Screening of FSH-responsive genes in sheep follicular granulosa cells based on sheep whole genome CRISPR-Cas9 knockout library

Abstract

The present invention provides a method for screening FSH response genes in sheep follicle granulosa cells based on a sheep whole genome CRISPR-Cas9 knockout library, and belongs to the field of genetic bioengineering technology. The present invention designs sgRNA probes for sheep whole genome coding genes, and constructs a sheep whole genome CRISPR-Cas9sgRNA library, focusing on knocking out sheep follicle granulosa cells with CRISPR-Cas9sgRNA libraries of sheep chromosomes 2, 3 and X coding genes, and constructs a specific knockout cell library of three chromosomes. Based on the cell knockout library, genes related to the action of FSH can be screened, and combined with transcriptome sequencing, the dose-dependent genes of FSH promoting the proliferation of granulosa cells are further explored.

Description

Technical Field

[0001] The invention belongs to the technical field of gene bioengineering, and particularly relates to screening of sheep follicular granulosa cell FSH response genes based on a sheep whole genome CRISPR-Cas9 knockout library. Background Art

[0002] Sheep are one of the important livestock, and their reproductive traits directly affect important economic traits such as meat and wool yield and quality. However, traditional breeding methods have certain limitations in improving sheep reproductive traits. Therefore, studying the genomic characteristics of sheep reproductive traits is of great significance for a deeper understanding of their genetic mechanisms and improving the efficiency of reproductive traits. Sheep have become important economic animals in the agricultural field because of their suitable body shape, tolerance to roughage, and short gestation period. They are also important model animals in pharmaceutical and biomedical research.

[0003] The development of ovarian follicles is mainly regulated by follicle-stimulating hormone (FSH) and luteinizing hormone (LH) released by the pituitary gland. LH and FSH are transmitted to the ovaries through the blood circulation. LH acts on the LHR receptor to stimulate theca cells to secrete androgens, while FSH acts on the granulosa cells (GCs) receptor FSHR to regulate the conversion of androgens to estrogens, thereby causing a surge in hormones secreted by mature follicles, leading to an increase in LH concentration, prompting follicle rupture and release of mature oocytes, and FSH regulates gene expression in cells and tissues by activating multiple signaling pathways. Gene expression in GCs under FSH stimulation is very complex, requiring the activation of many transcription factors and the inhibition of transcriptional repressors. FSH regulates the expression of at least 500 target genes in GCs, and the expression of these genes drives the development of follicles, enabling them to respond to the surge of LH, promote ovulation, oocyte maturation and corpus luteum formation, and thus support fertilization and embryonic development after implantation. Therefore, FSH regulates follicle development through a specific gene expression program and is widely used in assisted reproductive technology.

[0004] CRISPR / Cas9 is a precise and efficient gene editing tool that can be rapidly and widely used to study gene function and improve economically important traits such as muscle mass, fiber length, coat color, fat color, and litter size. CRISPR-Cas9 technology has been successfully used in sheep, goats, and cattle to introduce various types of modifications, such as gene knockout, multiple gene knockout, gene knock-in, point mutation of DNA oligonucleotide templates, and single nucleotide changes of base editors. Using CRISPR-Cas9-mediated multiple gene editing, multiple genes and multiple traits can be precisely targeted simultaneously to avoid negative additive effects. Whole-genome CRISPR-Cas9 gene knockout technology has been applied to species such as humans or mice. However, the above applications require the construction of stable cell lines expressing Cas9 in advance, and the operation process is complicated. At present, there is no whole-genome knockout library for sheep, nor is there any record of constructing a knockout library with the gene encoding the Cas9 enzyme and sgRNA in the same vector. Summary of the invention

[0005] The present invention provides a method for screening FSH response genes in sheep follicular granulosa cells based on a sheep whole genome CRISPR-Cas9 knockout library, wherein a gene encoding a Cas9 enzyme and sgRNA are co-constructed in the same vector, sgRNA is designed for a large number of sheep genes, a CRISPR-Cas9 knockout library is constructed to knock out sheep follicular granulosa cells, and FSH response genes are screened from GCs knockout cells.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0007] The invention provides a sheep FSH response gene knockout screening library, comprising an sgRNA expression plasmid targeting an FSH dose-dependent gene, wherein the targeted FSH dose-dependent gene comprises a ZNF367 gene, a CLK1 gene, a PRUNE2 gene, a TMEM37 gene, an ACTG2 gene, a MB gene, an ADIPOR2 gene, a HK2 gene, a VDR gene, an AGPAT2 gene, an EPS8 gene, a FOXO4 gene, and a TSC22D3 gene; sgRNA sequences targeting the ZNF367 gene, the CLK1 gene, the PRUNE2 gene, the TMEM37 gene, the ACTG2 gene, the MB gene, the ADIPOR2 gene, the HK2 gene, the VDR gene, the AGPAT2 gene, the EPS8 gene, the FOXO4 gene, and the TSC22D3 gene are shown in SEQ ID NOs. 1-52, respectively, wherein each gene corresponds to 4 sgRNA sequences.

[0008] The present invention also provides a method for constructing a sheep FSH response gene knockout screening library, comprising the following steps: designing and synthesizing sgRNA for sheep chromosome 2, chromosome 3 and chromosome X genes, amplifying the synthesized sgRNA with a high-fidelity enzyme, recovering the amplified product, connecting the amplified product with a CRISPR_Cas9 lentiviral expression vector, transforming Trans1-T1 competent cells after connection, extracting plasmids, and obtaining a sgRNA expression plasmid library targeting specific chromosomes.

[0009] Preferably, the sgRNA design principles include: the sgRNA length is designed to be 20 nt and the target gene site contains a PAM of NGG, close to the start codon ATG, and a GC content range of 40% to 60%.

[0010] The present invention also provides a method for constructing sheep follicle granulosa knockout cells, comprising the following steps: packaging the sgRNA expression plasmid library constructed by the construction method with a lentivirus to obtain a recombinant lentivirus; infecting sheep follicle granulosa cells with the recombinant lentivirus, screening and culturing with a culture medium containing puromycin for 6 to 8 days, and obtaining a sheep follicle granulosa knockout cell library.

[0011] Preferably, the sheep follicle granulosa cells are cells isolated from fresh sheep ovarian tissue and cultured for 1 to 3 generations.

[0012] The present invention also provides a method for screening sheep FSH response genes, comprising the following steps: culturing the sheep follicle granule knockout cell bank with a complete medium containing 5-15 ng / mL FSH, collecting the cultured cells; extracting DNA of the cultured cells, PCR amplification, gel recovery and purification, and performing second-generation sequencing on the purified products; performing sequence comparison analysis on the second-generation sequencing data and the sgRNA expression plasmid library obtained by the construction method, counting and standardizing the sgRNA enrichment number, and screening to obtain a total of 499 positively screened target genes and 337 negatively screened target genes in chromosome 2, chromosome 3 and chromosome X; culturing GCs with medium containing different concentrations of FSH, and performing transcriptome sequencing; performing STEM analysis on the 836 genes obtained by the positive and negative screening and the transcriptome sequencing data, and screening out 13 FSH dose-dependent genes.

[0013] Preferably, the primers involved in the PCR amplification include sgRNA-F and sgRNA-R, and the nucleotide sequences are shown in SEQ ID Nos. 53 to 54.

[0014] Preferably, the reaction system for PCR amplification includes: a total reaction volume of 50 μL, 25 μL of 2x Taq Plus MasterMix, 2 μL of sgRNA-F, 2 μL of sgRNA-R, 4 μL of genomic DNA, and water is added to 50 μL.

[0015] Preferably, the reaction procedure of the PCR amplification includes: 95°C for 5 min, 95°C for 30 sec, 55°C for 30 sec, 72°C for 20 sec, 72°C for 7 min, 40 cycles, 4°C infinity.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention proposes for the first time to screen FSH response genes in sheep follicular granulosa cells based on a sheep whole genome CRISPR-Cas9 knockout library, construct the Cas9 enzyme encoding gene and sgRNA together in the same vector, knock out sheep follicular granulosa cells by whole genome CRISPR-Cas9 editing technology, extract total genomic DNA of knockout cells, analyze sgRNA information by PCR, and screen 499 FSH resistance target genes and 337 FSH sensitive target genes from chromosomes 2, 3 and X. GCs were cultured with medium containing different concentrations of FSH, and transcriptome sequencing was performed. The 836 genes obtained by positive and negative screening were jointly analyzed with transcriptome sequencing data to screen out 13 FSH dose-dependent genes.

[0018] The present invention also proposes for the first time a sheep FSH response gene knockout screening library, which includes sgRNA expression plasmids targeting FSH dose-dependent genes, wherein the sgRNA sequences targeting the ZNF367 gene, CLK1 gene, PRUNE2 gene, TMEM37 gene, ACTG2 gene, MB gene, ADIPOR2 gene, HK2 gene, VDR gene, AGPAT2 gene, EPS8 gene, FOXO4 gene, and TSC22D3 gene are shown in SEQ ID NO.1-52, respectively, wherein each gene corresponds to 4 sgRNA sequences. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Lenti-CRISPR.v2 vector map.

[0020] Figure 2 sgRNA read distribution and frequency.

[0021] Figure 3 The CCK8 method was used to observe the effects of different concentrations of FSH on the proliferation of granulosa cells.

[0022] Figure 4PCR amplification of sgRNAs.

[0023] Figure 5 Virus infection screening and microscopic examination of GCs knockout cell library.

[0024] Figure 6 sgRNA sequencing alignment rate of GCs-specific chromosome knockout cell library.

[0025] Figure 7 Cluster heatmap of the number of genes in positive and negative screening and the top 20 enriched terms.

[0026] Figure 8 The number of differentially expressed genes in the transcriptome of different doses of FSH.

[0027] Fig. 9 Figure 3 FSH dose-dependent gene expression pattern. DETAILED DESCRIPTION

[0028] The invention provides a sheep FSH response gene knockout screening library, comprising a sgRNA expression plasmid targeting FSH dose-dependent genes, wherein the targeted FSH dose-dependent genes include ZNF367 gene, CLK1 gene, PRUNE2 gene, TMEM37 gene, ACTG2 gene, MB gene, ADIPOR2 gene, HK2 gene, VDR gene, AGPAT2 gene, EPS8 gene, FOXO4 gene and TSC22D3 gene. The sgRNA sequence of the ZNF367 gene of the present invention is shown in SEQ ID NOs.1-4, the sgRNA sequence of the CLK1 gene is shown in SEQ ID NOs.5-8, the sgRNA sequence of the PRUNE2 gene is shown in SEQ ID NOs.9-12, the sgRNA sequence of the TMEM37 gene is shown in SEQ ID NOs.13-16, the sgRNA sequence of the ACTG2 gene is shown in SEQ ID NOs.17-20, the sgRNA sequence of the MB gene is shown in SEQ ID NOs.21-24, the sgRNA sequence of the ADIPOR2 gene is shown in SEQ ID NOs.25-28, the sgRNA sequence of the HK2 gene is shown in SEQ ID NOs.29-32, the sgRNA sequence of the VDR gene is shown in SEQ ID NOs.33-36, the sgRNA sequence of the AGPAT2 gene is shown in SEQ ID NOs.37-40, and the sgRNA sequence of the EPS8 gene is shown in SEQ ID NOs. NO.41-44, the sgRNA sequence of the FOXO4 gene is shown in SEQ ID NO.45-48, and the sgRNA sequence of the TSC22D3 gene is shown in SEQ ID NO.49-52. The genes of the present invention can be used as an important research candidate gene set, laying a foundation for studying the mechanism of gonadotropin regulating follicle development, and making an important contribution to the discovery of new sheep reproduction genes.

[0029] The present invention also provides a method for constructing a sheep FSH response gene knockout screening library, comprising the following steps: designing and synthesizing sgRNA for chromosome 2, chromosome 3 and chromosome X genes of sheep, amplifying the synthesized sgRNA with a high-fidelity enzyme, recovering the amplified product, connecting the amplified product with a CRISPR_Cas9 lentiviral expression vector, transforming Trans1-T1 competent cells after connection, extracting plasmids, and obtaining a sgRNA expression plasmid library targeting specific chromosomes.

[0030] In the present invention, the sgRNA design principles include: the sgRNA length is designed to be 20nt and the target gene site contains PAM as NGG, close to the start codon ATG, and the GC content range is 40% to 60%. In the sgRNA design, the present invention examines 3 base mismatches in the genome off-target assessment, and is the only sgRNA that exists on the genome, does not contain 1 and 2 base mismatch off-target sites, and has the least off-target sites; sgRNACas9 online software is used to design and search for sgRNAs with higher specificity as candidate sgRNAs, and 2000 sgRNAs without targets are designed as negative controls. In addition to housekeeping genes and genes essential for survival, the present invention can design 4 sgRNAs for each gene.

[0031] The present invention also provides a method for constructing a sheep follicle granulosa knockout cell, comprising the following steps: packaging the sgRNA expression plasmid library with a lentivirus to obtain a recombinant lentivirus; infecting sheep follicle granulosa cells with the recombinant lentivirus, screening and culturing the cells in a culture medium containing puromycin for 6 to 8 days, and obtaining a sheep follicle granulosa knockout cell library. The sheep follicle granulosa cells described in the present invention are cells isolated from fresh sheep ovarian tissue and cultured to passage 1 to 3.

[0032] In the present invention, GCs are inoculated into T25 culture flasks before the sheep follicle granulosa cells are infected with cells. The cells are cultured for 20 to 26 hours to allow the cells to adhere to the wall and to be confluent to 70 to 90%, and then infected with recombinant lentivirus (MOI=0.3). After culturing for 2 to 4 days, fresh complete cell culture medium is replaced, and a medium without dual antibodies having a final concentration of 0.5 to 1.5 μg / mL of puromycin is added. The medium is changed every day, and the cell state is observed; after screening and culturing with puromycin medium for 6 to 8 days, the knocked-out cells are collected for verification and for subsequent test screening.

[0033] The present invention also provides a method for screening sheep FSH response genes, comprising the following steps: culturing the sheep follicle granulosa knockout cells with a complete medium containing 5-15 ng / mL FSH, collecting the cultured cells; extracting DNA from the cultured cells, PCR amplification, and performing second-generation sequencing on the amplified products; comparing the second-generation sequencing data with the constructed sgRNA library sequence, performing statistics and standardization on the sgRNA enrichment number, and screening 499 positively screened and 337 negatively screened target genes in chromosomes 2, 3, and X; culturing GCs with medium containing different concentrations of FSH, performing transcriptome sequencing, and performing STEM analysis on the 836 genes obtained by the positive and negative screening and transcriptome sequencing data, and screening out 13 FSH dose-dependent genes. The present invention shows that when the positive screening gene is missing, GCs will call on the cell growth-promoting effect of FSH to extend the life cycle of GCs, and when the negative screening gene is missing, due to the sensitivity of FSH to the effect of GCs, these genes play a key role in the growth or metabolism of granulosa cells. Essential genes. The positive and negative screening of target genes in the CRISPR-Cas9 cell library of the present invention combined with the transcriptome data of GCs cultured with different concentrations of FSH revealed three different gene expression patterns in FSH-treated GCs, and further obtained 13 FSH dose-dependent genes, which may jointly promote the maintenance of normal cell and tissue functions, such as growth, development, reproduction and protein synthesis.

[0034] In the present invention, the primers involved in the PCR amplification include sgRNA-F and sgRNA-R, and the nucleotide sequences are shown in SEQ ID No.53-54.

[0035] In the present invention, the reaction system for PCR amplification includes: a total reaction volume of 50 μL, 2x Taq Plus Master Mix 25 μL, sgRNA-F 2 μL, sgRNA-R 2 μL, genomic DNA 4 μL, and water is added to 50 μL.

[0036] In the present invention, the reaction procedure of PCR amplification includes: 95°C 5min, 95°C 30sec, 55°C 30sec, 72°C 20sec, 72°C 7min, 40 cycles, 4°C∞.

[0037] In the present invention, unless otherwise specified, all components or reagents are commercially available products well known to those skilled in the art.

[0038] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0039] Example 1

[0040] 1. Materials

[0041] Cell line: Sheep follicular granulosa cells (GCs) Fresh sheep ovarian tissue was collected from a local slaughterhouse and transported back to the laboratory for isolation and culture of granulosa cells. The cell line used in the experiment was the cell line of follicular granulosa cells at the second generation. Virus strain: 293FT cells were from Suzhou Hongxun Biotechnology Co., Ltd.

[0042] Vector: Lenti-CRISPR.v2, a CRISPR-Cas9 library vector, was purchased from Suzhou Hongxun Biotechnology Co., Ltd. The vector map is as follows: Figure 1 The packaging plasmid vector Packaging Mix was purchased from Invitrogen.

[0043] 2. Main reagents and instruments

[0044] Main reagents: M199 culture medium (Gibco), fetal bovine serum (BI), 0.25% trypsin (BI), penicillin-streptomycin mixture (Gibco), DPBS (Gibco); lipofectamine 2000 (IVGN), opti-MEM (Gibco); puromycin (Puro, Sigma-Aldrich); endotoxin-free plasmid large-scale extraction kit (Plasmid Maxi Kit, QIAGEN), TaKaRaMiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 Cell genome small-scale extraction kit (TaKaRa), Thermo Scientific GeneJET gel recovery kit; isopropanol (Sinopharm), 75% anhydrous ethanol (Sinopharm), etc.

[0045] Main instruments: biological safety cabinet (Thermo), carbon dioxide cell culture incubator (Thermo), inverted microscope (Leica), desktop high-speed low-temperature centrifuge (Eppendorf), microplate reader (Bio-rad), desktop refrigerated centrifuge (Eppendorf), temperature-controlled shaker (THZ-98, Taicang).

[0046] 3. Design and construction of sheep whole-genome CRISPR-Cas9 sgRNA library

[0047] 3.1 Design and synthesis of sheep whole-genome CRISPR-Cas9 sgRNA library

[0048] Reference genome: GCF_002742125.1_Oar_rambouillet_v1.0_genomic. CRISPR / Cas9 knockout libraries were designed for all protein-coding genes on the sheep genome. The sgRNA length was designed to be 20 nt and the target gene site contained PAM as NGG, close to the start codon ATG, and the GC content ranged from 40% to 60%. The genome-wide off-target evaluation of sgRNA examined 3 base mismatches, and the only sgRNA on the genome that did not contain 1 and 2 base mismatch off-target sites, and had the fewest off-target sites. The sgRNACas9 online software was used to design and search for sgRNAs with higher specificity as candidate sgRNAs, and 2000 sgRNAs without targets were designed as negative controls. In addition to housekeeping genes and genes essential for survival, sgRNAs were designed for a total of 21,134 genes, with 4 sgRNAs designed for each gene.

[0049] 3.2 Synthesis of oligonucleotide probes for sheep whole-genome CRISPR-Cas9 sgRNA library

[0050] The sheep whole-genome CRISPR-Cas9 sgRNA library oligonucleotide probes were synthesized by Suzhou Hongxun Biotechnology Co., Ltd.

[0051] 3.3 Construction of sheep whole-genome CRISPR-Cas9 sgRNA plasmid library

[0052] (1) The synthesized oligonucleotide probe was amplified using a high-fidelity enzyme, and the library amplification product was recovered by 2% agarose gel electrophoresis.

[0053] (2) Enzyme digestion of the CRISPR_Cas9 lentiviral expression vector Lenti-CRISPR.v2 vector to form a linearized vector.

[0054] (3) Recover the library fragment product from (1) and the linearized vector from (2) using Gibson Master Mix connection.

[0055] (4) The Gibson assembly product obtained in the previous step is used to transform Trans1-T1 competent cells.

[0056] (5) Use a plasmid large-scale extraction kit to extract plasmids, i.e., sgRNA plasmid library.

[0057] (6) Next generation sequencing (NGS) was used to identify the abundance of sgRNA in the sgRNA plasmid library. NGS library construction and sequencing were completed by Suzhou Hongxun Biotechnology Co., Ltd.

[0058] The CRISPR-Cas9 plasmid library (knockout library) constructed in the whole sheep genome is specifically: sheep chromosome 1 (Chr1), chromosome 2 (Chr2), chromosome 3 (Chr3), chromosome X (ChrX), the remaining chromosomes except chromosomes 1, 2, 3, and X, and all sheep chromosomes. The sgRNA second-generation sequencing data was analyzed using the Linux program, and the sgRNA reads were aligned to the library to obtain the number of sgRNAs and the corresponding number of sgRNA target genes for each sample. The coverage reached more than 99%, the abundance was high, and the sgRNA uniformity met the library qualification standard (Table 1). The sequencing reads of sgRNA conform to the normal distribution, with high uniformity and low discreteness; the cumulative distribution diagram of the frequency of sgRNA reads also shows that the library has good uniformity ( Figure 2 ) and can be used for subsequent experiments.

[0059] Table 1 Coverage and uniformity of CRISPR-Cas9 sgRNA library

[0060]

[0061]

[0062] Note: "Uniformity" means that the ratio of the smallest total number of reads in the top 10% of reads to the largest total number of reads in the bottom 10% must be less than 15.

[0063] 4. Lentiviral packaging of sheep whole genome CRISPR-Cas9 sgRNA library

[0064] The whole genome CRISPR-Cas9 sgRNA library lentiviral packaging was completed by Suzhou Hongxun Biotechnology Co., Ltd. The main lentiviral packaging process is as follows:

[0065] (1) Take 293T cells that are in good growth condition and in the logarithmic growth phase, digest them with 0.25% trypsin, gently pipette the cells with 10 times the volume of trypsin in complete culture medium, suspend them into a single cell suspension, count the cells, and inoculate 6×10 cells in a 10 cm cell culture dish. 6 Cells were cultured at 37°C, 5% CO2 overnight;

[0066] (2) The next day, confirm that the cells are growing well and remove the culture medium before transfection and replace it with 5 mL of Opti-MEM culture medium;

[0067] (3) Plasmid mixing: Take 9 μg Packaging Mix and 3 μg lentiviral expression plasmid and add 1.5 mL Opti-MEM preheated at 37°C and mix gently;

[0068] (4) Dilute Lipofectamine 2000: add 36 μL of lipofectamine 2000 to another 1.5 mL of Opti-MEM, mix gently, and leave at room temperature for 5 min;

[0069] (5) Gently mix the plasmid solution (3) and the lipofectamine 2000 dilution (4) and leave at room temperature for 20 minutes;

[0070] (6) Transfection: Carefully add 3 mL of plasmid-lipid complex (5) to the cell culture dish, gently mix, and incubate in a 37°C, 5% CO2 incubator for 6 hours, then replace with complete culture medium DMEM + 10% FBS;

[0071] (7) Virus fluid collection: After 48 h, the cell culture supernatant was collected, centrifuged at 3000 rpm for 10 min to remove cells and debris, and filtered with a 0.45 μm filter;

[0072] (8) Concentration: The collected virus stock solution was ultracentrifuged at 50,000 g for 2 h. After removing the supernatant, the solution was resuspended in 1 mL of DMEM culture medium, divided into sterile enzyme-free tubes, and stored at -80°C for later use.

[0073] 5. Lentivirus Titration

[0074] Sheep ovarian granulosa cells (GCs) were cultured using a six-well cell culture plate. When the cells were confluent to 80%, they were infected with lentivirus. At the same time, the lentivirus was diluted with M199 culture medium containing 1% double antibody and 10% FBS. The dilution concentrations were (5 μL, 10 μL, 20 μL, 30 μL, 40 μL, 50 μL and control group), respectively. Polybrene with a final concentration of 8 μg / mL was added to each well containing the diluted lentivirus solution; fresh complete culture medium was replaced after 24 hours of infection; after 3 days of infection, the cells were digested and collected using trypsin, and the virus titer was quantified and calculated by fluorescent quantitative PCR to determine the infection dosage in GCs, and finally the infection multiplicity was determined to be 0.3 MOI lentivirus dosage.

[0075] 6. Determination of Puromycin Screening Concentration for GCs

[0076] (1) Puromycin (Puro) was dissolved in sterile PBS to a working solution with a concentration of 1 mg / mL, filtered and sterilized using a 0.22 μm Millex-GP filter, and stored at -20°C for future use.

[0077] (2) GCs were divided into 5×10 5 The cells were inoculated into six-well plates and cultured for 24 h.

[0078] (3) discard the old culture medium, wash lightly with PBS, and culture the cells in culture medium prepared with Puro concentrations of 0, 0.5, 1, 1.5, 2, and 3 μg / mL in antibiotic-free M199 culture medium containing 10% FBS;

[0079] (4) Replace the above culture medium containing fresh Puro once a day.

[0080] (5) After continuous culture for about 7 days, when all cells died at a certain concentration, the lowest concentration of Puro was taken as the optimal concentration for screening cells, and this concentration was used for subsequent experiments. The results showed that all cells died at a puromycin concentration of 1 μg / mL, and most cells survived at 0.5 μg / mL. Therefore, 1 μg / mL puromycin concentration was determined as the optimal concentration for screening after lentivirus-infected cells.

[0081] 7. Effect of FSH on granulosa cell viability

[0082] During the culture of GCs, three doses of FSH were added at different time points, namely the control dose group (0ng / mL FSH), low dose group (10ng / mL FSH), and high dose group (100ng / mL). The cell proliferation rate was evaluated using CCK-8 reagent, and it was found that the cell proliferation rate of 10ng / mL FSH was significantly higher than that of other concentrations (p-value<0.05). In addition, as the FSH treatment time increased, the growth density of GCs gradually increased. Figure 3 This result showed that 10ng / mL FSH was the optimal dose to promote the proliferation of GCs. Based on this finding, this optimal dose of FSH was used as the experimental group when constructing a sheep ovarian granulosa cell-specific chromosome cell bank.

[0083] 8. Construction of GCs-specific chromosomal gene CRISPR-Cas9 knockout cell library

[0084] (1) Before infecting granulosa cells, GCs cells were inoculated into T25 culture flasks;

[0085] (2) After culturing for 24 h, the cells were allowed to adhere to the wall and confluent to about 80%, and then washed twice with PBS, the supernatant was discarded, 2 mL of serum-free M199 and polybrene with a final concentration of 8 μg / mL were added and incubated for 2 h, and the lentivirus solution diluted with complete medium (MOI = 0.3) was added and cultured for 24 h;

[0086] (3) Three days after infection, replace the complete cell culture medium with fresh one and add Puro dual antibody-free culture medium with a final concentration of 1 μg / mL. Change the medium every day and observe the cell status.

[0087] (4) After 7 days of screening and culture with Puro medium, a portion of the cells were collected to extract genomic DNA and check the abundance of sgRNA, and the remaining cells were used for subsequent experimental screening.

[0088] The experimental results showed that the cells that survived the puromycin selection were the cells that successfully introduced the target sgRNA. The genomic DNA of the cells was extracted using a kit, and the gene fragment containing the sgRNA was amplified by PCR. The purified PCR product was sequenced by Sanger sequencing to verify whether the library vector was integrated into the GC cell genome. The knockout cell library had an obvious target band at around 250bp, which was relatively specific, with no obvious nonspecific amplification, and all showed positive; while the blank group GCs had no band and showed negative ( Figure 4 ).

[0089] according to Figure 4 As a result, chromosome 2 (chr2), chromosome 3 (chr3), and sex chromosome (chrX) libraries with relatively high gene density (more genes on the chromosome) and enriched genes related to development, reproduction, and immune processes were selected for GCs knockout. The methods for constructing CRISPR-Cas9 sgRNA plasmid libraries, CRISPR-Cas9 sgRNA library lentivirus, and CRISPR-Cas9 knockout cell libraries based on chromosome 2, chromosome 3, and sex chromosomes were the same as above.

[0090] After the CRISPR-Cas9 library constructed with chromosome 2, chromosome 3 and sex chromosomes was infected with lentivirus, the knockout cell library GC-Cas9 was obtained by screening with 1μg / mL puromycin. The 10ng / mL FSH screened above was added to GC-Cas9 (GC-Cas9+FSH), and it was found that the cells in the experimental group with added FSH grew faster than those in the control group without added FSH, while all the cells in the blank group died ( Figure 5 ).

[0091] 9. Screening of genes related to FSH response

[0092] (1) The GC cell knockout library constructed based on chromosome 2, chromosome 3 and sex chromosomes was divided into groups without FSH (chr2, chr3 and chrX) and groups with FSH (chr2-FSH, chr3-FSH and chrX-FSH). The above GC knockout cells (chr2, chr3 and chrX) were cultured with complete medium containing 10 ng / mL FSH and without FSH for three consecutive rounds, and 1×10 6 The cells were used for genomic DNA extraction. TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0 was used to extract total genomic DNA. The specific extraction steps refer to the instruction manual.

[0093] (2) PCR was used to analyze the sgRNA information. 4 μg of genomic DNA was taken and 2x Taq Plus Master Mix (DyePlus) was used as the PCR enzyme for amplification reaction. The total reaction volume was 50 μL. The specific reaction system was: 2x Taq Plus Master Mix II 25 μL, sgRNA-F 2 μL, sgRNA-R 2 μL, genomic DNA 4 μL, and water was added to 50 μL. The reaction program was: 95°C 5 min, 95°C 30 sec, 55°C 30 sec, 72°C 20 sec, 72°C 7 min, 40 cycles, 4°C ∞. The primers used for PCR were: sgRNA-F sequence (5'-3'): AATTAATTTTGACTGTAAACACAA (SEQ ID NO. 53), sgRNA-R sequence (5'-3'): TTCAAGTTGATAACGGACT (SEQ ID NO. 54).

[0094] (3) gel recovery and purification of the target fragment;

[0095] (4) The purified product was used to construct a library for next-generation sequencing, and Novogene was commissioned to perform the next-generation sequencing;

[0096] (5) The raw data after sequencing were quality controlled using FASTQC software. After quality control, the average clean read count was 8619589.667 bp, the average number of bases was 1.29 G, and the average Q30 was 92.73. The sequencing data were used for subsequent analysis;

[0097] (6) Use MaGeck software to compare the clean data after quality control with the sgRNA library sequence, and perform statistics and standardization on sgRNA; use the R package MAGeCKFlute for downstream analysis and statistical comparison rate.

[0098] The results showed that the average alignment rate of the three chromosomes was 39.14% ( Figure 6 ). The target fragment size of the second-generation PCR paired-end sequencing is 250bp. The sgRNA sequence is close to one side of the fragment. 50% of the sequencing reads cannot detect the sgRNA sequence. Therefore, the actual sgRNA sequence alignment rate is 39.14%, which is within the normal range.

[0099] (7) Using the MAGeCK-RRA algorithm, the importance of genes was evaluated by calculating the RRA score of the target gene site corresponding to the sgRNA in the sequencing results, and the target genes were ranked. According to the standard of log2(Fold Change)>2 and P-Value<0.05, the target genes obtained by positive screening were obtained; the positive screening genes showed that under the action of FSH, knocking out these genes prolonged the life cycle of GCs and were FSH resistance genes. The target genes obtained by negative screening were those with log2(Fold Change)<-2 and P-Value<0.05, indicating that under the action of FSH, after knocking out these genes, GCs were sensitive to FSH treatment and were essential genes for FSH action. Further, the difference analysis was performed based on the number of sgRNA reads enriched in the cell library, and the target gene ranking and functional enrichment analysis were performed on the positive and negative screening genes with significant differences.

[0100] The results showed that a total of 499 target genes were positively screened and 337 target genes were negatively screened in the three chromosome groups ( Figure 7A). The positively screened genes are mainly involved in metal ion transport, organic anion transport and molecular adaptor activity. The negatively screened genes are involved in monosaccharide biosynthetic process, small molecule biosynthetic process, sex differentiation and tube morphogenesis. In the sex differentiation function, they are mainly concentrated on reproductive structure development, development of primary female sexual characteristics, gonad development, ovulation cycle and other reproductive functions. The positively and negatively screened genes are jointly involved in transcription factor binding, response to hormone and glutamatergic synapse and other functions. Figure 7 B). The KEGG pathways in which the positively and negatively screened genes were involved were the glucagon signaling pathway and the PI3K-Akt signaling pathway.

[0101] After positive screening of the CRISPR library, most cells died due to sensitivity to FSH, and some cells survived due to resistance caused by specific gene knockout. Genes related to drug resistance can be screened out by detecting the gRNA carried by surviving cells. When the positive screening gene is missing, GCs will use FSH's cell growth-promoting effect to extend the life cycle of GCs, and when the negative screening gene is missing, these genes are essential genes that play a key role in the growth or metabolism of granulosa cells due to the sensitivity of FSH to the effect of GCs.

[0102] (8) To further understand the biology and regulatory mechanisms of ovine follicle development, a FSH model with different doses was established to culture GCs.

[0103] GCs were seeded in 6-well plates (1×10 5The GCs were cultured in the above three culture media for 48 hours, the supernatant was discarded, and 1 mL of RNAiso Plus (Takara Bio, China) was added. The cells were completely lysed by repeated blowing, and the cells were collected in 1.8 mL cryovials and quickly frozen in liquid nitrogen. Total RNA was extracted and transcriptome sequencing was performed. Bioinformatics analysis of transcriptome sequencing data was performed. The 836 genes obtained by the positive and negative screening of the CRISPR-Cas9 experiment were differentially expressed and STEM analyzed with the transcriptome data to fully reveal the dynamic changes of FSH-induced GCs gene expression and explore the effects of FSH stimulation on GCs and follicle function.

[0104] The results showed that there were 363 differentially expressed genes in the high-dose group compared with the low-dose group, 788 in the high-dose group compared with the control group, and 1148 in the low-dose group compared with the control group. The low-dose group with 10 ng / mL FSH had the largest number of upregulated genes in GCs. Compared with the group without FSH, the addition of FSH led to an increase in the number of differentially expressed genes, while the number of differentially expressed genes in the high-dose group was less than that in the low-dose group ( Figure 8 ), these results revealed the expression patterns of genes responsive to different doses of FSH in granulosa cells.

[0105] STEM analysis of 836 genes identified three distinct gene expression patterns in FSH-treated GCs. Fig. 9 The expression trend of 31 genes in Profile 2 was first decreased and then stable. These genes are mainly involved in the coordination of transferase activity, transfer of phosphorus-containing groups, cell component organization, and maintaining the stability of cell structure and function. Fig. 9 In the project combination table (Profile 0), 33 genes showed an expression trend of first decreasing and then increasing, involving nitrogen compound metabolism, primary metabolism, catalytic complex and other functions. Fig. 9 The 65 genes in Profile 6 showed an expression trend that first increased and then decreased. This gene profile is mainly involved in transcription factor binding, receptor complex and metal ion transport, and cell surface receptor signaling pathways. These 129 important FSH dose-dependent genes may jointly promote the maintenance of normal cell and tissue functions, such as growth, development, reproduction, and protein synthesis.

[0106] (9) The differentially expressed genes obtained by transcriptome analysis shared 13 genes with 129 important FSH dose-dependent genes, namely ZNF367, CLK1, PRUNE2, TMEM37, ACTG2, MB, ADIPOR2, HK2, VDR, AGPAT2, EPS8, FOXO4, and TSC22D3. The sgRNA sequences corresponding to these 13 genes are shown in Table 2. These genes can be used as important candidate gene sets for research, laying the foundation for studying the mechanism of gonadotropin regulation of follicle development, and making important contributions to the discovery of new genes for sheep reproduction.

[0107] Table 2 FSH dose-dependent genes and their sgRNA sequences

[0108]

[0109]

[0110] The above 13 genes were verified, and each sgRNA targeting the candidate gene was cloned into the plasmid backbone of the sgRNA library using the above method, and the screening phenotype was verified. The results showed that the sgRNA expression plasmid can be well packaged into lentivirus and integrated into the cell genome; at the same time, sgRNA can well target the target gene and guide SpCas9 to cut the target sequence. In addition, the perturbation, indel rate and transcriptional activation caused by each sgRNA are used for knockout and activation screening, respectively, and will be quantified to establish the relationship between phenotype and genotype.

[0111] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A sheep FSH response gene knockout screening library, characterized in that The invention comprises an sgRNA expression plasmid targeting FSH dose-dependent genes, wherein the targeted FSH dose-dependent genes include ZNF367 gene, CLK1 gene, PRUNE2 gene, TMEM37 gene, ACTG2 gene, MB gene, ADIPOR2 gene, HK2 gene, VDR gene, AGPAT2 gene, EPS8 gene, FOXO4 gene, and TSC22D3 gene; The sgRNA sequences targeting the ZNF367 gene, CLK1 gene, PRUNE2 gene, TMEM37 gene, ACTG2 gene, MB gene, ADIPOR2 gene, HK2 gene, VDR gene, AGPAT2 gene, EPS8 gene, FOXO4 gene, and TSC22D3 gene are shown in SEQ ID NO.1-52, respectively, wherein each gene corresponds to 4 sgRNA sequences.

2. The method for constructing a sheep FSH response gene knockout screening library as claimed in claim 1, characterized in that, The method comprises the following steps: designing and synthesizing sgRNA for the genes of chromosome 2, chromosome 3 and chromosome X of sheep, amplifying the synthesized sgRNA with a high-fidelity enzyme, recovering the amplified product, connecting the amplified product with a CRISPR-Cas9 lentiviral expression vector, transforming Trans1-T1 competent cells after connection, extracting plasmids, and obtaining a sgRNA expression plasmid library targeting specific chromosomes.

3. The construction method according to claim 2, characterized in that: The sgRNA design principles include: the sgRNA length is designed to be 20 nt and the target gene site contains a PAM of NGG, close to the start codon ATG, and a GC content range of 40% to 60%.

4. A method for constructing sheep follicle granulosa knockout cells, characterized in that: The method comprises the following steps: packaging the sgRNA expression plasmid library constructed by the method of claim 2 with lentivirus to obtain recombinant lentivirus; infecting sheep follicle granulosa cells with the recombinant lentivirus, and obtaining a sheep follicle granulosa knockout cell library after screening and culturing in a culture medium containing puromycin for 6 to 8 days.

5. The construction method according to claim 4, characterized in that: The sheep follicle granulosa cells are cells separated from fresh sheep ovarian tissue and cultured and passaged to 1 to 3 generations.

6. A method for screening sheep FSH response genes, characterized in that: The steps include: The sheep follicle granulosa knockout cells according to claim 4 or 5 are cultured in a complete medium containing 5 to 15 ng / mL FSH, and the cultured cells are collected; Extract DNA from cultured cells, amplify by PCR, and perform next-generation sequencing on the amplified products; The data of the second generation sequencing were compared and analyzed with the sgRNA library sequence obtained by the construction method of claim 2, and the sgRNA enrichment number was counted and standardized, and 499 positively screened target genes and 337 negatively screened target genes in chromosome 2, chromosome 3 and chromosome X were screened; GCs were cultured in medium containing different concentrations of FSH, and transcriptome sequencing was performed. The 836 genes obtained by positive and negative screening were combined with transcriptome sequencing data for STEM analysis, and 13 FSH dose-dependent genes were screened out.

7. The method according to claim 6, characterized in that The primers involved in the PCR amplification include sgRNA-F and sgRNA-R, and the nucleotide sequences are shown in SEQ ID NOs.53 to 54.

8. The method according to claim 6, characterized in that The reaction system for PCR amplification includes: a total reaction volume of 50 L, 2x Taq Plus Master Mix 25 L, sgRNA-F 2 L, sgRNA-R 2 L, genomic DNA 4 L, and water is added to 50 L.

9. The method according to claim 6, characterized in that The reaction procedure of the PCR amplification includes: 95°C for 5 min, 95°C for 30 sec, 55°C for 30 sec, 72°C for 20 sec, 72°C for 7 min, 40 cycles, 4°C.

Images