CAPS molecular marker for screening grain length gene in promoter region of rice pGL12 and its application

Abstract

The invention discloses a CAPS molecular marker of a rice grain length pGL12 promoter region and an application thereof. The primer sequences of the CAPS molecular marker are shown as pGL12-F and pGL12-R. The invention can quickly screen the rice pGL12 promoter region grain length gene, which helps to improve the current situation of much field work and heavy workload caused by using population materials for a large number of grain type tests and identifications, and has important theoretical and practical significance for breeding new rice varieties with long-grain traits.

Description

Technical Field

[0001] The invention relates to the technical field of rice variety screening, in particular to a CAPS molecular marker for screening a grain length gene in a promoter region of rice pGL12 and an application thereof. Background Art

[0002] Rice is one of the world's important food crops. There is an urgent need to cultivate high-yield and high-quality rice varieties to meet people's growing demand. At present, many scholars have located and cloned multiple major QTLs related to rice grain length using different rice populations such as natural populations, F2:3, CSSLs, and RILs. However, there are few grain length and yield genes cloned and used from wild rice, but there are few reports on how to identify and obtain the genes of the pGL12 promoter of wild rice. Summary of the invention

[0003] In order to achieve the above object, the present invention provides the following technical solutions:

[0004] The invention provides a CAPS molecular marker for screening a grain length gene in a promoter region of rice pGL12. A specific primer pair of the CAPS molecular marker can amplify a band of 1536 bp in rice genomic DNA. After the rice amplified band containing the grain length gene in the promoter region of pGL12 is digested with restriction endonuclease Age I, two bands of 818 bp and 718 bp are obtained. After the rice amplified band not containing the grain length gene in the promoter region of pGL12 is digested with restriction endonuclease Age I, only one band of 1536 bp is obtained. After the rice amplified band containing the grain length gene in the promoter region of pGL12 is digested with restriction endonuclease BspE I, two bands of 1168 bp and 368 bp are obtained. After the rice amplified band not containing the grain length gene in the promoter region of pGL12 is digested with restriction endonuclease BspE I, only one band of 1536 bp is obtained.

[0005] Furthermore, the CAPS molecular marker of the present invention is obtained by amplification using the following specific primer pairs:

[0006] Upstream primer pGL12-F: ATCCTCTTGTCTTGCTGTCC;

[0007] Downstream primer pGL12-R: TCAGGCAGAATGGAGGGTAGAAT.

[0008] The present invention provides a specific primer pair for screening the CAPS molecular marker of the grain length gene in the promoter region of rice pGL12, comprising the following primer sequences:

[0009] Upstream primer pGL12-F: ATCCTCTTGTCTTGCTGTCC;

[0010] Downstream primer pGL12-R: TCAGGCAGAATGGAGGGTAGAAT.

[0011] The invention provides application of CAPS molecular marker in screening long-grain rice varieties.

[0012] The present invention provides a method for screening rice pGL12 promoter region grain length gene using CAPS molecular markers, comprising the following steps:

[0013] (1) Extracting genomic DNA from the rice to be tested;

[0014] (2) Using the genomic DNA of the rice to be tested as a template, PCR amplification was performed using the upstream primer pGL12-F and the downstream primer pGL12-R;

[0015] (3) The PCR amplification product is digested with restriction endonucleases, and the digestion products are typed by agarose gel electrophoresis. The electrophoresis bands are used to determine whether the product contains the plasmid gene fragment.

[0016] Furthermore, the PCR amplification system described in step (2) is: 25 μL of 10× buffer, 10 μL of 2.5 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD enzyme, 100 ng of the sample DNA to be tested, and water is added to 50 μL.

[0017] Furthermore, the PCR amplification program described in step (2) is: pre-denaturation at 98°C for 5 min; pre-denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 68°C for 2.5 min, 33 cycles; extension at 68°C for 5 min.

[0018] Furthermore, in step (3), restriction endonuclease Age Ⅰ was used for digestion, and the digestion product contained two main bands of 818 bp and 718 bp, then the promoter region of the rice pGL12 to be tested contained the grain length gene; the digestion product contained only one main band of 1536 bp, then the promoter region of the rice pGL12 to be tested did not contain the grain length gene.

[0019] Furthermore, in step (3), restriction endonuclease BspE Ⅰ is used for enzyme digestion, and the digestion product contains two main bands of 1168 bp and 368 bp, then the promoter region of the rice pGL12 to be tested contains the grain length gene; if the digestion product has only one main band of 1536 bp, then the promoter region of the rice pGL12 to be tested does not contain the grain length gene.

[0020] The beneficial effects of the present invention are as follows: by using the CAPS marker to detect the genotype of the pGL12 promoter of different individual plants, rice varieties improved by using the wild rice pGL12 gene can be rapidly bred, which helps to improve the current situation of much field work and heavy workload caused by using group materials for a large number of grain type tests and identifications, and has important theoretical and practical significance for breeding new rice varieties with long-grain traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is the result of phenotypic comparison between 9311 and NIL141;

[0022] Figure 2 is the restriction electrophoresis diagram of the rice pGL12 promoter fragment CAPS-labeled Age Ⅰ in Example 1;

[0023] Figure 3 This is the electrophoresis diagram of the enzyme digestion of the rice pGL12 promoter fragment CAPS-labeled BspE Ⅰ in Example 2. DETAILED DESCRIPTION

[0024] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] Example 1: Development of CAPS Molecular Markers

[0026] A wild rice chromosome segment substitution line (CSSL) population consisting of 214 individuals was constructed using common wild rice as the donor parent and cultivated rice 9311 as the recipient parent. The grain shape data of the 214 populations were analyzed and statistically analyzed, among which the grain length of CSSL141 was significantly longer than that of 9311. Multiple backcrosses were performed between CSSL141 and 9311, and finally the long-grain NIL141 substitution individual ( Figure 1 ).

[0027] The results of sequencing the promoter of gene GL12 of 9311 and NIL141 showed that there were two restriction endonuclease sites at 818bp and 1168bp in the promoter of GL12 of NIL141, namely BspE Ⅰ and Age Ⅰ. The target region was amplified using primers in the promoter region, and CAPS markers were developed for the two target regions to distinguish long-grain genotypes from short-grain genotypes. The upstream primer pGL12-F: ATCCTCTTGTCTTGCTGTCC; the downstream primer pGL12-R: TCAGGCAGAATGGAGGGTAGAAT.

[0028] Example 2: Validation of CAPS molecular markers for identifying rice grain length traits

[0029] (1) Extracting genomic DNA from the rice to be tested;

[0030] (2) Using the genomic DNA of the rice to be tested as a template, PCR amplification was performed using the upstream primer pGL12-F and the downstream primer pGL12-R. The PCR amplification reaction system of 50 μL was as follows: 25 μL of 10× buffer, 10 μL of 2.5 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD enzyme, 100 ng of the sample DNA to be tested, and water was added to 50 μL. The PCR amplification program was as follows: pre-denaturation at 98°C for 5 min; pre-denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 68°C for 2.5 min, 33 cycles; extension at 68°C for 5 min;

[0031] (3) The PCR amplification product was digested with restriction endonuclease Age Ⅰ, and the digestion product was typed by agarose gel electrophoresis. The digestion system was: 1 μg of PCR product, 1 μL of BspE Ⅰ, 5 μL of 10×rCutSmart Buffer, and sterile water was added to 50 μL; the digestion condition was incubation at 37℃ for 15 min.

[0032] Identification results: After electrophoresis of the pGL12 promoter fragment, two bands of 818 bp and 718 bp were obtained, which was NIL141, and only one main band of 1536 bp was obtained, which was 9311 ( Figure 2 ), and the molecular identification results of the grain lengths of the two rice varieties were consistent with the phenotypic results, indicating that the identification procedure of the present invention is simple and has a wide range of applications.

[0033] Example 3: Validation of CAPS molecular markers for identifying rice grain length traits

[0034] (1) Extracting genomic DNA from the rice to be tested;

[0035] (2) Using the genomic DNA of the rice to be tested as a template, PCR amplification was performed using the upstream primer pGL12-F and the downstream primer pGL12-R. The PCR amplification reaction system of 50 μL was as follows: 25 μL of 10× buffer, 10 μL of 2.5 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD enzyme, 100 ng of the sample DNA to be tested, and water was added to 50 μL. The PCR amplification program was as follows: pre-denaturation at 98°C for 5 min; pre-denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 68°C for 2.5 min, 33 cycles; extension at 68°C for 5 min;

[0036] (3) The PCR amplification product was digested with restriction endonuclease BspE Ⅰ, and the digestion product was typed by agarose gel electrophoresis. The digestion system was: 1 μg of PCR product, 1 μL of BspE Ⅰ, 5 μL of 10×rCutSmart Buffer, and sterile water was added to 50 μL; the digestion condition was incubation at 37℃ for 15 min.

[0037] Identification results: After electrophoresis of the pGL12 promoter fragment, two bands of 1168 bp and 368 bp were obtained, which was NIL141, and only one main band of 1536 bp was obtained, which was 9311 ( Figure 3 ), and the molecular identification results of the two rice grain types were consistent with the grain length phenotype results, indicating that the identification accuracy of the present invention is high.

[0038] The present invention uses specific embodiments to illustrate the principles and implementation methods of the present invention. The description of the above embodiments is only used to help understand the method of the present invention and its core idea. At the same time, for those skilled in the art, according to the idea of ​​the present invention, there will be changes in the scope of the specific implementation methods. In summary, the content of this specification should not be understood as limiting the present invention.

Claims

1. Application of CAPS molecular marker in rice pGL12 promoter region in screening long-grain rice varieties, characterized in that: The upstream primer sequence of the specific primer pair for amplifying the CAPS molecular marker is shown in pGL12-F, and the downstream primer sequence is shown in pGL12-R; the upstream primer pGL12-F: ATCCTCTTGTCTTGCTGTCC; the downstream primer pGL12-R: TCAGGCAGAATGGAGGGTAGAAT; the specific primer pair for amplifying the CAPS molecular marker can amplify an electrophoresis band of 1536 bp in rice genomic DNA, and the rice amplification product containing the long-grain gene fragment in the promoter region of pGL12 is digested with the restriction endonuclease AgeⅠ to obtain two electrophoresis bands of 818 bp and 718 bp, and pGL After the rice amplification product whose promoter region does not contain the long-grain gene fragment is digested with the restriction endonuclease AgeⅠ, only one electrophoresis band of 1536bp is obtained; after the rice amplification product whose promoter region contains the long-grain gene fragment is digested with the restriction endonuclease BspEⅠ, two electrophoresis bands of 1168bp and 368bp are obtained; after the rice amplification product whose promoter region does not contain the long-grain gene fragment is digested with the restriction endonuclease BspEⅠ, only one electrophoresis band of 1536bp is obtained; the rice varieties are wild rice, cultivated rice 9311, and a wild rice chromosome fragment replacement line population constructed with wild rice as a donor parent and cultivated rice 9311 as a recipient parent.

2. The method for screening long-grain gene fragments in the promoter region of rice pGL12 using CAPS molecular markers according to claim 1, characterized in that: The following steps are included: (1) extracting genomic DNA of rice to be tested; (2) using the genomic DNA of the rice to be tested as a template, and performing PCR amplification using the upstream primer pGL12-F and the downstream primer pGL12-R; (3) The PCR amplification product is digested with restriction endonucleases, and the digestion product is typed by agarose gel electrophoresis. The electrophoresis bands are used to determine whether it contains long-grain gene fragments; In step (3), restriction endonuclease AgeⅠ is used for enzyme digestion. If the digestion product contains two main bands of 818 bp and 718 bp, the promoter region of the rice pGL12 to be tested contains the long-grain gene fragment; if the digestion product contains only one main band of 1536 bp, the promoter region of the rice pGL12 to be tested does not contain the long-grain gene fragment; In step (3), restriction endonuclease BspEⅠ is used for enzyme digestion. If the digestion product contains two main bands of 1168 bp and 368 bp, the promoter region of the rice pGL12 to be tested contains the long-grain gene fragment; if the digestion product contains only one main band of 1536 bp, the promoter region of the rice pGL12 to be tested does not contain the long-grain gene fragment; The rice includes wild rice, cultivated rice 9311, and a wild rice chromosome segment replacement line population constructed with wild rice as a donor parent and cultivated rice 9311 as a recipient parent.

3. The method according to claim 2, characterized in that The PCR amplification system described in step (2) is: 25 μL of 10× buffer, 10 μL of 2.5 mM dNTPs, 1.5 μL of 10 pmol / μL primer pair, 1 μL of KOD enzyme, 100 ng of the sample DNA to be tested, and water is added to 50 μL.

4. The method according to claim 2, characterized in that: The PCR amplification program described in step (2) is: pre-denaturation at 98°C for 5 min; pre-denaturation at 98°C for 10 s, annealing at 58°C for 30 s, extension at 68°C for 2.5 min, 33 cycles; extension at 68°C for 5 min.

Images