, moistening, and barrier functions on the ocular surface. Therefore, in the present invention, a drug composition is designed and prepared based on the dynamic covalent bond or non-covalent interaction between phenylboronic acid and protein glycosylation, by grafting the end of the siNFKBIZ sense strand, which has good ocular surface retention characteristics. The specific interaction between phenylboronic acid and the MUC protein expressed on the surface of ocular surface cells can effectively promote cell uptake and more efficiently exert biological effects.

[0125] In the present invention, the targeting ligand molecule is preferably directly covalently coupled to the end of the nucleic acid molecule.

[0126] When the targeting ligand molecule is a nucleic acid aptamer, the phosphate group of the nucleic acid aptamer is preferably covalently coupled to the ribose of the nucleic acid molecule. When the targeting ligand molecule is a compound modified with boric acid or its derivatives or a compound modified with phenylboronic acid or its derivatives, the targeting ligand molecule is preferably covalently coupled to the phosphate group or base at the end of the nucleic acid molecule backbone. When the targeting ligand molecule is preferably covalently coupled to the phosphate group at the end of the nucleic acid molecule, the structural formula of the drug composition preferably includes at least one of Formulas 11 to 20;

[0127]

[0128]

[0129] In Formulas 11 to 20, the X group represents -O- or -S-.

[0130] In the present invention, when the targeting ligand molecule is preferably covalently coupled to the base at the end of the nucleic acid molecule, the structural formula of the pharmaceutical composition is preferably at least one of Formulas 21 to 30:

[0131]

[0132]

[0133] In Formulas 21 to 30, Q represents a base, and R represents -H or -OH;

[0134] In Formulas 11 to 30, represents a nucleic acid molecule.

[0135] In the present invention, the targeting ligand molecule is preferably covalently coupled to the nucleic acid molecule through an extension sequence connected to the end of the nucleic acid molecule. The extension sequence preferably includes an extension sequence connected to the end of the nucleic acid molecule at only one end and / or an extension sequence with one end connected to the 3'-end of one strand of the nucleic acid molecule and the other end connected or not connected to the 5'-end of the complementary strand of the nucleic acid molecule to form a stem-loop structure. The length of the extension sequence is preferably 1 to 40 nt; the extension sequence is preferably a random nucleotide sequence, such as an oligonucleotide sequence, TTTTTT, etc.

[0136] In the present invention, when the targeting ligand molecule is preferably a nucleic acid aptamer, the phosphate group of the nucleic acid aptamer is preferably covalently coupled to the ribose of the extension sequence. Figure 2 It is a schematic diagram of a pharmaceutical composition formed by covalently coupling a nucleic acid aptamer to a nucleic acid molecule through an extension sequence. The length of the extension sequence is preferably 1 to 40 nt and can be used to couple the nucleic acid aptamer and boric acid or phenylboric acid or its derivatives. The targeting ligand molecule can also be a pharmaceutical composition formed by coupling to a nucleic acid molecule through an extension sequence with a stem-loop structure. The length of the extension sequence is preferably 10 to 40 nt, where the 5'-end of the extension sequence is connected to one strand of the nucleic acid molecule, and the 3'-end of the extension sequence is connected or not connected to the end of the complementary strand of the nucleic acid molecule to form a stem-loop structure, mainly used to couple boric acid or phenylboric acid or its derivatives. Figure 3 It shows the formation of a 16-base stem-loop structure at the 3'-end of the sense strand of the nucleic acid molecule, and three phosphorothioate (PS) modifications are used at the loop part of the stem-loop structure (3PS-siNFKBIZ-S) to enable it to be coupled to the bromo group modified on bromo-diphenylboric acid (2PBA-Br).

[0137] In the present invention, a method for preparing a pharmaceutical composition obtained by coupling an aptamer with a nucleic acid molecule. Preferably, the aptamer is directly or through an extended sequence connected to one strand of the nucleic acid molecule, assembled with the complementary strand of the nucleic acid molecule through base complementary pairing, and verified using non-denaturing polyacrylamide gel to obtain a gene pharmaceutical composition. The present invention has no special limitation on the method of the connection, and the well-known connection methods in the art can be used, such as nucleic acid solid-phase synthesis.

[0138] In one embodiment of the present invention, aptamers with targeting properties to MUC1, MUC16, integrin α V β3, and CD44 proteins were respectively designed, and a pharmaceutical composition (Apt MUC1 -siNFKBIZ, Apt MUC16 -siNFKBIZ, Apt αvβ3 -siNFKBIZ, and Apt CD44 -siNFKBIZ) formed by connecting to a nucleic acid molecule that inhibits the NFKBIZ gene through an extended sequence was prepared. The pharmaceutical composition is used for highly targeted treatment of dry eye. Mucins are a group of high-molecular-weight glycoproteins that are widely present on the ocular surface and are divided into two major categories: secreted and membrane-associated mucins, which play important roles in lubricating the eye and maintaining ocular homeostasis. Ocular mucins are closely related to various ocular diseases, including dry eye, infection, allergy, and immune-related diseases, etc. Mucins can bind water to form a gel to prevent tear evaporation; and can interact with a variety of inflammatory factors, playing an important role in maintaining the ocular epithelial cell barrier. Corneal epithelial cells have been shown to express integrins and are a source of dry eye inflammatory cytokines; in addition, inflammatory Th17 cells express a large amount of α V β3 integrin, which is crucial for maintaining the Th17 inflammatory phenotype, such as the production of IL-17 and the IL-17-induced disruption of the corneal epithelial barrier in dry eye. CD44 is a transmembrane protein expressed on the surface of corneal epithelial cells and is involved in the migration and adhesion processes of injury repair. Therefore, the present invention utilizes aptamers based on targeting MUC1, MUC16, integrin α V β3, and CD44 to construct a composition of siNFKBIZ gene drugs with targeting functions (AptM UC1 -siNFKBIZ, AptM UC16 -siNFKBIZ, Apt αvβ3 -siNFKBIZ, and Apt CD44-siNFKBIZ), Apt-siNFKBIZ overcomes various barriers on the ocular surface through hydrophilic nucleic acid aptamers. It is delivered through the ocular surface and penetrates the cornea, the largest static barrier on the ocular surface. Through receptor-mediated endocytosis, dsRNA enters the cell, passes through the aqueous layer of the tear film to reach the eye, and is efficiently taken up by corneal epithelial cells, effectively adsorbed and endocytosed in the epithelial tissue of the ocular surface, achieving efficient delivery of the functional nucleic acid molecule siNFKBIZ. After the nucleic acid molecule, the active ingredient of the drug, enters the cell, it can better exert its immunomodulatory and anti-inflammatory effects, inhibit the production and release of pro-inflammatory cytokines, reduce the release of inflammatory factors (interleukin-1, interleukin-17, tumor necrosis factor α) and matrix metalloproteinases, reduce T cell activity, control the immune inflammatory response, regulate the immune balance, effectively improve the dry eye symptoms and signs caused by long-term inflammation, further inhibit the inflammatory response of dry eye, promote dry eye patients to restore their own tear secretion, block the vicious cycle of dry eye inflammation, and inhibit the apoptosis of lacrimal glands and goblet cells, achieving effective treatment of dry eye.

[0139] In the present invention, when the targeting ligand molecule is preferably a compound modified with boric acid or its derivative or a compound modified with phenylboric acid or its derivative, the targeting ligand molecule is covalently coupled to one or more phosphate groups or bases on the extension sequence. When coupled to a phosphate group, the compound modified with boric acid or its derivative or the compound modified with phenylboric acid or its derivative is coupled to the phosphate group through an X group. The X group represents -O- or -S-. When the compound modified with boric acid or its derivative or the compound modified with phenylboric acid or its derivative is a monovalent boric acid or monovalent phenylboric acid (Formula 1), when the targeting ligand molecule is coupled to a phosphate group or a base on the extension sequence, the structural formula is shown in Formulas 31 to 36.

[0140]

[0141] In Formulas 31 to 36, represents a nucleic acid molecule.

[0142] In the present invention, when the targeting ligand molecule is a compound modified with boric acid or its derivative or a compound modified with phenylboric acid or its derivative, the preparation method of the pharmaceutical composition is preferably an conjugate obtained by chemically coupling the compound modified with boric acid or its derivative or the compound modified with phenylboric acid or its derivative to a phosphate group or a base of a nucleic acid molecule or one strand of the extension sequence; annealing and hybridizing the conjugate with the complementary strand of the nucleic acid molecule to obtain a gene pharmaceutical composition.

[0143] In the present invention, after the phosphate group or base of one strand in the nucleic acid molecule or extended sequence is preferably group-modified, it is covalently coupled to a compound modified with boric acid, phenylboric acid or its derivative through a chemical reaction to obtain a conjugate. The modifying groups include amino group (3'-NH2, formula 59), mercapto group (3'SH, formula 60), aldehyde group (5'-CHO, formula 61), dibenzocyclooctyne (3'-DBCO, formula 62), etc.

[0144] In the present invention, the annealing hybridization conditions are preferably that the molar ratio of the conjugate to the complementary strand of the nucleic acid molecule is preferably 1:1. The hybridization annealing temperature is preferably to heat the reaction system in a PCR instrument to 65°C, keep it at a constant temperature for 10 min, and then perform annealing at a rate of cooling by 4°C per minute until it reaches 25°C.

[0145] In one embodiment of the present invention, a drug composition PBA-siNFKBIZ is constructed by covalently coupling a single phenylboronic acid (PBA) molecule with a nucleic acid molecule (siNFKBIZ) of the gene targeting nuclear factor κB inhibitor ζ (NFKBIZ). The specific preparation method preferably includes the following steps:

[0146] Couple 4-carboxyphenylboronic acid and a single-stranded nucleic acid molecule with an amino group modified at the 3' end through an amide chemical reaction to obtain a conjugate;

[0147] Hybridize and anneal the conjugate with the complementary strand of the nucleic acid molecule to obtain the drug composition PBA-siNFKBIZ.

[0148] In the present invention, the single-stranded nucleic acid molecule with an amino group modified at the 3' end can be commissioned to a gene synthesis company to complete. The amide reaction condensing agent is preferably dicyclohexylcarbodiimide (DCC), diisopropylcarbodiimide (DIC), 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI). Preferably EDCI. The activating reagent for the amide reaction is preferably N-hydroxysuccinimide (NHS). The temperature of the amide chemical reaction is preferably 20-55°C, more preferably 25°C. The time of the amide chemical reaction is preferably 12-48 h, more preferably 24 h. The amide chemical reaction is preferably accompanied by shaking, and the shaking speed is preferably 200-4000 rpm, more preferably 1000 rpm. After the amide chemical reaction is completed, it is preferably to remove the excessive 4-carboxyphenylboronic acid and moisture. The removal method of 4-carboxyphenylboronic acid is preferably extraction and removal with ethyl acetate. The method of removing moisture is preferably completed by concentration and distillation. The structural formula of the conjugate is as shown in formula 55.

[0149]

[0150] Among them, represents a linked nucleic acid molecule, and Base represents any type of base.

[0151] In the present invention, the molar ratio of the conjugate to the complementary strand of the nucleic acid molecule is preferably 1:1. The complementary conditions are preferably to heat the reaction system in a PCR instrument to 65°C, keep it at a constant temperature for 10 min, and then anneal at a rate of cooling 4°C per minute until it reaches 25°C.

[0152] In the present invention, the PBA-siNFKBIZ can be used for the treatment of eye diseases. By constructing a PBA-siNFKBIZ covalent conjugate, the present invention can achieve targeted delivery of a nucleic acid drug for inhibiting the NFKBIZ gene to achieve targeted treatment of dry eye. The present invention constructs a PBA-siNFKBIZ drug composition (PBA-siNFKBIZ) based on the dynamic covalent bond between phenylboronic acid and protein glycosyl groups through grafting at the end of the sense strand of siNFKBIZ. It has good ocular surface retention characteristics. The specific interaction between phenylboronic acid and the sugar chain on the MUC glycoprotein overexpressed on the surface of ocular cells can effectively promote cell uptake and more efficiently exert biological effects. In addition, small interfering RNA (siNFKBIZ) targeting the NFKBIZ gene can effectively knockdown the expression of the NFKBIZ gene in corneal epithelial cells, thereby reducing the expression of IκB-ζ protein, reducing the cell inflammation level, and regulating the immune balance. Due to the presence of PBA, the PBA-siNFKBIZ covalent conjugate can enhance its interaction with ocular surface tissue cells. Compared with unmodified oligonucleotides, the PBA-siNFKBIZ conjugate can be better endocytosed by cells, thereby better exerting the gene regulation effect and achieving a good dry eye treatment effect.

[0153] In one embodiment of the present invention, by grafting at the end of the sense strand of siNFKBIZ, a drug composition (2PBA-siNFKBIZ) for inhibiting the expression of the NFKBIZ gene formed by covalently conjugating two PBA molecules with siNFKBIZ is constructed. The specific preparation method preferably includes the following steps:

[0154] Dissolve the compound of structural formula 37 and 4-carboxyphenylboronic acid pinacol ester of structural formula 38, add EDCI and DMAP (4-dimethylaminopyridine), and react under nitrogen protection to obtain the compound of structural formula 39;

[0155] React the compound of structural formula 39, sodium periodate and ammonium acetate under nitrogen protection to obtain the compound of structural formula 40;

[0156] The compound of Structural Formula 40 and 4-maleimidobutyric acid are co-dissolved in methanol, and 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride (DMTMM) and N-methylmorpholine (NMM) are added for reaction to obtain the compound of Structural Formula 41;

[0157] The compound of Structural Formula 41 and a single strand of nucleic acid molecule with a thiol group modified at the 3′ end are subjected to a shaking reaction to obtain a 2PBA-siNFKBIZ-S conjugate;

[0158] The 2PBA-siNFKBIZ-S conjugate and the complementary strand of the nucleic acid molecule are annealed and hybridized to obtain the pharmaceutical composition 2PBA-siNFKBIZ.

[0159] Among them,

[0160]

[0161] In the present invention, the concentration of the compound of Structural Formula 37 is preferably 75.00 mg / mL. The concentration of 4-carboxyphenylboronic acid pinacol ester is preferably 29.00 mg / mL. The concentration of EDCI is preferably 22.50 mg / mL. The concentration of DMAP is preferably 0.75 mg / mL. The reaction temperature is preferably 20-50 °C, more preferably 25 °C. The reaction time is preferably 4-48 h, more preferably 24 h. After the reaction, it is preferably subjected to reduced pressure distillation to remove the solvent and separation and purification. The method of separation and purification is preferably crystallization.

[0162] In the present invention, the working concentration of the compound of Structural Formula 39 is preferably 21.40 mg / mL. The working concentration of sodium periodate is preferably 28.25 mg / mL. The working concentration of ammonium acetate is preferably 10.30 mg / mL. The reaction temperature is preferably 15-50 °C, more preferably 25 °C. The reaction time is preferably 2-24 h, more preferably 10 h. After the reaction, the organic solvent is removed by reduced pressure distillation, and after washing, the water is removed to obtain the compound of Structural Formula 40.

[0163] In the present invention, the working concentration of the compound of Structural Formula 40 is preferably 14.10 mg / mL. The working concentration of 4-maleimidobutyric acid is preferably 12.20 mg / mL. The working concentration of DMTMM is preferably 19.20 mg / mL. The working concentration of NMM is preferably 68 mg / mL. The reaction temperature is preferably 15-50 °C, more preferably 25 °C. The reaction time is preferably 1-10 h, more preferably 2 h. After the reaction, the organic solvent is removed by reduced pressure distillation, and after washing, the water is removed to obtain the compound of Structural Formula 41.

[0164] In the present invention, a single-stranded nucleic acid molecule with a thiol group modified at the 3′ end is entrusted to a gene synthesis company. The temperature of the click chemical reaction is preferably 20-55 °C, more preferably 40 °C. The time of the click chemical reaction is preferably 12-48 h, more preferably 24 h. The click chemical reaction preferably occurs with shaking, and the rotation speed of the shaking is preferably 200-4000 rpm, more preferably 1800 rpm. After the click chemical reaction is completed, it is preferred to remove the excessive compound of Structural Formula 41 and water. The method for removing the compound of Structural Formula 41 is preferably extraction and removal with ethyl acetate. The water is removed by the method of concentration and distillation. The structural formula of the conjugate is as shown in Formula 56.

[0165]

[0166] Among them, represents the linked nucleic acid molecule, and Base represents any type of base.

[0167] In the present invention, the molar ratio of the conjugate to the complementary strand of the nucleic acid molecule is preferably 1:1. The hybridization and annealing conditions are preferably as follows: the reaction system is heated to 65 °C in a PCR instrument, incubated at a constant temperature for 10 min, and then annealed at a rate of 4 °C per minute until it reaches 25 °C.

[0168] In the present invention, 2PBA-siNFKBIZ utilizes the targeting recognition of PBA, and the targeting head of 2PBA further improves the binding ability to the membrane protein on the cell membrane surface, realizes the efficient delivery of siNFKBIZ, and realizes the treatment of dry eye with 2PBA-siNFKBIZ. The present invention uses the small molecule target 2PBA to bind to the small interfering RNA drug for the treatment of dry eye. On the one hand, due to its binding effect with mucin, PBA can improve the retention of nucleic acid drugs on the ocular surface; on the other hand, due to its recognition effect with MUC protein, PBA can solve the cell membrane barrier of the siNFKBIZ gene drug and realize efficient cell delivery; secondly, the present invention utilizes the key role of IκB-ζ in immune regulation to design an siRNA drug, combined with the efficient delivery of PBA, which can effectively inhibit the gene expression of NFKBIZ; furthermore, compared with the PBA-siNFKBIZ covalent conjugate prepared by coupling a single PBA molecule with siRNA targeting the NFKBIZ gene, the 2PBA-siNFKBIZ covalent conjugate formed after coupling two PBA molecules can better bind to mucin and realize the efficient co-delivery of the siNFKBIZ gene drug, thereby achieving a good dry eye treatment effect.

[0169] In one embodiment of the present invention, a pharmaceutical composition (4PBA-siNFKBIZ) for inhibiting the expression of the NFKBIZ gene, formed by covalently coupling PBA tetramer molecules with siNFKBIZ, was constructed by grafting at the end of the sense strand of siNFKBIZ. The specific preparation method is as follows:

[0170] Dissolve the compound with the structural formula as shown in Formula 42 and 4-carboxyphenylboronic acid pinacol ester, add DMTMM and NMM, and react under nitrogen protection to obtain a compound with the structural formula as shown in Formula 43;

[0171] Mix the compound with the structural formula as shown in Formula 43, DIEA, acetic anhydride and DMAP, and react under nitrogen protection to separate the compound with the structural formula as shown in Formula 44;

[0172] Dissolve the compound with the structural formula as shown in Formula 44 and the compound with the structural formula as shown in Formula 37, add EDCI and DMAP, and react under nitrogen protection to obtain a compound with the structural formula as shown in Formula 45;

[0173] Mix the acetone solution of the compound with the structural formula as shown in Formula 45 and an aqueous solution containing sodium periodate and ammonium acetate, and react under nitrogen protection to obtain a compound with the structural formula as shown in Formula 46;

[0174] Add hydrogen chloride-ethyl acetate to the ethyl acetate solution of the compound with the structural formula as shown in Formula 46 and carry out the reaction under nitrogen protection to obtain a compound with the structural formula as shown in Formula 47.

[0175] Perform click chemical reaction on the compound with the structural formula as shown in Formula 47 and a single-stranded nucleic acid molecule with an aldehyde group modified at the 5' end to obtain a 4PBA-siNFKBIZ-S conjugate;

[0176] Anneal and hybridize the 4PBA-siNFKBIZ-S conjugate and the complementary strand of the nucleic acid molecule to obtain the pharmaceutical composition 4PBA-siNFKBIZ;

[0177] Among them,

[0178]

[0179] In the present invention, the working concentration of the compound with the structural formula as shown in Formula 42 is preferably 2.50 mg / mL. The working concentration of the 4-carboxyphenylboronic acid pinacol ester is preferably 20.65 mg / mL. The working concentration of the DMTMM is preferably 23.03 mg / mL. The working concentration of the NMM is preferably 8.43 mg / mL. The reaction temperature is preferably 15-45 °C, more preferably 25 °C. The reaction time is preferably 12-48 h, more preferably 20 h.

[0180] In the present invention, the working concentration of the compound with the structural formula shown in Formula 43 is preferably 17.07 mg / mL. The working concentration of the succinic anhydride is preferably 6.30 mg / mL. The working concentration of the DMAP is preferably 0.33 mg / mL. The reaction conditions are preferably the same as above and will not be elaborated.

[0181] In the present invention, a single-stranded nucleic acid molecule with an aldehyde group modified at the 5′ end is commissioned from a gene synthesis company. The 5′-CHO-siNFKBIZ-S and the compound of structural formula 47 are subjected to an electrophilic substitution reaction to form a Schiff base, and then reduced to obtain a 4PBA-siNFKBIZ-S conjugate. The temperature of the electrophilic substitution reaction is preferably 20-55 °C, more preferably 40 °C. The time of the electrophilic substitution reaction is preferably 12-48 h, more preferably 24 h. The electrophilic substitution reaction is preferably accompanied by shaking, and the rotation speed of the shaking is preferably 200-4000 rpm, more preferably 1800 rpm. After the electrophilic substitution reaction is completed, it is preferred to remove the excessive compound of structural formula 43 and water. The removal method of the compound of structural formula 47 is preferably extraction and removal with ethyl acetate. The water is removed by the method of concentration and distillation. The structural formula of the conjugate is shown in Formula 57:

[0182]

[0183] Among them, represents the connected nucleic acid molecule, and Base represents any type of base.

[0184] In the present invention, the drug composition (4PBA-siNFKBIZ) realizes the application of the siNFKBIZ gene drug in the targeted treatment of dry eye based on the targeting property of PBA. Four phenylboronic acid molecules react with 1,2- and 1,3-diol sugars to form borate esters, which have strong eye adhesion, can be efficiently taken up by cells, and effectively improve the bioavailability of nucleic acid drugs on the ocular surface; in the present invention, 4PBA as the targeting head can effectively target and recognize cells related to the ocular surface tissue, and after siNFKBIZ enters the cell, it can effectively knockdown the expression of the inflammation-related gene NFKBIZ, further regulate the protein expression of IκB-ζ, inhibit the inflammatory reaction of dry eye and contain the vicious cycle of inflammation, so as to achieve better dry eye treatment effect.

[0185] In one embodiment of the present invention, the present invention first synthesized 3-hydroxy azide compound, and reacted with 2PBA polymer through an esterification reaction to obtain a 6PBA azide-modified compound (6PBA-N3); Next, through click chemistry reaction, it was successfully grafted at the end of the siNFKBIZ sense strand, and annealed and complemented with the antisense strand of siNFKBIZ to obtain a PBA hexamer molecule and a drug composition (6PBA-siNFKBIZ) that inhibits the expression of NFKBIZ gene. The preparation method of the drug composition (6PBA-siNFKBIZ) preferably includes the following steps:

[0186] Dissolve the compound shown in Structural Formula 48 and azidohexanoic acid, add DMTMM and NMM, and react under nitrogen protection to obtain the compound shown in Structural Formula 49;

[0187] Dissolve the compound shown in Structural Formula 49 and the compound shown in Structural Formula 44, add EDCI and DMAP, and react under nitrogen protection to obtain the compound shown in Structural Formula 50;

[0188] Fuse the compound shown in Structural Formula 50 with acetone and mix with an aqueous solution of sodium periodate and ammonium carbonate, and react under nitrogen protection to obtain the compound shown in Structural Formula 51;

[0189] Vibrate and react the compound shown in Structural Formula 51 with a strand of dibenzocyclooctyne-modified nucleic acid molecule at the 3′ end to obtain a 6PBA-siNFKBIZ-S conjugate;

[0190] Anneal and hybridize the 6PBA-siNFKBIZ-S conjugate with the complementary strand of the nucleic acid molecule to obtain the drug composition 6PBA-siNFKBIZ;

[0191] Wherein,

[0192]

[0193] In the present invention, the working concentration of the compound shown in Structural Formula 48 is preferably 10.00 mg / mL. The working concentration of the azidohexanoic acid is preferably 23.35 mg / mL. The working concentration of the DMTMM is preferably 34.40 mg / mL. The working concentration of the NMM is preferably 12.40 mg / mL. The reaction conditions are the same as above and will not be elaborated here. After the reaction, it is preferably to remove the solvent and separate and purify. The method for removing the solvent is preferably vacuum distillation. The method for separation and purification is preferably silica gel column chromatography separation and purification. When separating and purifying, the eluent is preferably an ethyl acetate-methanol solution. The volume ratio of ethyl acetate to methanol in the ethyl acetate-methanol solution is preferably 30∶1.

[0194] In the present invention, the working concentration of the compound shown in Formula 49 is preferably 3.56 mg / mL. The working concentration of the compound with the structural formula as shown in Formula 44 is preferably 35.60 mg / mL. The working concentration of the EDCI is preferably 8.49 mg / mL. The working concentration of the DMAP is preferably 1.00 mg / mL. The conditions of the reaction are the same as above and will not be elaborated here.

[0195] In the present invention, the compound shown in Formula 51 to the pharmaceutical composition 6PBA-siNFKBIZ is a click chemical reaction. A single-stranded nucleic acid molecule with dibenzocyclooctyne modified at the 3′-end is commissioned from a gene synthesis company. The temperature of the click chemical reaction is preferably 25-60 °C, more preferably 50 °C. The time of the click chemical reaction is preferably 12-48 h, more preferably 24 h. The click chemical reaction preferably occurs with shaking, and the rotation speed of the shaking is preferably 200-4000 rpm, more preferably 1800 rpm. After the click chemical reaction is completed, it is preferred to remove the excessive compound shown in Formula 51 and water. The removal method is preferably extraction with ethyl acetate. The water is removed by the method of concentration and distillation. The structural formula of the conjugate is as shown in Formula 58.

[0196]

[0197] Among them, represents the connected nucleic acid molecule, and Base represents any type of base.

[0198] In the present invention, the pharmaceutical composition 6PBA-siNFKBIZ has more PBA molecules, so that it can more likely increase the reaction with the glycans on the cell membrane surface, enhance the adhesion to cells, and enter the cells through receptor-mediated endocytosis, significantly improving the uptake efficiency of siNFKBIZ by cells. Further, it exerts the silencing effect of the NFKBIZ gene in cells, down-regulates the expression of the NFKBIZ gene, realizes the down-regulation of IκB-ζ, inhibits cell inflammation, and thus plays a therapeutic role in dry eye.

[0199] In an embodiment of the present invention, the present invention constructs a DNA strand (polymerized from 12 T nucleotides) with 10 phenylboronic acid molecules grafted and modified at the 3′-end extended sequence of the sense strand of the nucleic acid molecule targeting the NFKBIZ gene through phosphorothioate, and prepares a pharmaceutical composition (PBA 10 -siNFKBIZ) for inhibiting the expression of the NFKBIZ gene. The preparation method preferably includes the following steps:

[0200] Synthesize a sense strand of an artificial nucleic acid molecule with an extended sequence; 10 phosphorothioate backbone modifications (10PS-siNFKBIZ-S) are modified on the phosphate backbone of the extended sequence;

[0201] React the 10PS-siNFKBIZ with a 4-bromomethyl-phenylboronic acid solution to obtain a PBA 10 -siNFKBIZ-S conjugate;

[0202] Anneal and hybridize the PBA 10 -siNFKBIZ-S conjugate and the complementary strand of the nucleic acid molecule to obtain the drug composition PBA 10 -siNFKBIZ.

[0203] In the present invention, the working concentration of 4-bromomethyl-phenylboronic acid is preferably 60 mM. The working concentration of the 10PS-siNFKBIZ is preferably 200 μM. The volume ratio of the 10PS-siNFKBIZ to the 4-bromomethyl-phenylboronic acid solution is 1:1. Based on the target recognition effect of PBA in the drug composition (PBA 10 -siNFKBIZ), explore its effect in the treatment of dry eye. In this example, 12 T bases are extended at the 3′ end of the sense strand of the siNFKBIZ drug, and phosphorothioate modification is used between the last 10 bases, and it is synthesized using a nucleic acid synthesizer. After PBA is grafted through phosphorothioate, it anneals and complements with the antisense strand of siNFKBIZ to obtain PBA 10 -siNFKBIZ. There are 10 PBA molecules in this composition, which can better bind to the ocular surface MUC protein, improve the interaction efficiency with the ocular surface protein, further increase the retention on the ocular surface, improve the intracellular delivery of siNFKBIZ, improve the biological effect of siNFKBIZ, and achieve effective treatment of dry eye.

[0204] In an embodiment of the present invention, a siNFKBIZ drug composition with a stem-loop structure is constructed, 3 phosphorothioate modifications are performed at the stem-loop structure, and a 2PBA branch is grafted onto the stem-loop structure to prepare a siNFKBIZ drug composition (PBA6-siNFKBIZ) with 6 phenylboronic acid molecules. The preparation method preferably includes the following steps:

[0205] Esterify the compound with the structural formula shown in Formula 44 and the compound with the structural formula shown in Formula 52 under the condensation of EDCI and DMAP to obtain a compound with the structural formula shown in Formula 53:

[0206] The acetone solution of the compound with the structural formula shown in Formula 53 is mixed with an aqueous solution containing sodium periodate and ammonium carbonate, and reacted under nitrogen protection to obtain a compound (2PBA-Br) with the structural formula shown in Formula 54;

[0207] The solution of the compound with the structural formula shown in Formula 54 is reacted with one strand of a nucleic acid molecule with three phosphorothioate modifications in the stem-loop structure part to obtain a PBA6-siNFKBIZ-S conjugate;

[0208] The PBA6-siNFKBIZ-S conjugate is annealed and hybridized with the complementary strand of the nucleic acid molecule to obtain a pharmaceutical composition PBA6-siNFKBIZ;

[0209] Among them,

[0210] In the present invention, the targeting uptake effect of the pharmaceutical composition PBA6-siNFKBIZ in human corneal epithelial cells, and its ability to regulate the NFKBIZ gene and the IκB-ζ protein. The results show that PBA6-siNFKBIZ can significantly promote the cellular uptake of the siNFKBIZ gene drug and can inhibit the expression of the NFKBIZ gene. Further, through an animal dry eye model, it is verified that the pharmaceutical composition PBA6-siNFKBIZ has a good adhesion effect on the ocular surface, can improve the bioavailability of the siNFKBIZ gene drug on the ocular surface, effectively inhibits the expression of the NFKBIZ gene, curbs the vicious cycle of inflammation on the ocular surface, and achieves the purpose of dry eye treatment.

[0211] The present invention provides the use of the nucleic acid molecule or the pharmaceutical composition in the preparation of a drug for preventing and / or treating ocular diseases.

[0212] In the present invention, the ocular diseases preferably include one or more of the following: dry eye, keratitis, conjunctivitis, and blepharitis.

[0213] The following examples are used to illustrate in detail a pharmaceutical composition and its application for inhibiting the expression of the NFKBIZ gene provided by the present invention, but they should not be construed as limiting the protection scope of the present invention.

[0214] Example 1

[0215] Screening of double-stranded ribonucleic acid for inhibiting the expression of the NFKBIZ gene

[0216] 1. Using the NFKBIZ gene (GenBan accession number: NM_031419.4) as the target gene, a total of 210 pairs of double-stranded ribonucleic acids were designed through conventional siRNA design (see Table 1). To preliminarily screen and verify the effectiveness of siRNA, we used commercial Lipofectamine 2000 to transfect human corneal epithelial cells, and verified the expression of the NFKBIZ gene and the IκB-ζ protein through qPCR and Western-blot experiments.

[0217] Table 1 siRNA sequences targeting the NFKBIZ gene

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224] 2. Screening double-stranded ribonucleic acids that inhibit the expression of the NFKBIZ gene based on qPCR technology

[0225] Human corneal epithelial cells (HCEC) were seeded in 6-well plates at a density of 3.5×10 4 cells / well and cultured overnight before transfection. According to the manufacturer's method, Lipofectamine 2000 (Invitrogen GmbH, Karlsruhe, Germany) was incubated with siRNA using OptiMEM medium, then added to the 6-well plates, and a Lipofectamine 2000 blank control group was set. At 6 h after transfection, the Opti-MEM medium was replaced with complete medium. At 48 h after changing the medium, a Biyuntian RNA extraction kit was used, and RNA reverse transcription was performed using a TAKARA reverse transcription kit (Code No. RR036A). The reverse transcription reaction solution was prepared according to the following composition (the reaction solution preparation was carried out on ice).

[0226] Table 2 Reverse transcription system

[0227]

[0228] The specific reaction process is as follows: First, perform at 37°C for 15 min (reverse transcription reaction). Next, perform at 85°C for 5 s (inactivation reaction of reverse transcriptase), cool down to 4°C, and finally take out the sample and store it at -20°C. Perform qPCR reaction according to the real-time quantitative PCR kit of TAKARA (Code No. RR820A), using GAPDH as the internal reference gene. Forward primer for GAPDH: AGAAGGCTGGGGCTCATTTG (SEQ ID NO: 427); Reverse primer for GAPDH: AGGGGCCATCCACAGTCTTC (SEQ ID NO: 428).

[0229] Forward primer for NKFBIZ: ACACCCACAAACCAACTCTGG (SEQ ID NO: 429);

[0230] Reverse primer for NFKBIZ: GGCAAAACTGTGATTCTGGACC (SEQ ID NO: 430). Prepare the PCR reaction solution according to the following components (the preparation of the reaction solution is carried out on ice).

[0231] Table 3 qPCR reaction system

[0232]

[0233] The specific reaction process is as follows: The first stage: pre-denaturation; Number of cycles: 1; 95°C for 30 s; The second stage: PCR reaction, Number of cycles: 40; 95°C for 3 s; 60°C for 30 s; Melting curve stage.

[0234] The results are as Figure 4 shown, where the Mock group is the normal NFKBIZ mRNA expression level of cells without siRNA treatment. Taking this as the normalization benchmark, select the siRNA sequence that can significantly inhibit the expression of the NFKBIZ gene compared with the Mock group (the mRNA expression level is lower than or equal to Figure 4 the sequence of the dotted line in) as the preferred sequence; Through significant difference quantitative analysis, ID1-18, ID25-49, ID51-89, ID93-108, ID113-132, ID134-135, ID143-152, ID169-185 can significantly inhibit the expression of NFKBIZ gene mRNA.

[0235] 3. Verify the biological effect of double-stranded ribonucleic acid that inhibits the expression of NFKBIZ gene based on Western-blot technology

[0236] To better verify the effect of siRNA in inhibiting the NFKBIZ gene, 7 siRNAs were selected to detect the expression of IκB-ζ protein. Human corneal epithelial cells (HCECs) were seeded in 6-well plates at a density of 3.5×10 4 cells / well and cultured overnight before transfection. According to the manufacturer's method, Lipofectamine 2000 was incubated with siRNA using Opti-MEM medium, then added to the 6-well plates, and a Lipofectamine 2000 blank control group was set. At 6 h after transfection, the OptiMEM medium was replaced with complete medium. At 48 h after medium replacement, proteins were extracted for detection, and the results are as Figure 5 shown. The results showed that the screened siRNA ID1, siRNA ID30, siRNA ID70, siRNA ID101, siRNA ID120, and siRNA ID180 could all inhibit the expression of IκB-ζ at the protein level, which was consistent with the qPCR results. They could not only inhibit the expression of the NFKBIZ gene at the gene level but also inhibit the expression of IκB-ζ protein, thereby exerting an anti-inflammatory effect.

[0237] Example 2

[0238] Nucleic acid aptamer-targeted delivery of siNFKBIZ gene drug composition for the treatment of dry eye

[0239] Nucleic acid aptamers are short single-stranded DNA or RNA molecules that can selectively bind to specific targets, including proteins, peptides, carbohydrates, small molecules, toxins, etc. Compared with other targeting ligands (such as antibodies), aptamers have been shown to have lower toxicity and immunogenicity. In addition, due to the advantages of easy synthesis, chemical modification, and conjugation of nucleic acid aptamers, nucleic acid aptamers have broad application prospects in the field of small nucleotide delivery. Mucin is a key factor in the quality and stability of the tear film. On the ocular surface, mucin is secreted by conjunctival goblet cells and lacrimal glands, and among them, MUC1, MUC4, and MUC16 are the main transmembrane mucins highly expressed at the ocular surface site. Corneal epithelial cells have been shown to express integrins and are a source of dry eye inflammatory cytokines; in addition, inflammatory Th17 cells express a large amount of α V β3 integrin, which is crucial for maintaining the Th17 inflammatory phenotype, such as the production of IL-17 in dry eye and IL-17-induced disruption of the corneal epithelial barrier. To achieve efficient delivery of siRNA, in this example, a drug composition for delivering the siNFKBIZ gene was developed based on nucleic acid aptamers targeting MUC1, MUC16, integrin α V β3, and CD44 proteins for the treatment of dry eye, an ocular surface disease.

[0240] 1. Assembly of Nucleic Acid Aptamer-Targeted Delivery of siNFKBIZ Gene Drug Composition

[0241] First, in this example, two nucleic acid aptamers targeting MUC protein were selected, namely the nucleic acid aptamer targeting MUC1 protein (Apt MUC1 nucleic acid aptamer) and the nucleic acid aptamer targeting MUC16 protein (Apt MUC16 ), as well as the nucleic acid aptamer targeting integrin α V β3 (Apt αvβ3 nucleic acid aptamer) and the nucleic acid aptamer targeting CD44 protein (Apt CD44 nucleic acid aptamer). The nucleic acid aptamer was linked to the sense strand of siRNA (siNFKBIZ sense, SEQ ID NO: 1) inhibiting the NFKBIZ gene through a deoxyribonucleic acid linker TTTTT and assembled with the antisense strand of siRNA (siNFKBIZ antisense, SEQ ID NO: 211) through base complementary pairing. Verification was carried out by non-denaturing polyacrylamide gel, and the results are as Figure 6 shown. It can be seen that Apt-siNFKBIZ sense and siNFKBIZ antisense were successfully complementary.

[0242] The siNFKBIZ gene drug sequences used in this example are as follows:

[0243] Among them, the sequence of small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0244] Sense: 5′-GAGCCGGUGGCGCAGGUGU-3′ (SEQ ID NO: 1);

[0245] Antisense: 5′-ACACCUGCGCCACCGGCUCgc-3′ (SEQ ID NO: 431).

[0246] Among them, the sequence of small interfering RNA (siNFKBIZ-M) targeting the mouse NFKBIZ gene is

[0247] Sense: 5′-GCGUCAAUGUACCAGUAUU-3′ (SEQ ID NO: 421):

[0248] Antisense: 5′-AAUACUGGUACAUUGACGCCU-3′ (SEQ ID NO: 422).

[0249] The sequences of the nucleic acid aptamers are as follows:

[0250] MUC1 nucleic acid aptamer: GCAGTTGATCCTTTGGATACCCTGG (SEQ ID NO: 423);

[0251] MUC16 nucleic acid aptamer: CTCACTATAGGGAGACAAGAATAAACGCTCAA (SEQ ID NO: 424);

[0252] α V β3 nucleic acid aptamer: GGGAGACAAGAATAAACGCTCAATTCAACGCT

[0253] GTGAAGGGCTTATACGAGCGGATTACCCTTCGACAGGAGGCTCACAAAAGGC (SEQ ID NO: 425);

[0254] CD44 nucleic acid aptamer: ACCGGGCGTACACCGTCGCGGCACATGTCTGA (SEQ ID NO: 426).

[0255] 2. Verification of the cellular uptake efficiency of the siNFKBIZ gene drug composition with aptamer targeting function

[0256] To verify the uptake efficiency of the Apt MUC1 -siNFKBIZ gene drug composition at the cellular level, a laser confocal microscope was used for verification. The specific method is as follows: Human corneal epithelial cells (HCEC) were seeded in confocal dishes at a density of 2×10 4 cells / well and cultured overnight before administration. Apt MUC1 -siNFKBIZ (Apt MUC1 -siNFKBIZ-Cy3) gene drug composition labeled with Cy3 and siNFKBIZ labeled with Cy3 (siNFKBIZ-Cy3) were respectively prepared using Opti-MEM medium, with an equivalent Cy3 concentration of 0.5 μM, and incubated with HCEC cells. After 6 h, they were washed with PBS and fixed with 4% paraformaldehyde; next, they were stained with DAPI, and finally observed using a laser confocal microscope. The results are as shown in Figure 7 Figure A. The results showed that the fluorescence intensity of the cells in the Apt MUC1 -siNFKBIZ drug composition incubation group was significantly higher than that in the free siNFKBIZ group, indicating that the aptamer targeting MUC1 could significantly improve the uptake efficiency of siNFKBIZ and play a gene silencing role.

[0257] Next, flow cytometry was used to analyze Apt MUC16, Apt αvβ3 , Apt CD44 The targeting uptake efficiency of the siNFKBIZ pharmaceutical composition with Apt was verified at the cellular level. The specific method is as follows: HCEC cells were seeded in a 12-well plate at a density of 3.0×10 5 cells per well and cultured overnight in DMEM. Cy3-labeled siNFKBIZ (siNFKBIZ-Cy3) and the Apt MUC16 , Apt αvβ3 , Apt CD44 -related aptamer pharmaceutical compositions were added to wells with the same Cy3 concentration (0.5 μM), incubated at 37 °C for 6 h in Opti-MEM, and finally the cells were collected using trypsin for flow cytometry analysis (BD FACSCalibur, USA). The results are shown as B in Figure 7 . Apt MUC16 , Apt αvβ3 , Apt CD44 could all significantly improve the cellular uptake efficiency of siRNA, thereby enabling efficient delivery of siRNA into cells and exerting the gene silencing effect.

[0258] 3. Biological verification of the siNFKBIZ gene pharmaceutical composition with aptamer targeting function

[0259] To verify the biological effect of aptamer-targeted delivery of siNFKBIZ, the expression of the NFKBIZ gene and the IκB-ζ protein was verified by qPCR and Western-blot experiments. HCEC cells were seeded in a 6-well plate at a density of 1×10 5 cells per well, adhered overnight, and then stimulated with 100 ng / mL LPS for 12 h. After removing the supernatant, 1 mL of Opti-MEM medium containing siNFKBIZ and the Apt MUC-1 -siNFKBIZ, Apt MUC16 -siNFKBIZ, Apt αvβ3 -siNFKBIZ, Apt CD44 -siNFKBIZ pharmaceutical compositions (the equivalent concentration of siNFKBIZ was 500 nM) was added, and after co-incubation at 37 °C for 6 h, the medium was changed to DMEM medium, and the cells were collected and RNA was extracted for qPCR experiments to evaluate the expression of NFKBIZ mRNA in HCEC cells and proteins were extracted for Western-blot experiments. The results of the qPCR experiment are shown in Figure 8 . LPS stimulation increased the expression of the NFKBIZ gene in HCEC cells by approximately 1.4-fold; the simple siNFKBIZ gene pharmaceutical could downregulate the NFKBIZ gene to about 1.2, and AptMUC1 -siNFKBIZ, Apt MUC16 -siNFKBIZ, Apt αvβ3 -siNFKBIZ, Apt CD44 -All siNFKBIZ drugs were able to significantly inhibit the expression of NFKBIZ, achieving a gene inhibition effect of 40% - 50%. The results of Western-blot are as Figure 9 shown. It can be seen from the results that Apt MUC-1 -siNFKBIZ, Apt MUC16 -siNFKBIZ, Apt αvβ3 -siNFKBIZ, Apt CD44 -The siNFKBIZ drug composition has a better inhibitory effect on the expression of IκB-ζ protein compared to the stimulation group. In summary, the aptamer-based siNFKBIZ gene drug composition can efficiently deliver the siNFKBIZ nucleic acid drug, achieve the down-regulation of the NFKBIZ gene, further inhibit the expression of IκB-ζ protein, and inhibit the inflammatory response.

[0260] 4. Evaluation of the Ocular Surface Retention Effect of the Apt-siNFKBIZ-M Gene Drug Composition

[0261] The retention effect of the drug composition that inhibits the expression of the NFKBIZ gene on the ocular surface was verified through animal experiments. All animal experiments in this example complied with the statement of the Association for Research in Vision and Ophthalmology. All animal experiments were conducted in accordance with the guidelines established by the Ethics Committee of Shanghai Jiao Tong University. Thirty 6 - 8-week-old specific pathogen-free (SPF) C57BL / 6 mice (60 eyes) were selected and housed in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 6 groups, and benzalkonium chloride was instilled 2 times a day to establish a dry eye model in mice. After intraperitoneal anesthesia of C57BL / 6 mice, 5 μL of: Apt MUC1 -siNFKBIZ-Cy5.5, Apt MUC16 -siNFKBIZ-Cy5.5, Apt αvβ3 -siNFKBIZ-Cy5.5, Apt CD44 -siNFKBIZ-Cy5.5 gene drug composition and free siRNA-Cy5.5 eye drops were instilled into the right eyes. After 30 min, the mice were anesthetized and the corneas were removed for frozen section imaging. The results are as Figure 10 , compared with the siNFKBIZ-Cy5.5 administration group, the fluorescence on the ocular surface of the composition expressing the Apt-siNFKBIZ gene provided by the present invention is stronger, indicating better ocular surface retention and adhesion ability in vivo, reducing drug loss and improving bioavailability, suggesting that the Apt-siNFKBIZ gene drug composition is indeed a promising drug for local application.

[0262] 5. Therapeutic Effect of Apt-siNFKBIZ Gene Drug Composition on Dry Eye

[0263] All animal experiments in this example were conducted in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO)'s "Statement on the Use of Animals in Ophthalmic and Vision Research" and complied with relevant operating specifications. All animal experiments were carried out in accordance with the guidelines established by the Ethics Committee of Shanghai Jiao Tong University. In this example, 40 C57BL / 6 mice (80 eyes) aged 6 - 8 weeks of specific pathogen-free (SPF) level were selected from Shanghai Slack Experimental Animal Co., Ltd. and raised in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 8 groups and exposed to a low-humidity environment (RH = 18.5% ± 5.1%, AF = 15 L / min, T = 21 - 23 °C) for 4 days to adapt. Then, 5 μL of 0.2% benzalkonium chloride was instilled into each eye twice a day for 14 consecutive days to establish a dry eye model in mice. Each group of mice received local instillation of PBS, cyclosporine CsA eye drops (Xingqi Eye Medicine), siNFKBIZ-M, Apt MUC1 -siNFKBIZ-M, Apt MUC16 -siNFKBIZ-M, Apt αvβ3 -siNFKBIZ-M, Apt CD44 -siNFKBIZ-M drug composition (equivalent siRNA dose of 0.05 mg / kg) twice a day for 14 consecutive days (once in the morning and once in the evening), and tear secretion was detected and corneal fluorescein sodium staining was evaluated on days 0, 7, and 14 of administration. The specific operations were as follows: Basic tear secretion test (Schirmer’s I Test): On days 0, 7, and 14 of administration, a basic tear secretion test was performed using Zone-Quick phenol red cotton thread. After anesthetizing the mice intraperitoneally with 1.25% alfutin (0.2 mL / 10 g), the 1-mm phenol red cotton tip was inserted into the lateral fornix of the conjunctiva of the mice for 30 s. The change in the color of the phenol cotton from yellow to red indicates secreted tears, and the wet length (mm) was read and recorded. Corneal fluorescein sodium staining score: 2 μL of 0.5% fluorescein sodium (w / v) was instilled onto the ocular surface, and then the eyelids were manually closed 3 - 4 times to gently remove the excess fluorescein sodium. Fluorescein staining images were taken under cobalt blue light irradiation with a slit lamp, and corresponding scores were given by the same experienced ophthalmologist. The cornea was divided into 5 quadrants, with each quadrant graded from 0 to 3: Grade 0, absent: 1) less than 30 punctate stains; 2) more than 30 punctate stains but not diffuse; 3) severe diffuse staining or plaque positive. The sum of all quadrants was used as the final score. All affected eyes in each group were examined and analyzed.

[0264] The experimental results are as Figure 11As shown, the drug administration groups (CsA eye drops, siNFKBIZ-M, Apt MUC1 -siNFKBIZ-M, Apt MUC16 -siNFKBIZ-M, Apt αvβ3 -siNFKBIZ-M, Apt CD44 -siNFKBIZ-M drug compositions) were all able to effectively improve the degree of corneal injury. Among them, after one week of treatment, the eye score of the mice in the cyclosporine eye drop group decreased from 12 points to about 8 points, and the phenol red thread tear test result increased from 3 mm to about 3.8 mm; the eye score of the mice in the siNFKBIZ-M drug administration group decreased from 12 points to about 10 points, and the phenol red thread tear test result increased from 3 mm to about 3.5 mm; the sodium fluorescein scores of the eyes of the mice in the Apt-siNFKBIZ-M drug administration group all decreased significantly, from about 12 points to 6 points, indicating that Apt-siNFKBIZ-M can significantly improve corneal injury; the phenol red thread tear test result increased from about 3 mm to about 5 mm, indicating that Apt-siNFKBIZ-M can significantly promote tear secretion. From the above experimental results, it can be seen that the aptamer can effectively promote the entry of the siNFKBIZ gene drug into cells and exert the biological function of siNFKBIZ, achieving effective treatment of dry eye.

[0265] Example 3

[0266] Monophenylboronic acid-targeted delivery of nucleic acid molecules

[0267] 1. Synthesis and characterization of PBA-siNFKBIZ gene drug composition

[0268] 1.1 Synthesis of 4-carboxyphenylboronic acid (PBA-COOH) and NFKBIZ small interfering RNA composition (PBA-siNFKBIZ)

[0269] In this example, the small interfering RNA targeting the NFKBIZ gene used was purchased from Suzhou Beixin Biotechnology Co., Ltd., and an amino group (-NH2) modification was introduced at the 3′ end of the small interfering RNA to enable it to be efficiently coupled with the carboxyl group on PBA-COOH through an amide chemical reaction. The 3′-end amino group modification is represented by 3′-NH2 in all the following examples, and its modification structure is as shown in Formula 59:

[0270]

[0271] Among them, represents the linked nucleic acid molecule, and Base represents any type of base.

[0272] The siNFKBIZ gene drug sequence used in this example is as follows:

[0273] The sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0274] Sense: 5′-AGAACAUUAUCAACAUUAA-3′ (SEQ ID NO: 43);

[0275] Antisense: 5′-UUAAUGUUGAUAAUGUUCUga-3′ (SEQ ID NO: 432);

[0276] The sequence of the small interfering RNA (siNFKBIZ-M) targeting the mouse NFKBIZ gene is

[0277] Sense: 5′-GCGUCAAUGUACCAGUAUU-3′ (SEQ ID NO: 421);

[0278] Antisense: 5′-AAUACUGGUACAUUGACGCCU-3′ (SEQ ID NO: 422);

[0279] The synthetic route of PBA-siNFKBIZ is as Figure 12 shown:

[0280] The specific synthesis method is as follows: Dissolve 0.22 mg of PBA-COOH (1300 nmol), 0.40 mg of EDCI (2600 nmol), and 0.30 mg of NHS (2600 nmol) in 1.3 mL of DMSO. Take 0.13 mL and add 5 OD (26 nmol) of the 3′-terminal amino-modified siNFKBIZ sense strand (siNFKBIZ-S-3′-NH2), then place it in a shaker at 25 °C for 24 h. After adding 5 mL of water, extract with dichloromethane to remove EDCI / NHS and excess PBA-COOH in the reaction, and then concentrate and evaporate the aqueous solution to dryness to obtain the PBA-siNFKBIZ-S conjugate molecule. Then, under the condition of a molar ratio of 1:1 between PBA-siNFKBIZ-S and the antisense strand of siNFKBIZ (siNFKBIZ-A), keep it at 65 °C for 10 minutes and then anneal to 25 °C for 10 minutes to obtain the drug composition of PBA-siNFKBIZ.

[0281] 2. Verification of the cellular uptake ability of the PBA-siNFKBIZ gene drug composition

[0282] Seed HCEC cells at 4×10 per well 4The number of cells was seeded in a 24-well culture plate, and a clean coverslip was placed in each well. After overnight culture, they were then cultured with PBA-siNFKBIZ-Cy3 and siNFKBIZ-Cy3 (equivalent Cy3 concentration of 0.5 μM) for 6 h. Subsequently, the culture medium was removed, and the cells were washed 3 times with PBS and fixed with 4% paraformaldehyde at room temperature for 15 min. Then, the cell nuclei were stained with DAPI for 15 min, washed with PBS, and observed using a laser confocal microscope. The results are shown in Figure 13 As shown in A in , the green fluorescence of the cells in the PBA-siNFKBIZ-Cy3 group was higher than that in the siNFKBIZ-Cy3 administration group.

[0283] To seed HCEC cells at a density of 4.0×10 5 per well in a 12-well plate and culture them overnight in DMEM. PBA-siNFKBIZ-Cy3 was added to the cells at a concentration of 0.5 μM per well of Cy3, and they were incubated in Opti-MEM at 37 °C for 6 h. siNFKBIZ-Cy3 was used as a control. The cells were collected using trypsin and collected for flow cytometry analysis. The results are shown in Figure 13 As shown in B in , the mean fluorescence intensity of the PBA-siNFKBIZ-Cy3 group was approximately 1.2 times that of the siNFKBIZ group. In summary, the above results indicate that the modification of PBA can enhance the uptake ability of the siNFKBIZ small nucleic acid drug and improve its cellular uptake effect.

[0284] 3. Evaluation of the gene regulation ability of the PBA-siNFKBIZ gene drug composition

[0285] According to the standard of 1×10 5 cells / well, HCEC cells were seeded in a 6-well plate and cultured overnight. Then, after stimulation with IL-1β for 12 h, they were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing siNFKBIZ and the PBA-siNFKBIZ gene drug composition for 6 h, and then the complete DMEM medium was replaced and the cells were cultured for another 48 h. Next, the cells were lysed using RNAiso reagent to extract mRNA, and the concentration of mRNA was measured by Nanodrop. cDNA was obtained according to the reverse transcription kit, and further qPCR experiments were performed. The results are shown in Figure 14As shown, after IL-1β stimulation, the expression of the NFKBIZ gene in HCEC cells was significantly upregulated to about 1.6 times that of normal cells, and the free siNFKBIZ gene drug could be downregulated to about 1.4 times. However, the PBA-siNFKBIZ gene drug composition could inhibit the expression of the NFKBIZ gene, and the expression level decreased to about 1.26 of the normal unstimulated group (Mock group) after inhibition. The above results indicate that the PBA-siNFKBIZ gene drug composition can promote the entry of the siNFKBIZ gene drug into cells to a certain extent, achieve the regulatory effect on the NFKBIZ gene, and achieve the gene inhibition effect.

[0286] 4. Dry eye treatment effect of PBA-siNFKBIZ gene drug composition

[0287] All animal experiments in this example were conducted in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO) "Statement on the Use of Animals in Ophthalmic and Vision Research" and complied with relevant operating specifications. All animal experiments were carried out in accordance with the guidelines formulated by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6-8-week-old specific pathogen-free (SPF) grade C57BL / 6 mice (30 eyes) were selected from Shanghai Slack Experimental Animal Co., Ltd. and raised in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 3 groups and exposed to a low humidity environment (RH = 18.5% ± 5.1%, AF = 15 L / min, T = 21 - 23 °C) for 4 days to adapt. Then, 5 μL of 0.2% benzalkonium chloride was instilled into each eye twice a day for 14 consecutive days to establish a mouse dry eye model. Each group of mice was locally instilled with PBS, cyclosporine CsA eye drops (Xingqi Eye Drops), and PBA-siNFKBIZ-M (equivalent siRNA dose of 0.05 mg / kg) in both eyes twice a day for 14 consecutive days (once in the morning and once in the evening). Tear secretion was detected and corneal fluorescein sodium staining was evaluated on the 0th, 7th, and 14th days of drug administration, and the specific operations were carried out according to Example 2.

[0288] The results are as Figure 15 shown. The fluorescein sodium results showed that the scores of all drug administration groups decreased. Among them, the CsA eye drop treatment group decreased significantly on the 7th day and decreased from the initial 11 points to about 6 points on the 14th day, and the result of the phenol red thread tear test increased from 1.8 mm to about 3.3 mm. The fluorescein sodium score of the PBA-siNFKBIZ-M group of mice decreased after 14 days of treatment (from 11 points to about 8.0), and the tear secretion volume also increased (from 1.5 mm to 3 mm). Compared with the PBS treatment group, both the CsA administration group and the PBA-siNFKBIZ-M administration group could improve the signs of dry eye.

[0289] Example 4

[0290] The dual-phenylboronic acid targeted delivery of siNFKBIZ gene pharmaceutical composition for the treatment of dry eye

[0291] 1. Synthesis and characterization of the 2PBA-siNFKBIZ gene pharmaceutical composition

[0292] 1.1 Synthesis of 2PBA-MAL

[0293] In this example, the synthesis route of 2PBA-MAL is as Figure 16 shown.

[0294] 1.2 Synthesis of compound 4

[0295] Take compound 1 (1000 mg) and compound 2 (1440 mg) in a 100 mL flask, add 40 mL of dichloromethane and stir until dissolved. Add EDCI (900 mg) and DMAP (30 mg), under nitrogen protection, place the reaction at room temperature for 20 h. After the reaction is completed, distill off dichloromethane under reduced pressure, add 30 mL of water, and extract with 30 mL of ethyl acetate twice. Collect the organic phase, then wash it once with 30 mL of saturated sodium bicarbonate solution, and then wash it once with 30 mL of saturated sodium chloride solution. The organic phase is dried with anhydrous sodium sulfate. After evaporating the solvent, add 10 mL of ethyl acetate and shake. Slowly add n-hexane with stirring until a large amount of white solid precipitates. Filter by suction, wash the filter cake twice with n-hexane to obtain compound 3 (859 mg), yield: about 84%.

[0296] The 1 1H NMR spectrum of compound 3 is as Figure 17 shown. The solvent used for nuclear magnetic spectroscopy test is CDCl3, and the attribution of each proton peak is as follows: 1 1H NMR (600 MHz, Chloroform-d) δ 7.94 (d, J = 7.9 Hz, 4H), 7.79 (d, J = 7.9 Hz, 4H), 4.89 (d, J = 6.8 Hz, 1H), 4.47 - 4.36 (m, 5H), 1.35 (s, 9H), 1.29 (s, 24H). The 1 1H NMR spectrum of compound 3 is as Figure 18 shown. The solvent used for nuclear magnetic spectroscopy test is CDCl3, and the attribution of the characteristic carbons contained in the product is as follows: 13 13C NMR (151 MHz, Chloroform-d) δ 166.37, 134.75, 128.72, 84.23, 64.11, 28.31, 24.89.

[0297] 1.3 Synthesis of compound 4

[0298] Compound 4 (859 mg) was placed in a dry 100 mL round-bottom flask, and 20 mL of acetone was added and stirred until dissolved. Sodium periodate (1130 mg) and ammonium acetate (412 mg) were dissolved in 20 mL of water and added to the acetone. Under nitrogen protection, the reaction was carried out at room temperature for 10 h. After the reaction was completed, acetone was removed by distillation under reduced pressure, 20 mL of water was added, and it was washed twice with 20 mL of ethyl acetate. Then the organic phase was washed once with 20 mL of saturated sodium chloride solution. Next, the organic phase was collected, dried over anhydrous sodium sulfate, and distilled under reduced pressure to obtain a colorless oily liquid. It was redissolved in 20 mL of ethyl acetate and 2 mL of methanol, and 7 mL of 4 M hydrogen chloride-ethyl acetate solution was added under an ice bath. The reaction was stirred at room temperature for 4 h, and a large amount of white solid precipitated. It was filtered by suction, and the filter cake was washed twice with ethyl acetate to obtain 424 mg of white solid, that is, compound 4 was prepared, and the yield was about 76%.

[0299] The 1 H NMR spectrum of compound 4 is as Figure 19 shown. The solvent used for nuclear magnetic spectroscopy test is CDCl3, and the attribution of each proton peak is as follows: 1 H NMR (700 MHz, DMSO-d6) δ 8.82 (s, 2H), 8.35 (s, 4H), 8.10 (d, J = 8.3 Hz, 4H), 7.94 (d, J = 8.2 Hz, 4H), 4.61 (qd, J = 11.9, 5.1 Hz, 4H), 4.05 (s, 1H). The 13 C NMR spectrum of compound 3 is as Figure 20 shown. The solvent used for nuclear magnetic spectroscopy test is CDCl3, and the attribution of the characteristic carbons contained in the product is as follows: 13C NMR (151 MHz, Methanol-d4) δ 166.14, 133.56, 128.41, 62.00, 49.52.

[0300] 1.4 Synthesis of compound 5

[0301] Compound 4 (424 mg) and 4-maleimidobutyric acid (366 mg) were placed in a dry 100 mL round-bottom flask, and 30 mL of methanol was added and stirred until dissolved. Next, DMTMM (557 mg) and NMM (203 mg) were added, and the reaction was carried out at room temperature for 2 h. After the reaction was completed, methanol was removed by distillation under reduced pressure, 20 mL of water was added, and it was washed twice with 20 mL of ethyl acetate. The organic phase was washed once with 20 mL of saturated sodium chloride solution. The organic phase was collected, dried over anhydrous sodium sulfate, and distilled under reduced pressure to obtain a colorless oily liquid. Purification by reverse-phase column chromatography gave 481 mg of white solid, that is, compound 7 was prepared, and the yield was about 87%.

[0302] The 1 H NMR spectrum of compound 5 is as Figure 21As shown, the solvent used for nuclear magnetic spectroscopy test is DMSO-d6, and the attribution of each proton peak is as follows: 1 1H NMR (600 MHz, DMSO-d6) δ 8.25 (d, J = 8.3 Hz, 1H), 7.96 (d, J = 8.3 Hz, 4H), 7.91 (d, J = 8.2 Hz, 4H), 6.97 (s, 2H), 4.61 - 4.52 (m, 1H), 4.45 - 4.36 (m, 4H), 3.39 (t, J = 7.0 Hz, 2H), 2.14 (t, J = 7.5 Hz, 2H), 1.73 (p, J = 7.2 Hz, 2H). For compound 5 13 The 13C NMR spectrum is as follows Figure 22 As shown, the solvent used for nuclear magnetic spectroscopy test is DMSO-d6, and the attribution of the characteristic carbons contained in the product is as follows: 13 13C NMR (151 MHz, DMSO-d6) δ 170.41, 165.17, 133.83, 133.59, 130.03, 127.58, 62.92, 38.44, 36.17, 32.01, 23.56.

[0303] 1.5 Synthesis of 2PBA-siNFKBIZ gene pharmaceutical composition

[0304] The small interfering RNA targeting the NFKBIZ gene used in this example was purchased from Suzhou Beixin Biotechnology Co., Ltd. A thiol (-SH) modification was introduced at the 3' end of the small interfering RNA to enable efficient coupling with the maleimide group modified on 2PBA-MAL through click chemistry. The 3'-thiol group modification is represented by 3'-SH in all the following examples, and its modified structure is as shown in Formula 60.

[0305]

[0306] Among them, represents the linked nucleic acid molecule, and Base represents any type of base.

[0307] The siNFKBIZ gene drug sequence used in this example is as follows:

[0308] Among them, the sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0309] Sense: 5'-GCCCGAUUCGUUGUCUGAU-3' (SEQ ID NO: 35);

[0310] Antisense: 5'-AUCAGACAACGAAUCGGGCcc-3' (SEQ ID NO: 433);

[0311] The sequence of the small interfering RNA (siNFKBIZ-M) targeting the mouse NFKBIZ gene is

[0312] Sense: 5′-GCGUCAAUGUACCAGUAUU-3′ (SEQ ID NO: 421);

[0313] Antisense: 5′-AAUACUGGUACAUUGACGCCU-3′ (SEQ ID NO: 422);

[0314] The synthesis route of the 2PBA-siNFKBIZ-S conjugate is as Figure 23 shown:

[0315] The synthesis method is as follows: Dissolve 0.72 mg of 2PBA-MAL (1300 nmol) prepared in Example 4.1 in 1.3 mL of DMSO. Take 0.13 mL and add 5 OD (26 nmol) of the sense strand (siNFKBIZ-S) of siNFKBIZ-3′-SH, then place it in a shaker at 50 °C and react for 24 h. After adding 5 mL of water, extract with ethyl acetate to remove the excess 2PBA-MAL in the reaction. Then concentrate and evaporate the aqueous solution to dryness to obtain the 2PBA-siNFKBIZ-S conjugate molecule. Then, quantitatively mix 2PBA-siNFKBIZ-S with the antisense strand (siNFKBIZ-A) of siNFKBIZ at a molar ratio of 1:1, place it at 65 °C for 10 min, and anneal for 10 min to 25 °C to obtain the pharmaceutical composition of 2PBA-siNFKBIZ. Verify the successful grafting and coupling of 2PBA and siNFKBIZ by 20% non-denaturing polyacrylamide gel electrophoresis, as shown in Figure 24 .

[0316] 2. Verification of the cellular uptake ability of the 2PBA-siNFKBIZ gene pharmaceutical composition

[0317] Seed HCEC cells in a 24-well culture plate at a density of 4×10 4 cells per well, place a clean coverslip in each well, and culture overnight. Subsequently, culture with 2PBA-siNFKBIZ-Cy3 and siRNA-Cy3 (equivalent Cy3 concentration: 0.5 μM) for 6 h respectively. Then remove the culture medium, wash 3 times with PBS, and fix with 4% paraformaldehyde at room temperature for 15 min. Then, stain with DAPI for 15 min, wash with PBS, and observe using a laser confocal microscope. The results are as shown in Figure 25 A in it. The green fluorescence of cells in the 2PBA-siNFKBIZ-Cy3 group is higher than that in the siNFKBIZ-Cy3 group.

[0318] The HCEC cells were seeded at a density of 4.0×10 5 cells per well in a 12-well plate and cultured overnight in DMEM. PBA-siNFKBIZ-Cy3 was added to the cells at a concentration of 0.5 μM per well of Cy3 concentration and incubated at 37 °C for 6 h in Opti-MEM. siNFKBIZ-Cy3 was used as a control. The cells were collected using trypsin and collected for flow cytometry analysis. The results are as Figure 25 shown in B of the figure. The mean fluorescence intensity of the 2PBA-siNFKBIZ-Cy3 group was approximately 1.5 times that of the siNFKBIZ-Cy3 group. Based on the above results, it is shown that the modification of 2PBA can further enhance the drug uptake ability of siNFKBIZ and improve its cellular uptake effect.

[0319] 3. Evaluation of the gene regulation ability of the 2PBA-siNFKBIZ gene drug composition

[0320] According to the standard of 1×10 5 cells / well, HCEC cells were seeded in a 6-well plate and cultured overnight. Then, after stimulation with IL-1β for 12 h, the cells were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing siNFKBIZ and the 2PBA-siNFKBIZ drug composition for 6 h, and then the complete medium was replaced. The cells were further cultured at 37 °C for 48 h. Next, mRNA was extracted and the concentration of mRNA was measured. cDNA was reverse transcribed and qPCR experiments were performed. The results are as Figure 26 shown. After stimulation with IL-1β, the expression of the NFKBIZ gene in HCEC cells was significantly upregulated to about 1.5 times that of normal cells. The simple siNFKBIZ gene drug could downregulate it to about 1.4 times, with no significant difference. However, the 2PBA-siNFKBIZ drug composition could effectively inhibit the expression of the NFKBIZ gene to about 1.1. The above results indicate that the 2PBA-siNFKBIZ gene drug composition can effectively promote the cellular uptake of the siNFKBIZ gene drug, thereby achieving the regulatory effect on the NFKBIZ gene and achieving a better gene inhibition effect.

[0321] 4. Dry eye treatment effect of the 2PBA-siNFKBIZ gene drug composition

[0322] All animal experiments in this example were conducted in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO)'s "Statement on the Use of Animals in Ophthalmic and Vision Research" and complied with relevant operating specifications. All animal experiments were carried out in accordance with the guidelines formulated by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6- to 8-week-old specific pathogen-free (SPF) C57BL / 6 mice (30 eyes) were selected from Shanghai Slack Experimental Animal Co., Ltd. and housed in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 6 groups and exposed to a low-humidity environment (RH = 18.5% ± 5.1%, AF = 15 L / min, T = 21 - 23 °C) for 4 days to adapt. Then, 5 μL of 0.2% benzalkonium chloride was instilled into each eye twice a day for 14 consecutive days to establish a dry eye model in mice. Each group of mice received local instillation of PBS, cyclosporine CsA eye drops (Xingqi Eye Medicine), and 2PBA-siNFKBIZ (equivalent siRNA dose of 0.05 mg / kg) into both eyes twice a day for 14 consecutive days (once in the morning and once in the evening). Tear secretion was detected and corneal fluorescein sodium staining was evaluated on days 0, 7, and 14 of drug administration, and the specific operations were carried out according to Example 2.

[0323] The results are as Figure 27 shown. In the group administered with CsA eye drops, the fluorescein sodium score of the mice decreased from 10 points to about 5 points, and the result of the phenol red thread tear test increased from 2 mm to about 4 mm; in the group administered with 2PBA-siNFKBIZ-M, the fluorescein sodium score of the mice's eyes decreased to about 4.8 points, and the result of the phenol red thread tear test increased from 2 mm to about 4.5 mm; it can be seen from the results of the animal experiments that 2PBA-siNFKBIZ-M has a good therapeutic effect on dry eye in mice. One reason is that PBA can bind to ocular proteins and promote the entry of siNFKBIZ-M into cells; the other is that after siNFKBIZ-M enters cells, it can play a good regulatory role on the NFKBIZ gene, inhibit inflammation, and achieve a good therapeutic effect on dry eye.

[0324] Example 5

[0325] Treatment of dry eye with a tetrabenzoic acid-targeted delivery siNFKBIZ gene pharmaceutical composition

[0326] 1. Synthesis and characterization of the 4PBA-siNFKBIZ gene pharmaceutical composition

[0327] The synthesis route of 4PBA-NH2 in this example is as Figure 28 shown.

[0328] 1.1 Synthesis of compound 7

[0329] Compound 6 (100 mg) and compound 2 (826 mg) were taken in a 100 mL flask, 40 mL of methanol was added and stirred until dissolved. DMTMM (921 mg) and NMM (337 mg) were added. Under nitrogen protection, the reaction was carried out at room temperature for 20 h. After the reaction was completed, methanol was removed by distillation under reduced pressure. 10 mL of ethyl acetate was added and shaken. The mixture was allowed to stand to precipitate a white solid, which was filtered by suction to obtain compound 7 (512 mg), yield: about 84%.

[0330] For compound 7 1 The 1H NMR spectrum is as follows Figure 29 shown. The solvent used for the NMR spectrum test was CDCl3, and the assignments of each proton peak are as follows: 1 1H NMR (700 MHz, Chloroform-d) δ 7.82 - 7.73 (m, 8H), 7.30 (t, J = 6.4 Hz, 2H), 3.95 (q, J = 5.0 Hz, 1H), 3.61 - 3.50 (m, 4H), 1.29 (s, 24H). For compound 7 13 The 13C NMR spectrum is as follows Figure 30 shown. The solvent used for the NMR spectrum test was CDCl3, and the assignments of the characteristic carbons in the product are as follows: 13 13C NMR (151 MHz, Chloroform-d) δ 168.08, 134.87, 133.98, 131.74, 125.25, 83.09, 69.08, 41.97, 23.85.

[0331] 1.2 Synthesis of compound 8

[0332] Compound 7 (512 mg) was taken in a 100 mL flask, 30 mL of dichloromethane was added and stirred until dissolved. DMAP (10 mg) and DIEA (240 mg) were added. Acetic anhydride (190 mg) was added under ice bath. Under nitrogen protection, the reaction was carried out at room temperature for 20 h. After the reaction was completed, dichloromethane was removed by distillation under reduced pressure. 50 mL of water was added, and it was washed twice with 20 mL of ethyl acetate in sequence. The organic phase was washed once with 20 mL of saturated sodium chloride solution. The organic phase was dried with anhydrous sodium sulfate and distilled under reduced pressure to obtain a colorless oily liquid. 10 mL of ether was added and shaken. The mixture was allowed to stand to obtain a white solid, which was filtered by suction. After drying the filter cake, 550 mg of white solid was obtained, namely compound 8, yield: about 91%.

[0333] For compound 8 1 The 1H NMR spectrum is as follows Figure 31 shown. The solvent used for the NMR spectrum test was CDCl3, and the assignments of each proton peak are as follows: 11H NMR (700 MHz, DMSO-d6) δ 12.22 (s, 1H), 8.67 (t, J = 6.0 Hz, 2H), 7.88 - 7.69 (m, 8H), 5.09 (tt, J = 6.7, 4.9 Hz, 1H), 3.58 (dt, J = 13.9, 5.1 Hz, 2H), 3.43 - 3.38 (m, 2H), 2.51 (s, 2H), 2.48 - 2.44 (m, 2H), 1.31 (s, 22H). For compound 8 13 The 13C NMR spectrum of Figure 32 is shown as follows. The solvent used for NMR spectroscopy measurement is CDCl3, and the attribution of characteristic carbons in the product is as follows: 13 13C NMR (151 MHz, Chloroform-d) δ 174.55, 170.86, 167.66, 134.79, 133.97, 131.68, 125.34, 83.13, 70.50, 38.17, 28.39, 28.20, 23.83.

[0334] 1.3 Synthesis of compound 9

[0335] Take compound 1 (100 mg) and compound 8 (1019 mg) in a 100 mL flask, add 40 mL of ethyl acetate and stir until dissolved. Add EDCI (300 mg) and DMAP (10 mg), and under nitrogen protection, place the reaction at room temperature for 20 h. After the reaction is completed, distill off dichloromethane under reduced pressure, add 30 mL of water (pH = 3), wash twice with 30 mL of ethyl acetate, collect the organic phase, wash once with 30 mL of saturated sodium bicarbonate solution and once with 30 mL of saturated sodium chloride solution, dry the collected organic phase with anhydrous sodium sulfate, and distill under reduced pressure to obtain a white foam solid, which is directly used for the subsequent reaction.

[0336] 1.4 Synthesis of compound 10

[0337] Take compound 9 (647 mg) in a dry 100 mL round-bottom flask, add 10 mL of acetone and stir until dissolved. Dissolve sodium periodate (761 mg) and ammonium acetate (278 mg) in 10 mL of water and add it to the acetone solution. Under nitrogen protection, place the reaction at room temperature for 10 h. After the reaction is completed, distill off acetone under reduced pressure, add 20 mL of water, wash twice with 20 mL of ethyl acetate, wash the organic phase once with 20 mL of saturated sodium chloride solution, dry the collected organic phase with anhydrous sodium sulfate, and distill under reduced pressure to obtain a colorless oily liquid, which is compound 10, directly used for the subsequent reaction.

[0338] 1.5 Synthesis of compound 11

[0339] Compound 10 was placed in a dry 100 mL round-bottom flask, and 30 mL of ethyl acetate was added and stirred until dissolved. 4M hydrogen chloride-ethyl acetate solution (10 mL) was added under an ice bath, and the reaction was carried out for 3 h under nitrogen protection. After the reaction was completed, the hydrogen chloride-ethyl acetate solution was removed by distillation under reduced pressure, and the product was purified by reverse-phase column chromatography to obtain 392 mg of a white solid, namely compound 11, with a yield of about 83%.

[0340] The 1 1H NMR spectrum of compound 11 is as Figure 33 shown. The solvent used for nuclear magnetic spectroscopy testing was DMSO-d6, and the assignments of each proton peak are as follows: 1 1H NMR (600 MHz, DMSO-d6) δ 8.76 (s, 5H), 8.57 (d, J = 6.2 Hz, 3H), 8.24 (d, J = 20.8 Hz, 4H), 7.87 (q, J = 6.4, 5.1 Hz, 16H), 5.07 (t, J = 6.0 Hz, 2H), 4.22 - 4.17 (m, 4H), 3.84 (d, J = 5.0 Hz, 1H), 3.40 - 3.28 (m, 8H), 2.64 - 2.60 (m, 8H). The 13 13C NMR spectrum of compound 11 is as Figure 34 shown. The solvent used for nuclear magnetic spectroscopy testing was DMSO-d6, and the assignments of the characteristic carbons contained in the product are as follows: 13 13C NMR (151 MHz, DMSO-d6) δ 170.82, 167.16, 167.08, 136.19, 134.40, 134.23, 126.59, 69.00, 60.23, 55.38, 50.81, 49.05, 44.06, 21.23, 14.55.

[0341] 1.5 Synthesis of 4PBA-siNFKBIZ gene pharmaceutical composition

[0342] The small interfering RNAs targeting the NFKBIZ gene used in this example were all purchased from Suzhou Beixin Biotechnology Co., Ltd., and an aldehyde group (5′-CHO-) modification was introduced at the 5′ end of the small interfering RNA to enable it to be efficiently coupled with the carboxyl group modified on 4PBA-NH2 through an electrophilic substitution reaction. The 5′-end aldehyde group modification is represented by 5′-CHO- in all the following examples, and its modified structure is as shown in Formula 61.

[0343]

[0344] Among them, represents the linked nucleic acid molecule, and Base represents any type of base.

[0345] The siNFKBIZ gene drug sequence used in this embodiment is as follows:

[0346] The sequence of small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0347] Sense: 5′-UUAUCAACAUUAAGAAUGA-3′ (SEQ ID NO: 44);

[0348] Antisense: 5′-UCAUUCUUAAUGUUGAUAA-3′ (SEQ ID NO: 254);

[0349] To further increase the stability of RNA, stabilization modification was performed in this embodiment, and the specific sequence is:

[0350] Sense: 5′-UmUmAmUmCfAmAfCfAfUmUmAmAmGmAmAmUmsGmsAm-3′ (SEQ ID NO: 44);

[0351] Antisense: 5′-UmsCfsAmUmUmCfUmUfAfAmUmGmUmUfGmAfUmsAmsAm-3′ (SEQ ID NO: 254);

[0352] The sequence of stabilized small interfering RNA (siNFKBIZ-M) targeting the mouse NFKBIZ gene is

[0353] Sense: 5′-GmCmGmUmCfAmAfUfGfUmAmCmCmAmGmUmAmsUmsUm-3′ (SEQ ID NO: 421);

[0354] Antisense: 5′-AmsAmsUmAmCmUfGmGfUfAmCmAmUmUfGmAfCmsGmsCm-3′ (SEQ ID NO: 422).

[0355] Among them, m represents 2′-O-methylation modification of the ribose sugar backbone, s represents phosphorothioate modification of the backbone, and f represents 2′-fluorination modification of the ribose sugar backbone.

[0356] The synthesis route of 4PBA-siNFKBIZ-S is as Figure 35 shown.

[0357] The specific synthesis method is as follows: Dissolve 0.15 mg of 4PBA-NH2 (1300 nmol) and 0.14 mg of pic-BH3 (1300 nmol) in 0.13 mL of DMSO. Take 0.13 mL and add 5 OD (26 nmol) of the sense strand of 5′-CHO-siNFKBIZ (siNFKBIZ-S) and 5 μL of acetic acid, and react with shaking at room temperature for 2 h. After the reaction is completed, add 1 mL of absolute ethanol and 13 μL of 10× PBS, and let it stand overnight at -20 °C. After centrifuging at 12000 rpm for 15 min, discard the supernatant, and dissolve the precipitate in water to obtain the 4PBA-siNFKBIZ-S conjugate molecule. Then, quantitatively mix PBA-siNFKBIZ-S with the antisense strand of siNFKBIZ (siNFKBIZ-A) at a molar ratio of 1:1, and place it at a constant temperature of 65 °C for 10 min, and anneal for 10 min to 25 °C to obtain the 4PBA-siNFKBIZ drug composition. Verify the successful grafting and coupling of 4PBA and siNFKBIZ by 20% non-denaturing polyacrylamide gel electrophoresis, as shown in Figure 36 . It can be seen from the figure that the efficiency of grafting 4PBA to DBCO-siNFKBIZ is relatively high, and the yield is more than 90%.

[0358] 2. Verification of the cellular uptake ability of the 4PBA-siNFKBIZ drug composition

[0359] Seed HCEC cells into a 12-well culture plate at a density of 4×10 4 cells per well, place a clean coverslip in each well, and culture overnight. Subsequently, culture with 4PBA-siNFKBIZ-FAM and siRNA-FAM (equivalent FAM concentration: 0.5 μM) for 6 h respectively. Then remove the culture medium, wash 3 times with PBS, and fix with 4% paraformaldehyde at room temperature for 15 min. Then, stain the cell nuclei with DAPI for 15 min, wash with PBS, and observe using a laser confocal microscope. The results are as shown in Figure 37 A. The green fluorescence of the cells in the 4PBA-siNFKBIZ-FAM group is significantly higher than that in the siNFKBIZ-FAM group.

[0360] In order to seed HCEC cells into a 12-well plate at a density of 4.0×10 5 cells per well, culture overnight in DMEM. Add 4PBA-siNFKBIZ-FAM to the cells according to the concentration of FAM (0.5 μM) per well, and incubate at 37 °C in Opti-MEM for 6 h. Use siNFKBIZ-FAM as a control. Collect the cells using trypsin and collect for flow cytometry analysis. The results are as shown in Figure 37As shown in B, the average fluorescence intensity of the 4PBA-siNFKBIZ-FAM group was approximately 2.3 times that of the siNFKBIZ-FAM group. Based on the above results, it is indicated that the modification of 4PBA can further enhance the uptake ability of the siNFKBIZ small nucleic acid drug and improve its cellular uptake effect.

[0361] 3. Evaluation of the gene regulation ability of the 4PBA-siNFKBIZ drug composition

[0362] According to the standard of 1×10 5 cells / well, HCEC cells were seeded into a 6-well plate and cultured overnight. Then, after stimulation with IL-1β for 12 h, the cells were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing siNFKBIZ and the 4PBA-siNFKBIZ drug composition for 6 h, and then the complete medium was replaced. The cells were continued to be cultured at 37 °C for 48 h. Next, mRNA was extracted, and the concentration of mRNA was measured. cDNA was obtained by reverse transcription, and qPCR experiments were performed. The results are as Figure 38 shown in A. After stimulation with IL-1β, the expression of the NFKBIZ gene in HCEC cells was significantly upregulated to about 1.8 times that of normal cells. The simple siNFKBIZ gene drug could downregulate it to about 1.5 times. However, the 4PBA-siNFKBIZ drug composition could effectively inhibit the expression of the NFKBIZ gene, inhibiting it to about 1.0.

[0363] According to the standard of 1×10 5 cells / well, HCEC cells were seeded into a 6-well plate and cultured overnight. Then, after stimulation with IL-1β for 12 h, the cells were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing different concentrations of the 4PBA-siNFKBIZ drug composition for 6 h. After replacing the complete medium, the cells were continued to be cultured for 48 h. Next, total protein was extracted from the cells using RIPA buffer containing a protease inhibitor mixture, the protein concentration was measured, and Western-blot experiments were performed. The results are as Figure 38 shown in B. The above results indicate that the 4PBA-siNFKBIZ drug composition can effectively promote the cellular uptake of the siNFKBIZ gene drug, inhibit the expression of the NFKBIZ gene, and can effectively inhibit the protein expression of IκBζ.

[0364] 4. Dry eye treatment effect of the 4PBA-siNFKBIZ drug composition

[0365] All animal experiments in this example were conducted in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO)'s "Statement on the Use of Animals in Ophthalmic and Vision Research" and complied with relevant operating specifications. All animal experiments were carried out in accordance with the guidelines formulated by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6- to 8-week-old specific pathogen-free (SPF) C57BL / 6 mice (30 eyes) were selected from Shanghai Slack Experimental Animal Co., Ltd. and housed in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 3 groups and exposed to a low-humidity environment (RH = 18.5% ± 5.1%, AF = 15 L / min, T = 21 - 23 °C) for 4 days to adapt. Then, 5 μL of 0.2% benzalkonium chloride was instilled into each eye twice a day for 14 consecutive days to establish a dry eye model in mice. In each group, the eyes of the mice were locally instilled with PBS, cyclosporine CsA eye drops (Xingqi Eye Medicine), and 4PBA-siNFKBIZ-M (equivalent siRNA dose of 0.05 mg / kg) twice a day for 14 consecutive days. Tear secretion was detected and corneal fluorescein sodium staining was evaluated on the 0th, 7th, and 14th days of drug administration, and the specific operations were carried out according to Example 2.

[0366] The results are as Figure 39 shown. It can be seen from the fluorescein sodium staining that after 14 days of treatment, compared with the PBS group, the staining in the eyes of the drug administration groups was less, and the degree of corneal damage was significantly improved. Among them, the ocular damage in the 4PBA-siNFKBIZ-M drug administration group was significantly reduced, from the initial 9 points to about 4 points, while the score in the CsA group dropped to about 5 points. The results of tear secretion showed that after treatment with the 4PBA-siNFKBIZ-M pharmaceutical composition, the tear secretion increased from about 1.5 mm to about 4 mm. In summary, the 4PBA-siNFKBIZ-M gene drug can improve the retention of the siNFKBIZ-M drug on the ocular surface, increase the bioavailability of the drug, promote the uptake of the siNFKBIZ gene drug by cells, thereby inhibiting the expression of the NFKBIZ gene, curbing the vicious cycle of inflammation, achieving improvement of corneal damage on the ocular surface, and effectively treating dry eye.

[0367] Example 6

[0368] Treatment of dry eye with a 6-phenylboronic acid-targeted delivery siNFKBIZ gene pharmaceutical composition

[0369] 1. Synthesis and characterization of the 6PBA-siNFKBIZ gene pharmaceutical composition

[0370] The synthesis route of 6PBA-N3 in this example is as Figure 40 shown.

[0371] 1.1 Synthesis of Compound 13

[0372] Compound 12 (200 mg) and azidohexanoic acid (467 mg) were placed in a 100 mL flask, and 20 mL of methanol was added and stirred until dissolved. DMTMM (688 mg) and NMM (248 mg) were added. Under nitrogen protection, the reaction was carried out at room temperature for 20 h. After the reaction was completed, methanol was removed by distillation under reduced pressure, and the product was separated and purified by silica gel column chromatography. The eluent was ethyl acetate∶methanol = 30∶1. Finally, 356 mg of white solid was obtained, that is, compound 13 was prepared, and the yield was about 83%.

[0373] For compound 13 1 The H NMR spectrum is as Figure 41 shown. The solvent used for nuclear magnetic spectroscopy test was CDCl3, and the assignments of each proton peak are as follows: 1 H NMR (700 MHz, DMSO-d6) δ 7.13 (s, 1H), 4.76 (t, J = 5.8 Hz, 3H), 3.51 (d, J = 5.7 Hz, 6H), 3.31 (t, J = 6.9 Hz, 2H), 2.14 (t, J = 7.4 Hz, 2H), 1.51 (ddt, J = 21.1, 15.1, 7.3 Hz, 4H), 1.33 - 1.26 (m, 2H).

[0374] 1.2 Synthesis of compound 14

[0375] Compound 13 (356 mg) and compound 8 (3560 mg) were placed in a 250 mL flask, and 100 mL of dichloromethane was added and stirred until dissolved. EDCI (849 mg) and DMAP (100 mg) were added. Under nitrogen protection, the reaction was carried out at room temperature for 20 h. After the reaction was completed, dichloromethane was removed by distillation under reduced pressure. 100 mL of ethyl acetate was added, and the mixture was washed twice with 100 mL of water (pH = 3), twice with 100 mL of saturated sodium bicarbonate solution, and once with 100 mL of saturated sodium chloride solution. After collecting the organic phase, it was dried over anhydrous sodium sulfate, and white foam solid was obtained by distillation under reduced pressure, which was directly used for the subsequent reaction.

[0376] 6.1.3 Synthesis of compound 15

[0377] Compound 14 (1000 mg) was placed in a dry 100 mL round-bottom flask, and 30 mL of acetone was added and stirred until dissolved. Sodium periodate (2379 mg) and ammonium carbonate (857 mg) were dissolved in 30 mL of water and added to the acetone solution. Under nitrogen protection, the reaction was carried out at room temperature for 10 h. After the reaction was completed, acetone was removed by distillation under reduced pressure. 100 mL of ethyl acetate was added, and it was washed twice with 100 mL of water and once with 100 mL of saturated sodium chloride solution in sequence. After collecting the organic phase, it was dried over anhydrous sodium sulfate, and white solid was obtained by distillation under reduced pressure. The white solid was dissolved in 10 mL of ethyl acetate, and 10 mL of dichloromethane and 20 mL of petroleum ether were slowly added with stirring. The mixture was filtered by suction to obtain a white solid, and the solid was washed with 20 mL of petroleum ether and dried to obtain 702 mg of white solid, namely Compound 15 was prepared, and the yield was about 91%.

[0378] For Compound 15 1 The H NMR spectrum is as Figure 42 shown. The solvent used for the nuclear magnetic spectroscopy test was Methanol-d4, and the assignments of each proton peak were as follows: 1 H NMR (600 MHz, Methanol-d4) δ 7.78 (t, J = 15.6 Hz, 24H), 5.22 - 5.18 (m, 3H), 4.32 (s, 6H), 3.71 (dd, J = 14.2, 4.8 Hz, 6H), 3.55 (dd, J = 14.3, 6.5 Hz, 6H), 3.19 (t, J = 6.8 Hz, 2H), 2.64 - 2.56 (m, 13H), 2.15 (t, J = 7.4 Hz, 2H), 1.51 (dq, J = 22.3, 7.4 Hz, 4H), 1.29 (ddt, J = 8.3, 5.9, 2.5 Hz, 2H). For Compound 15 13 The C NMR spectrum is as Figure 43 shown. The solvent used for the nuclear magnetic spectroscopy test was Methanol-d4, and the assignments of the characteristic carbons contained in the product were as follows: 13 C NMR (151 MHz, Methanol-d4) δ 175.22, 172.27 (d, J = 3.1 Hz), 169.37, 137.37, 135.29, 133.63, 125.97, 71.83, 62.03, 60.16, 57.56, 53.41, 50.85, 48.45, 40.07, 35.74, 25.82, 24.95, 19.47, 13.07.

[0379] 1.4 Synthesis of 6PBA-siNFKBIZ gene pharmaceutical composition

[0380] The small interfering RNAs targeting the NFKBIZ gene used in this example were all purchased from Suzhou Best Biotechnology Co., Ltd. A dibenzocyclooctyne (DBCO) modification was introduced at the 3′ end of the small interfering RNA to enable its efficient coupling with the azide group modified on 6PBA-N3 through click chemistry. The 3′-end DBCO group modification is represented as 3′-DBCO in all the following examples, and its modification structure is shown in Formula 62:

[0381]

[0382] Among them, represents the linked nucleic acid molecule. Base represents any type of base;

[0383] The siNFKBIZ gene drug sequence used in this example is as follows:

[0384] Among them, the sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0385] Sense: 5′-AGUUGUUUCUAUGAAACAA-3′ (SEQ ID NO: 101);

[0386] Antisense: 5′-UUGUUUCAUAGAAACAACUua-3′ (SEQ ID NO: 434);

[0387] Furthermore, the sequences used in this example were subjected to stabilization modification, and the specific modifications are as follows:

[0388] Sense: 5′-AmsGmsUmUmGfUmUfUfCfUmAmUmGmAmAmAmCmAmAm-3′ (SEQ ID NO: 101);

[0389] Antisense: 5′-UmsUfsGmUmUmUfCmAfUfAmGmAmAmAfCmAfAmCmUmsUmsAm-3′ (SEQ ID NO: 434);

[0390] Among them, m represents 2′-O-methylation modification of the ribose sugar backbone, s represents phosphorothioate modification of the backbone, and f represents 2′-fluorination modification of the ribose sugar backbone.

[0391] Among them, the sequence of the small interfering RNA (siNFKBIZ-M) targeting the mouse NFKBIZ gene is

[0392] Sense: 5′-GCGUCAAUGUACCAGUAUU-3′ (SEQ ID NO: 421);

[0393] Antisense: 5′-AAUACUGGUACAUUGACGCCU-3′ (SEQ ID NO: 422);

[0394] The synthetic route of 6PBA-siNFKBIZ-S is as Figure 44 shown:

[0395] The specific synthesis method is as follows: Dissolve 0.15 mg of 6PBA-N3 (130 nmol) in 0.13 mL of DMSO, add 5 OD (26 nmol) of the sense strand of DBCO-siNFKBIZ (siNFKBIZ-S), and place it in a shaker at 50 °C for 24 h. After adding 5 mL of water, extract and remove the excess 6PBA-N3 in the reaction with ethyl acetate. Then, concentrate and evaporate the aqueous solution to dryness to obtain the PBA-siNFKBIZ-S conjugate molecule. Then, quantitatively mix 6PBA-siNFKBIZ-S with the antisense strand of siNFKBIZ (siNFKBIZ-A) at a molar ratio of 1:1, and place it at a constant temperature of 65 °C for 10 min, and anneal from 10 min to 25 °C to obtain the pharmaceutical composition of 6PBA-siNFKBIZ. As Figure 45 shown, the successful grafting and coupling of 6PBA and siNFKBIZ was verified by 20% denaturing polyacrylamide gel electrophoresis, and the grafting rate was greater than 90%.

[0396] 2. Verification of the cellular uptake ability of the 6PBA-siNFKBIZ gene pharmaceutical composition

[0397] Seed HCEC cells in a 24-well culture plate at a density of 4 × 10 4 cells per well, place a clean coverslip in each well, and culture overnight. Subsequently, culture with 6PBA-siNFKBIZ-FAM and siNFKBIZ-FAM (equivalent FAM concentration: 0.5 μM) for 6 h respectively. Then, remove the culture medium, wash 3 times with PBS, and fix with 4% paraformaldehyde at room temperature for 15 min. Then, stain with DAPI for 15 min, wash with PBS, and observe using a laser confocal microscope. The results are as Figure 46 shown in A below. The green fluorescence of cells in the 6PBA-siNFKBIZ-FAM group was significantly higher than that in the siNFKBIZ-FAM-FAM group.

[0398] In order to seed HCEC cells at 4.0 × 10 5Cells were seeded in 12-well plates and cultured overnight in DMEM. 6PBA-siNFKBIZ-FMA (equivalent FAM concentration 0.5 μM) was added to the cells and incubated at 37 °C for 6 h in Opti-MEM. siNFKBIZ-FAM was used as a control. Cells were collected using trypsin and collected for flow cytometry analysis. The results are as Figure 46 shown in B of [reference], the mean fluorescence intensity of the 6PBA-siNFKBIZ-FMA group was approximately 3 times that of the siNFKBIZ-FAM group. Based on the above results, it is shown that the 6PBA-siNFKBIZ pharmaceutical composition has more PBA and can better interact with cell surface glycans, thereby improving the cell's uptake ability of the siNFKBIZ small nucleic acid drug and significantly enhancing its intracellular effect.

[0399] 3. Evaluation of the gene regulation ability of the 6PBA-siNFKBIZ gene pharmaceutical composition

[0400] According to the standard of 1×10 5 cells / well, HCEC cells were seeded in 6-well plates and cultured overnight. Then, after stimulation with IL-1β for 12 h, the cells were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing siNFKBIZ and the 6PBA-siNFKBIZ pharmaceutical composition for 6 h, and then the medium was replaced with complete DMEM medium. The cells were further cultured at 37 °C for 48 h. Next, RNAiso reagent was used to lyse the cells to extract mRNA, and the concentration of mRNA was measured by Nanodrop. cDNA was obtained by reverse transcription, and qPCR experiments were performed. The results are as Figure 47 shown in A of [reference]. After stimulation with IL-1β, the expression of the NFKBIZ gene in HCEC cells was significantly upregulated to about 1.6 times that of normal cells. The simple siNFKBIZ gene drug could downregulate it to about 1.5 times. However, the 6PBA-siNFKBIZ pharmaceutical composition could effectively inhibit the expression of the NFKBIZ gene, inhibiting it to about 0.7.

[0401] According to the standard of 1×10 5 cells / well, HCEC cells were seeded in 6-well plates and cultured overnight. Then, after stimulation with IL-1β for 12 h, the cells were washed twice with PBS. Next, the cells were incubated with Opti-MEM medium containing different concentrations of the 6PBA-siNFKBIZ pharmaceutical composition for 6 h. After replacing the complete medium, the cells were further cultured for 48 h. Next, proteins were extracted and the protein concentration was measured, and Western-blot experiments were performed. The results are as Figure 47 shown in B of [reference]. The 6PBA-siNFKBIZ pharmaceutical composition could effectively inhibit the protein expression of IκBζ.

[0402] 4. Dry eye treatment effect of the 6PBA-siNFKBIZ gene drug composition

[0403] All animal experiments in this example were conducted in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO)'s "Statement on the Use of Animals in Ophthalmic and Vision Research" and complied with relevant operating specifications. All animal experiments were carried out in accordance with the guidelines established by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6-8-week-old specific pathogen-free (SPF)-level C57BL / 6 mice (30 eyes) were selected from Shanghai Slack Experimental Animal Co., Ltd. and housed in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 3 groups and exposed to a low humidity environment (RH = 18.5% ± 5.1%, AF = 15 L / min, T = 21 - 23 °C) for 4 days to adapt. Then, 5 μL of 0.2% benzalkonium chloride was instilled into each eye twice a day for 14 consecutive days to establish a dry eye model in mice. Each group of mice received local instillation of PBS, cyclosporine CsA eye drops (Xingqi Eye Medicine), and 6PBA-siNFKBIZ (equivalent siRNA dose of 0.05 mg / kg) into both eyes twice a day for 14 consecutive days (once in the morning and once in the evening). Tear secretion was detected and corneal fluorescein sodium staining was evaluated on the 0th, 7th, and 14th days of drug administration, and the specific operations were carried out according to Example 2.

[0404] The results are as Figure 48 shown. The results of fluorescein sodium staining showed that compared with the PBS group, all the drug administration groups improved on the 7th day. On the 14th day, the eye score of the CsA eye drop administration group decreased from about 10 points to 5 points, and the phenol red cotton thread tear test results showed that the tear volume also increased significantly; while the fluorescein sodium score of the 6PBA-siNFKBIZ-M administration group decreased from 10 points to about 3.5 points, and the infiltration length of the phenol red cotton thread increased from 2 mm to about 5.7 mm. In summary, compared with CsA eye drops, the 6PBA-siNFKBIZ-M administration group had a significantly better treatment effect within two weeks.

[0405] Example 7

[0406] Treatment of dry eye with a decaphenylboronic acid-targeted delivery siNFKBZ gene drug composition

[0407] 1. PBA 10 -siNFKBIZ gene drug composition synthesis and characterization

[0408] The thiol-modified NFKBIZ gene small interfering RNA used in this example was purchased from Suzhou Beixin Biotechnology Co., Ltd. A 12-T sequence was introduced at the 3' end of the sense strand of the small interfering RNA, and 10 phosphorothioate (PS) modifications were made (10PS-siNFKBIZ-

[0409] S), enabling it to couple with the bromoacetyl bromide group modified on 4-bromomethyl-phenylboronic acid (PBA-Br). There is a PS modification on the 10 Ts at the 3′ end extension of the sense strand of siNFKBIZ, which is denoted as -10PS in all the following examples. The specific structure of PS is shown in Formula 63.

[0410]

[0411] Among them, represents the linked nucleic acid molecule.

[0412] The siNFKBIZ gene drug sequence used in this example is as follows:

[0413] Among them, the sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0414] Sense: 5′-GCCCGAUUCGUUGUCUGAU TT *T*T*T*T*T*T*T*T*T*T-3′ (SEQ ID NO: 435); where * represents phosphorothioate modification;

[0415] Antisense: 5′-AUCAGACAACGAAUCGGGCcc-3′ (SEQ ID NO: 433);

[0416] Among them, the sequence of the small interfering RNA (siNFKBIZ-M) targeting the mouse NFKBIZ gene is

[0417] Sense: 5′-GCGUCAAUGUACCAGUAUU TT *T*T*T*T*T*T*T*T*T*T-3′ (SEQ ID NO: 436); where * represents phosphorothioate modification;

[0418] Antisense: 5′-AAUACUGGUACAUUGACGCCU-3′ (SEQ ID NO: 422);

[0419] PBA 10 - The synthesis routes of PS and Br-PBA in the synthesis of siNKKBIZ are as Figure 49 shown:

[0420] Specific synthesis steps: Prepare a 60 mM DMSO solution of 4-bromomethyl-phenylboronic acid, and then react it with 200 μM of 10PS-siNFKBIZ in a metal bath according to a volume ratio of 1:1 at a temperature of 50 °C for 3 h. Then, extract small molecules with ethyl acetate and remove dimethyl sulfoxide by dialysis to obtain the product PBA 10 -siNFKBIZ-S, quantify it and spin-dry. Finally, dissolve PBA 10 -siNFKBIZ-S and siNFKBIZ-A in 1×PBS for base complementary pairing to assemble into PBA 10 -siNKKBIZ. Verify it using non-denaturing 10% polyacrylamide gel, and the results are as Figure 50 shown. The results show that PBA was successfully modified on the siNFKBIZ-S chain and successfully complemented with siNFKBIZ-A.

[0421] 2. Cellular uptake efficiency of the PBA 10 -siNFKBIZ gene drug composition

[0422] Seed HCEC cells at a density of 4.0×10 5 cells per well in a 12-well plate and culture overnight in DMEM. Add PBA 10 -siNFKBIZ-FAM (FAM equivalent concentration 0.5 μM) to the cells and incubate at 37 °C in Opti-MEM for 1 h, 3 h, and 6 h. Use siNFKBIZ-FAM as a control. Collect the cells using trypsin and collect for flow cytometry analysis. The results are as Figure 51 shown. HCEC cells show time-dependence for the PBA 10 -siNFKBIZ-FAM drug composition at 1 h and 3 h, and the uptake amount at 3 h is about 6 times that of the siNFKBIZ-FAM drug. In summary, the above results show that extending PBA modification on one of the strands of the siNFKBIZ gene drug can still enhance the uptake ability of the siNFKBIZ small nucleic acid drug and improve its cell entry effect.

[0423] 3. Regulatory effect of the PBA 10 -siNFKBIZ gene drug composition on the NFKBIZ gene

[0424] According to the standard of 1×10 5 cells / well, seed HCEC cells into a 6-well plate and culture overnight. Then, stimulate with IL-1β for 12 h, wash twice with PBS, and next treat the cells with a solution containing siNFKBIZ and PBA 10Incubate with Opti-MEM medium containing -siNFKBIZ drug composition (equivalent siRNA concentration is 400 nM) for 6 h. After replacing with complete medium, continue culturing for 48 h. Next, extract mRNA, measure the mRNA concentration, reverse transcribe to obtain cDNA, and perform qPCR experiment. The results are as Figure 52 shown. After LPS stimulation, the expression of NFKBIZ gene in HCEC cells was significantly up-regulated to about 1.2 times that of normal cells. PBA 10 -siNFKBIZ drug composition can effectively inhibit the expression of NFKBIZ gene and shows concentration dependence. At a concentration of 400 nM, compared with the LPS-stimulated group, the NFKBIZ gene can be inhibited to about 50%. The above results indicate that PBA 10 -siNFKBIZ drug composition can effectively promote the entry of siNFKBIZ gene drug into cells, thus realizing the regulatory effect on NFKBIZ gene and achieving a good gene inhibition effect.

[0425] 4. Dry eye treatment effect of PBA 10 -siNFKBIZ gene drug composition

[0426] All animal experiments in this example were carried out in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO)'s "Statement on the Use of Animals in Ophthalmic and Vision Research" and complied with relevant operating specifications. All animal experiments were carried out in accordance with the guidelines formulated by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6- to 8-week-old specific pathogen-free (SPF) C57BL / 6 mice (30 eyes) were selected from Shanghai Slack Experimental Animal Co., Ltd. and raised in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 3 groups and exposed to a low-humidity environment (RH = 18.5% ± 5.1%, AF = 15 L / min, T = 21 - 23 °C) for 4 days to adapt. Then, 5 μL of 0.2% benzalkonium chloride was instilled into each eye twice a day for 14 consecutive days to establish a mouse dry eye model. Each group of mice received local instillation of PBS, cyclosporine CsA eye drops (Xingqi Eye Medicine), and PBA 10 -siNFKBIZ-M (equivalent siRNA dose is 0.05 mg / kg) twice a day for 14 consecutive days (once in the morning and once in the evening). Tear secretion was detected and corneal fluorescein sodium staining was evaluated on the 0th, 7th, and 14th days of drug administration, and the specific operations were carried out according to Example 2.

[0427] The results are as Figure 53 shown. After 14 days of treatment, CsA eye drops and PBA 10- The eye injuries in the group with the siNFKBIZ-M pharmaceutical composition all showed obvious changes. In the group administered with CsA, the eye score of the mice decreased from 12 points to about 8 points, and the result of the phenol red cotton thread tear test increased from 2.4 mm to about 3.25 mm; PBA 10 - In the group with the siNFKBIZ-M pharmaceutical composition, the fluorescein sodium score of the mice's eyes decreased from 11 points to about 5.4 points, and the infiltration length of the phenol red cotton thread increased from 2.0 mm to about 3.35 mm. It can be seen from the animal experiment results that compared with the CsA eye drop group, PBA 10 - The siNFKBIZ-M pharmaceutical composition group had a more obvious therapeutic effect on dry eye in mice.

[0428] Example 8

[0429] The pharmaceutical composition of hexaphenylboric acid targeting and delivering the siNFKBIZ gene in the neck ring for the treatment of dry eye

[0430] 1. Synthesis and characterization of the PBA6-siNFKBIZ gene pharmaceutical composition

[0431] In this example, the synthesis route of 2PBA-Br is as Figure 54 shown.

[0432] 1.1 Synthesis of compound 17

[0433] Take compound 8 (776 mg) and compound 16 (200 mg) in a 100 mL flask, add 20 mL of dichloromethane and stir until dissolved. Add EDCI (285 mg) and DMAP (20 mg), and under nitrogen protection, place the reaction at room temperature for 20 h. After the reaction is completed, distill off dichloromethane under reduced pressure, add 30 mL of ethyl acetate, wash it twice with 30 mL of water (pH = 3), twice with 30 mL of saturated sodium bicarbonate solution, and once with 30 mL of saturated sodium chloride solution. After collecting the organic phase, dry it with anhydrous sodium sulfate and distill off the solvent under reduced pressure to obtain a white foam solid, which is directly used for the subsequent reaction.

[0434] 1.2 Synthesis of compound 18

[0435] Take compound 17 in a dry 100 mL round-bottom flask, add 20 mL of acetone and stir until dissolved. Dissolve sodium periodate (852 mg) and ammonium acetate (310 mg) in 20 mL of water and add it to the acetone solution. Under nitrogen protection, place the reaction at room temperature for 10 h. After the reaction is completed, distill off acetone under reduced pressure, add 100 mL of ethyl acetate, wash it twice with 100 mL of water and once with 100 mL of saturated sodium chloride solution. After collecting the organic phase, dry it with anhydrous sodium sulfate and distill off the solvent under reduced pressure to obtain a pale yellow oily liquid. Purify it by reverse-phase column chromatography to obtain 486 mg of white solid, that is, compound 18 is prepared. The two-step yield is about 73%.

[0436] For Compound 18 1 The H NMR spectrum is as follows Figure 55 shown. The solvent used for the NMR spectrum test is DMSO-d6, and the assignments of each proton peak are as follows: 1 H NMR(700MHz, DMSO-d6)δ8.58(t, J = 6.0Hz, 2H), 8.22(s, 4H), 7.87(d, J = 7.7Hz, 4H), 7.81 - 7.74(m, 4H), 7.41(d, J = 7.9Hz, 2H), 7.32(d, J = 8.0Hz, 2H), 5.09(qd, J = 6.4, 3.2Hz, 1H), 5.03(s, 2H), 4.74(s, 2H), 3.58(dt, J = 13.9, 5.5Hz, 2H), 3.42 - 3.39(m, 2H), 2.63 - 2.57(m, 4H). For Compound 18 13 The C NMR spectrum is as follows Figure 56 shown. The solvent used for the NMR spectrum test is DMSO-D6, and the assignments of the characteristic carbons in the product are as follows: 13 C NMR(176MHz, DMSO-d6)δ166.28, 136.87, 134.96, 133.35, 128.32, 127.50, 125.50, 71.05, 64.57, 45.21, 39.44, 38.63, 38.51, 28.29, 28.00.

[0437] 1.3 Preparation of PBA6-siNFKBIZ gene pharmaceutical composition

[0438] The thiol-modified NFKBIZ gene small interfering RNA used in this example was purchased from Suzhou Beixin Biotechnology Co., Ltd. A stem-loop structure was formed at the 3′ end of 16 bases of the sense strand of the small interfering RNA, and a phosphorothioate (PS) modification was used at the loop structure site (3PS-siNFKBIZ-S) to enable it to couple with the bromo group modified on bromo-diphenylboric acid (2PBA-Br).

[0439] The siNFKBIZ gene drug sequence used in this example is as follows:

[0440] Among them, the sequence of the small interfering RNA (siNFKBIZ) targeting the human NFKBIZ gene is

[0441] Sense: 5′-GCCCGAUUCGUUGUCUGAUGCAGCCG*A*A*AGGCUGC-3′(SEQ ID NO: 437);

[0442] Antisense: 5′-AUCAGACAACGAAUCGGGCcc-3′ (SEQ ID NO: 433);

[0443] The sequence of the small interfering RNA (siNFKBIZ-M) targeting the mouse NFKBIZ gene is

[0444] Sense: 5′-GCGUCAAUGUACCAGUAUUGCAGCCG*A*A*AGGCUGC-3′ (SEQ ID NO: 438):

[0445] Antisense: 5′-AAUACUGGUACAUUGACGCCU-3′ (SEQ ID NO: 422);

[0446] The synthetic route of PBA6-siNKKBIZ is as Figure 57 shown.

[0447] Specific synthesis steps: Take compound 18 to prepare a 20 mM DMSO solution, and then react with 200 μM of 3PS-siNFKBIZ in a metal bath according to a volume ratio of 1:1. React at 50 °C for 3 h. Then extract and remove small molecules with ethyl acetate, and remove dimethyl sulfoxide by dialysis to obtain the product PBA6-siNFKBIZ-S. Next, quantify and spin dry. Finally, base pair PBA6-siNFKBIZ-S with siNFKBIZ-A in 1×PBS to assemble PBA6-siNKKBIZ. Verify using non-denaturing 20% polyacrylamide gel, and the results are as Figure 58 shown, and the results show that PBA is successfully modified on the siNFKBIZ-S chain and successfully complementary to siNFKBIZ-A.

[0448] 2. Cellular uptake efficiency of the PBA6-siNFKBIZ gene drug composition

[0449] Seed HCEC cells at a density of 4×10 4 cells per well in a 24-well culture plate. Place a clean coverslip in each well and culture overnight. Subsequently, co-culture with PBA6-siNFKBIZ-FAM and siRNA-FAM (equivalent FAM concentration: 0.5 μM) for 4 h. Then remove the culture medium, wash 3 times with PBS, and fix with 4% paraformaldehyde at room temperature for 15 min. Then, stain with DAPI for 15 min, wash with PBS, and observe using a laser confocal microscope. The results are as Figure 59 shown in A below. The green fluorescence of cells in the PBA6-siNFKBIZ-FAM group is significantly higher than that in the FAM-modified siNFKBIZ-FAM group.

[0450] Seed HCEC cells at a density of 4.0×10 5 cells per well in a 12-well plate and culture overnight in DMEM. Add PBA6-siNFKBIZ-FAM to the cells at a concentration of 0.5 μM per well of FAM concentration and incubate at 37 °C for 6 h in Opti-MEM. Use siNFKBIZ-FAM as a control. Collect the cells using trypsin and collect for flow cytometry analysis. The results are as Figure 59 shown in B. The uptake of PBA6-siNFKBIZ-FAM by HCEC cells is approximately 3.2 times that of the drug uptake of siNFKBIZ-FAM. In summary, the above results indicate that PBA modification on the stem-loop structure of the siNFKBIZ gene drug can enhance the uptake ability of the siNFKBIZ small nucleic acid drug and improve its cellular uptake effect.

[0451] 3. Regulatory effect of the PBA6-siNFKBIZ gene drug composition on the NFKBIZ gene

[0452] Seed HCEC cells into a 6-well plate at a standard of 1×10 5 cells / well and culture overnight. Then, after stimulating with IL-1β for 12 h, wash twice with PBS. Next, incubate the cells with Opti-MEM medium containing siNFKBIZ and the PBA6-siNFKBIZ drug composition for 6 h. After changing to complete medium, continue to culture for 48 h. Next, extract mRNA, measure the mRNA concentration, reverse transcribe to obtain cDNA, and perform qPCR experiments. The results are as Figure 60 shown in A. After stimulation with IL-1β, the expression of the NFKBIZ gene in HCEC cells was significantly upregulated to about 1.5 times that of normal cells. The PBA6-siNFKBIZ gene drug composition can effectively inhibit the expression of the NFKBIZ gene and can effectively inhibit it to about 50%.

[0453] Seed HCEC cells into a 6-well plate at a standard of 1×10 5 cells / well and culture overnight. Then, after stimulating with IL-1β for 12 h, wash twice with PBS. Next, incubate the cells with Opti-MEM medium containing different concentrations of the PBA6-siNFKBIZ drug composition for 6 h. After changing to complete medium, continue to culture for 48 h. Extract total protein from the cells using RIPA buffer containing a protease inhibitor mixture, measure the protein concentration, and perform Western-blot experiments. The results are as Figure 60As shown in B, the inhibitory ability of the PBA6-siNFKBIZ gene pharmaceutical composition on IκBζ protein is concentration-dependent, and it can effectively inhibit protein expression at a concentration of 500 nM. The above results indicate that the modification of the end of the stem-loop structure by PBA can effectively promote the entry of the siNFKBIZ gene pharmaceutical into cells, thereby realizing the regulatory effect of the NFKBIZ gene, inhibiting the expression of IκBζ protein, and achieving better anti-inflammatory effects.

[0454] 4. Dry eye treatment effect of the PBA6-siNFKBIZ gene pharmaceutical composition

[0455] All animal experiments in this example were conducted in accordance with the guidelines of the Association for Research in Vision and Ophthalmology (ARVO)'s "Statement on the Use of Animals in Ophthalmic and Vision Research" and complied with relevant operating specifications. All animal experiments were carried out in accordance with the guidelines formulated by the Ethics Committee of Shanghai Jiao Tong University. In this example, 15 6- to 8-week-old specific pathogen-free (SPF)-level C57BL / 6 mice (30 eyes) were selected from Shanghai Slack Experimental Animal Co., Ltd. and housed in an environmentally controlled room with sufficient mouse food and water. The mice were randomly divided into 3 groups and exposed to a low-humidity environment (RH = 18.5% ± 5.1%, AF = 15 L / min, T = 21 - 23°C) for 4 days to adapt. Then, 5 μL of 0.2% benzalkonium chloride was instilled into each eye twice a day for 14 consecutive days to establish a mouse dry eye model. The eyes of each group of mice were locally instilled with PBS, cyclosporine CsA eye drops (Xingqi Eye Medicine), and PBA6-siNFKBIZ (equivalent siRNA dose of 0.05 mg / kg) twice a day for 14 consecutive days (once in the morning and once in the evening). Tear secretion was detected and corneal fluorescein sodium staining was evaluated on the 0th, 7th, and 14th days of drug administration, and the specific operations were carried out according to Example 2.

[0456] The results are as Figure 61 shown. After 14 days of treatment, obvious changes occurred in the eye injuries in both the CsA eye drop and PBA6-siNFKBIZ pharmaceutical composition groups. The eye score of the mice in the CsA administration group decreased from 11 points to about 6 points, and the result of the phenol red thread tear test increased from 2.1 mm to about 4.5 mm; the fluorescein sodium score of the mice in the PBA6-siNFKBIZ pharmaceutical composition group decreased from 11 points to about 4 points, and the infiltration length of the phenol red thread increased from 2.6 mm to 5.6 mm. It can be seen from the results of the animal experiment that, compared with the control group and the CsA eye drop group, the PBA6-siNFKBIZ pharmaceutical composition group has a more obvious therapeutic effect on dry eye in mice.

[0457] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A pharmaceutical composition for inhibiting the expression of the NFKBIZ gene, characterized in that, Composed of a nucleic acid molecule that inhibits the expression of the NFKBIZ gene and a targeting ligand molecule that targets an ocular tissue-specific protein; The targeting ligand molecule is a nucleic acid aptamer that targets an ocular tissue-specific protein; The ocular tissue-specific protein is at least one of the following: mucin MUC-1, MUC-16, integrin α V β3, and CD44; The nucleotide sequence of the nucleic acid aptamer targeting MUC-1 is shown in SEQ ID NO: 423; The nucleotide sequence of the nucleic acid aptamer targeting MUC-16 is shown in SEQ ID NO: 424; Targeting integrin α V The nucleotide sequence of the nucleic acid aptamer targeting β3 is shown as SEQ ID NO: 425; The nucleotide sequence of the nucleic acid aptamer targeting CD44 is shown in SEQ ID NO: 426; The nucleic acid aptamer that targets an ocular tissue-specific protein is directly covalently coupled to the end of the nucleic acid molecule or covalently coupled to the nucleic acid molecule through an extension sequence linked to the end of the nucleic acid molecule; The nucleic acid molecule is a double-stranded nucleic acid molecule composed of a sense strand and an antisense strand; The nucleic acid molecule includes at least one of the following nucleotide sequences: The sense strand of the nucleic acid molecule is selected from at least one of the following numbered nucleotide sequences: SEQ ID NO: 1 to SEQ ID NO: 18, SEQ ID NO: 25 to SEQ ID NO: 49, SEQ ID NO: 51 to SEQ ID NO: 89, SEQ ID NO: 93 to SEQ ID NO: 108, SEQ ID NO: 113 to SEQ ID NO: 132, SEQ ID NO: 134 to SEQ ID NO: 135, SEQ ID NO: 138, SEQ ID NO: 143 to SEQ ID NO: 152, SEQ ID NO: 154 to SEQ ID NO: 161, SEQ ID NO: 169 to SEQ ID NO: 185, and SEQ ID NO: 421; The antisense strand of the nucleic acid molecule is selected from at least one of the following numbered nucleotide sequences: SEQ ID NO: 211 to SEQ ID NO: 228, SEQ ID NO: 235 to SEQ ID NO: 259, SEQ ID NO: 261 to SEQ ID NO: 299, SEQ ID NO: 303 to SEQ ID NO: 318, SEQ ID NO: 323 to SEQ ID NO: 342, SEQ ID NO: 344 to SEQ ID NO: 345, SEQ ID NO: 348, SEQ ID NO: 353 to SEQ ID NO: 362, SEQ ID NO: 364 to SEQ ID NO: 371, SEQ ID NO: 379 to SEQ ID NO: 395, and SEQ ID NO:

422.

2. The pharmaceutical composition according to claim 1, wherein A hanging single strand is also provided at the end of the sense strand or antisense strand of the nucleic acid molecule.

3. The pharmaceutical composition according to claim 2, wherein The length of the hanging single strand is 1 to 3 nt.

4. The pharmaceutical composition according to any one of claims 1 to 3, wherein The nucleic acid molecule comprises any one or more of the following modified nucleotides: deoxynucleotide, 3'-terminal deoxythymidine nucleotide, 2'-O-methyl modified nucleotide, 2'-fluoro modified nucleotide, 2'-deoxy modified nucleotide, locked nucleic acid, conformationally restricted nucleotide, constrained ethyl nucleotide, abasic nucleotide, 2'-amino modified nucleotide, 2'-O-allyl modified nucleotide, 2'-C-alkyl modified nucleotide, 2'-hydroxy modified nucleotide, 2'-methoxyethyl modified nucleotide, 2'-O-alkyl modified nucleotide, morpholino nucleotide, phosphoramidate, nucleotide containing unnatural base, tetrahydropyran modified nucleotide, 1,5-anhydrohexitol modified nucleotide, cyclohexenyl modified nucleotide, nucleotide containing phosphorothioate group, nucleotide containing methylphosphonate group, nucleotide containing 5'-phosphate, and nucleotide containing 5'-phosphate mimic.

5. The pharmaceutical composition according to claim 1, wherein The nucleic acid aptamer further includes a nucleic acid aptamer modified with enhanced stability; The enhanced stability modification includes at least one of the following: phosphorothioate backbone modification, 2'-O-methyl modification, 2'-methoxyethyl modification, 2'-fluoro modification, reverse thymidine modification, deoxythymidine nucleotide, and polyethylene glycol terminal conjugation.

6. The pharmaceutical composition according to claim 1, wherein The phosphate group of the nucleic acid aptamer is covalently coupled to the ribose of the nucleic acid molecule.

7. The pharmaceutical composition according to claim 1, wherein The extension sequence includes an extension sequence connected only at one end to the end of the nucleic acid molecule and / or an extension sequence that forms a stem-loop structure in a form where one end is connected to the 3'-end of one strand of the nucleic acid molecule while the other end is connected or not connected to the 5'-end of the complementary strand of the nucleic acid molecule.

8. The pharmaceutical composition according to claim 7, wherein The length of the extension sequence is 1 - 40 nt; the extension sequence is a random nucleotide sequence.

9. The pharmaceutical composition according to claim 8, wherein The phosphate group of the nucleic acid aptamer is covalently coupled to the ribose of the extension sequence.

10. Use of the pharmaceutical composition according to any one of claims 1 to 9 in the preparation of a medicament for preventing and / or treating eye diseases.

11. The application according to claim 10, characterized in that, The eye diseases include one or more of the following: dry eye, keratitis, conjunctivitis, and blepharitis.

Citation Information

Patent Citations

  • Small molecule drug-oligonucleotide conjugate and application thereof

    CN115282283A