A strain of Yarrowia lipolytica capable of producing high amounts of astaxanthin, canthaxanthin and β-carotene, and its cultivation method and application

Abstract

The invention discloses a strain of Yarrowia lipolytica YL_Xqs36 capable of producing high amounts of astaxanthin, canthaxanthin and beta-carotene. The strain is deposited in China Center for Type Culture Collection, with a deposit date of February 26, 2024 and a deposit number of CCTCC NO: M 2024333. The Yarrowia lipolytica YL_Xqs36 can produce carotenoid products such as astaxanthin, canthaxanthin and beta-carotene simultaneously, and the total pigment content of the dry thalli reaches 36 mg / g (UV detection). The dry thalli detected by liquid chromatography has an astaxanthin content of 15 mg / g, a beta-carotene content of 4.2 mg / g and a canthaxanthin content of 2.4 mg / g. The dry thalli of the strain is particularly suitable for the development of feed for aquatic animals such as shrimps, crabs, salmon, large yellow croaker, grouper and ornamental fish.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering and the field of microbial fermentation engineering, and specifically relates to a Yarrowia lipolytica strain capable of producing high amounts of astaxanthin, canthaxanthin and beta-carotene, and a cultivation method and application thereof. Background Art

[0002] Astaxanthin is a carotenoid with a melting point of 224°C, dark red-brown powder, water-insoluble and lipophilic. Its chemical name is 3,3'-dihydroxy-4,4'-diketo-β-carotene, which is a tetraterpenoid oxygen-containing derivative composed of 8 molecules of isoprene units, containing 11 conjugated double bonds and 2 β-ionone rings. Astaxanthin is the final product in the synthesis process of carotenoids. It has the strongest antioxidant capacity among more than 600 carotenoids, 10 times higher than β-carotene, zeaxanthin, and canthaxanthin, and about 100 times higher than α-tocopherol. Therefore, astaxanthin is also known as "super vitamin E". Natural astaxanthin is mainly found in fish, crustaceans, algae, yeast and some bacteria. Usually, astaxanthin exists in marine organisms and algae in the form of esterification, while it generally exists in free form in yeast and bacteria. Astaxanthin has many physiological effects, such as inhibiting tumor occurrence, enhancing immunity, and removing free radicals in the body. It has broad application prospects in health products, medicine, cosmetics, food additives and animal breeding. Astaxanthin can also be used in special aquatic coloring feed and functional animal feed: it can improve the surface and muscle color of aquatic animals such as shrimp, crab, some marine fish and ornamental fish, and improve the appearance quality of goods; improve the antioxidant capacity of aquatic animals, reduce lipid oxidation, and extend the shelf life; increase the content of nutrients in aquatic animals (crude protein, crude fat, unsaturated fatty acids); improve the resistance of aquatic animals to stress (such as low temperature, dry dew), and reduce the loss caused by long-distance transportation. Astaxanthin is used as a feed additive to enhance the immune and anti-stress ability of animals, reduce the effect of drugs, improve the survival rate, and improve the utilization rate of feed; it is beneficial to the development of the remaining system of animal parents, improve the quality of eggs and sperm, and improve the survival rate of animal larvae. Improving the immunity of hens is beneficial to resist the infection of Salmonella, improve the color and taste of egg yolks, and extend the shelf life.

[0003] At present, the production methods of astaxanthin include chemical synthesis, shell waste extraction, Haematococcus pluvialis production and Phaffia rhodozyma production. The astaxanthin products produced by chemical synthesis have low activity and the risk of harmful reagent residues. The astaxanthin content of shell waste extraction is low, and there are organic solvent residues, which is not suitable for large-scale production. The production cost of Haematococcus pluvialis is high, the product content is low, and it is easily affected by weather and environmental conditions.

[0004] Canthaxanthin, also known as canthaxanthin and β-carotene-4,4'-dione, is also a carotenoid. The molecular formula is C40 H 52 O2, dark purple crystals or crystalline powder, fat-soluble. Canthaxanthin research shows that canthaxanthin has strong activity in quenching active oxygen and scavenging free radicals, and is widely used in aquaculture, feed additives, food colorants and the pharmaceutical industry. It was approved by FDA / WHO as a food additive in 1984 and is one of the commonly used nutrients in human health care products. Since the intake of canthaxanthin can make the meat and eggs of poultry animals brighter, it is also used in poultry farming. In addition, canthaxanthin can also make the color of fish brighter and pinker, so it is also often used in fish farming.

[0005] There are many ways to produce canthaxanthin, including biological fermentation, chemical synthesis, natural product extraction, etc.

[0006] β-Carotene is also a type of carotenoid, also known as carotene, carotene, and provitamin A. It is a tetraterpenoid compound containing 8 isoprene units. It is a reddish purple to dark red crystalline powder and is fat-soluble. It is widely found in many natural plants, such as sweet potatoes, carrots, papayas, mangoes, etc. β-Carotene can not only serve as a precursor for the synthesis of vitamin A in the human body, but also plays an important role in improving immunity, delaying aging, and inhibiting the proliferation of cancer cells. It can be used as a provitamin, functional cosmetics, food colorant, feed supplement, and colorant, so it is widely used in the fields of pharmaceuticals, health products, cosmetics, food industry, and feed industry. It is a type of pigment with important biological functions and commercial value.

[0007] The main methods for producing β-carotene are chemical synthesis, natural extraction and microbial fermentation. However, the route of chemical synthesis of β-carotene is very complicated and the yield is not high; the extraction of β-carotene from natural sources such as potatoes, carrots, sea buckthorn and corn is affected by many conditions, such as season, climate, etc., and the content of β-carotene from these plant sources is relatively low, which leads to high cost of natural β-carotene products. High energy consumption and low extraction efficiency hinder the practical use of these methods. Therefore, the production of β-carotene by microbial fermentation has obvious advantages. Especially with the rapid development of biotechnology, the production of β-carotene by microbial fermentation has become one of the current research hotspots.

[0008] Based on the chemical structure and physiological activity of the three carotenoids astaxanthin, canthaxanthin and β-carotene, their applications in human health and animal nutrition are becoming more and more extensive. As people's requirements for quality of life increase, the demand for some high-end aquatic products is also increasing. The breeding volume of crabs such as King Kong shrimp, Macrobrachium rosenbergii, blue crabs, and fish such as salmon, rainbow trout, large yellow croaker, and eastern star grouper has increased rapidly in recent years. Astaxanthin, canthaxanthin and β-carotene can significantly improve the color of the body surface and muscles of aquatic animals, improve the appearance quality of goods, and increase the content of crude protein, crude fat and unsaturated fatty acids in these aquatic animals. Experiments have shown that these three carotenoids are added to feed in a certain proportion, and the degree of improvement in the color of the animal's body surface and muscles is significantly higher than the use of astaxanthin, canthaxanthin and β-carotene alone.

[0009] Many existing documents and patents have achieved the synthesis of astaxanthin in microorganisms by introducing heterologous pathways of astaxanthin, and the hosts are mainly Escherichia coli, Saccharomyces cerevisiae, Phaffia rhodozyma, etc., but these engineered bacteria still have the problem of low astaxanthin production. With the increasing demand for astaxanthin, canthaxanthin, and β-carotene in the global market and the rapid development of metabolic engineering and gene editing technology, the use of microorganisms to synthesize astaxanthin, canthaxanthin, and β-carotene has become an inevitable trend. Compared with other chassis cells, Yarrowia lipolytica has a clear genetic background, is easy to genetically manipulate, is easy to culture relative to other microorganisms, and is a recognized safe strain (GRAS). At the same time, Yarrowia lipolytica is an oil-producing microorganism containing carotenoid precursors acetyl CoA and farnesyl pyrophosphate. Its independent intracellular liposomes are conducive to the storage of lipophilic carotenes, and are ideal hosts for the synthesis of carotenes such as astaxanthin. After years of research, Yarrowia lipolytica has been used for exogenous expression to produce some high value-added metabolites, such as erythritol, acetyl CoA, stigmasterol, tocopherol, phloretin, docosapentaenoic acid, β-carotene, etc. The industrial production using Yarrowia lipolytica fermentation has become increasingly mature.

[0010] However, the difficulty in constructing recombinant engineered bacteria that produce astaxanthin and other carotenoids lies in the following: the synthesis pathway of astaxanthin is complex, and it requires multiple transformations to recombinant the expression genes of the enzymes involved in the synthesis pathway into the engineered bacteria, which is difficult and has a low success rate; and after the introduction of heterologous genes to enable the genetically engineered bacteria to synthesize the product, the intermediate strains need to be transformed and screened multiple times to obtain high-yield genetically engineered bacteria.

[0011] In recent years, literature and patents on the production of carotenoids using Yarrowia lipolytica and Yarrowia lipolytica as chassis cells have become popular. For example, the Chinese patent application number 202311260660.9, "Method for improving the production of β-carotene by Yarrowia lipolytica through molecular docking, the resulting engineered bacteria, its construction method and application", is a genetically engineered bacterium constructed by expressing carB, carRP and GGPPSA124Y-T132D genes in the Yarrowia lipolytica polf strain, and expressing ERG20, IDI, ERG12 and tHMGR genes and other genetic engineering technologies. The recombinant Yarrowia lipolytica produces 16.71g / L (184.98mg / g DCW) of β-carotene in a 50L fermenter.

[0012] The Chinese patent application number 202310361322.8, "An engineered Yarrowia lipolytica and its application", uses multi-copy recombination and integration of gene clusters expressing multiple enzymes such as phytoene synthase and lycopene cyclase on the Yarrowia lipolytica genome, knocks out the glycerol-3-phosphate dehydrogenase gene GUT2 on the strain genome, and then recombines the corresponding enzyme mutant gene clusters to obtain an engineered Yarrowia lipolytica that can efficiently biosynthesize astaxanthin using glucose as a substrate, and its astaxanthin fermentation unit can reach 3775.4 mg / L.

[0013] The Chinese patent application number 202211399336.0, "A kind of engineering bacteria producing cantharidin, its construction method and application", obtains a β-carotene-producing engineering bacteria by introducing the β-carotene synthesis genes carB and carRP of Mucor circinelloides, and the Yarrowia lipolytica genes GGS1 and tHMGR into Yarrowia lipolytica, and then expresses two copies of the β-carotene ketolase gene BSW on this basis to convert β-carotene into cantharidin, and further improves the cantharidin level by increasing the copy number of carB, carRP, GGS1 and tHMGR, and its cantharidin production reaches 3.5g / L.

[0014] The above-mentioned prior arts are all genetically engineered bacteria with Yarrowia lipolytica or Yarrowia lipolytica and other microorganisms as chassis cells. The components of the metabolites of the genetically engineered bacteria obtained by using different genetic engineering technologies and fermentation control means are also different. However, the components obtained by the prior arts are single, and usually only one carotenoid product can be obtained. In view of this, how to develop a new Yarrowia lipolytica to obtain several high-content carotenoid products at the same time still needs to be further rebuilt and studied, which is also the driving force and basis for the completion of the present invention. Summary of the invention

[0015] The purpose of the present invention is to develop a strain of Yarrowia lipolytica with high yield of astaxanthin, canthaxanthin and β-carotene and its cultivation method and application, aiming at the problems that the current synthesis pathway of astaxanthin is complicated, the expression genes of the enzymes involved in the synthesis pathway are all recombined into engineering bacteria, which requires multiple transformations, is difficult, and the success rate is low, and the existing genetically engineered bacteria can usually only ferment to obtain one carotenoid, etc., and the strain is obtained by adopting the methods of transferring heterologous genes, overexpressing key enzymes, regulating key metabolic nodes, modular enzyme assembly expression, etc. The strain is used for industrial production, which can greatly increase the yield of astaxanthin, canthaxanthin, and β-carotene, reduce costs, and lay the foundation for the large-scale production of three carotenoids. The strain is suitable for coloring a variety of aquatic animals in aquatic feed.

[0016] The present invention is achieved through the following technical solutions:

[0017] A strain of Yarrowialipolytica YL_Xqs36 with high production of astaxanthin, canthaxanthin and β-carotene. The strain was deposited in the China Center for Type Culture Collection on February 26, 2024, with a deposit number of CCTCC NO: M 2024333.

[0018] The Yarrowia lipolytica YL_Xqs36 of the present invention is constructed by: using chassis cell Yarrowia lipolytica as a starting strain (Yarrowia lipolytica itself has a mevalonic acid / MVA pathway, and acetyl-CoA is converted into MVA via an acetyl-CoA acetyltransferase / HMG-CoA reductase gene MvaE and an HMG-CoA synthase gene MvaS), using pMEL16 as an expression vector, and sequentially transferring a mevalonate kinase gene ERG12S, an isopentenyl pyrophosphate isomerase gene IDI and a geranylgeranyl pyrophosphate synthase gene MvaS into the expression vector. The enzyme gene GGS1, the modular enzyme RIAD-RIDD assembled geranyl pyrophosphate synthase / farnesyl pyrophosphate synthase gene ERG20Y and the geranyl pyrophosphate synthase gene GGS1, the phytoene synthase gene CrtB, the phytoene dehydrogenase gene CrtI and the lycopene cyclase gene CrtY, and finally the bkt (β-carotene ketolase) gene and CrtZ (β-carotene hydroxylase) gene were transferred to obtain the high-astaxanthin-producing Yarrowia lipolytica YL_Xqs36, see the attached Figure 2 The nucleic acid sequence of the key gene bkt (β-carotene ketolase) is shown in SEQ ID No: 2, and the nucleic acid sequence of the key gene CrtZ (β-carotene hydroxylase) is shown in SEQ ID No: 1.

[0019] The nucleic acid sequence SEQ ID No: 2 of the bkt (β-carotene ketolase) key gene of the present invention is as follows:

[0020]

[0021]

[0022]

[0023] The nucleic acid sequence of the key gene of CrtZ (β-carotene hydroxylase) of the present invention, SEQ ID No: 1, is as follows:

[0024] atggctgctg aaatttcaat ctccgctagc tcccgtgccatttgtctcca gcgcaacccc 60

[0025] tttcctgctc caaaatactt tgcaactgcc ccgccacttc tcttcttctc tcctttaact120

[0026] tgtaatctcg acgcaatttt gcggtctcgg agaaagccta ggttggctgc ttgctttgtg180

[0027] ctgaaggatg acaaattgta tactgcacaa agtggaaaac aaagcgatac tgaagcaata240

[0028] ggtgatgaga ttgaagtaga gactaatgag gagaagagtt tagctgtcag gctggccgaa300

[0029] aaatttgcga ggaagaagtc agagaggttt acttatcttg tagctgcggt aatgtccagt360

[0030] ttggggatta cttctatggc ggttatatttca gtttattaca gattttcgtg gcaaatggag 420

[0031] ggtggagaaatgcctttttc tgaaatgttt tgtacattcg ctctcgcctttggcgctgcc 480

[0032] ataggaatgg agtactgggc gagatgggcg catagagcac tatggcatgc ttctttgtgg540

[0033] catatgcacg agtcacacca tagaccaaga gaaggacctt tcgagctgaa cgatattttt600

[0034] gccataatca atgctgttcc agctatagct cttctttcat tcggtttcaa ccataaaggc660

[0035] ctcatccctg gactatgttt cggcgctgga ttagggatta cagtatttgg gatggcctac720

[0036] atgttcgttc acgatggatt agttcacaag agattccccg tgggacccat tgccaacgta780

[0037] ccttattttc agagagtagc tgcagcacat cagcttcatc actcggacaa atttgatggg840

[0038] gtcccatatg gcttgttcct aggacctaag gaattggaag aagtaggggt acttgaagag900

[0039] ttggaaaagg aagtcaaccg aagaattaaa agttcgaaga gattatga 948

[0040] In the process of constructing recombinant engineering bacteria, the present invention strengthens the rate-limiting step in the synthesis pathway by overexpressing key enzymes, transforms enzymes at key nodes to improve enzyme activity, assembles and expresses partial enzymes to partition metabolic reactions to regulate metabolic flow, and increases cofactors to strengthen related redox reactions. Finally, the present invention successfully screened a genetically engineered strain of Yarrowia lipolytica that produces high yields of astaxanthin, canthaxanthin, and β-carotene.

[0041] The present invention successfully obtains a Yarrowia lipolytica genetically engineered bacterium that can produce high-yield carotenoids such as astaxanthin by introducing heterologous genes, overexpressing key enzymes, regulating key metabolic nodes, and modular enzyme assembly expression. The Yarrowia lipolytica genetically engineered bacterium obtained by the present invention can simultaneously produce astaxanthin, canthaxanthin, and β-carotene during the fermentation process, and the ratio of these three carotenoid products is astaxanthin: canthaxanthin: β-carotene = 1: 0.1-0.5: 0.1-0.6. The astaxanthin production of the Yarrowia lipolytica genetically engineered bacterium can reach 1520 mg / L (HPLC), the total pigment content of the dry cell reaches 36 mg / g (UV detection), and the liquid chromatography detection of the dry cell astaxanthin content can reach 15.0 mg / g, canthaxanthin 3.3 mg / g, and β-carotene 4.2 mg / g, realizing the efficient synthesis of carotenoids such as astaxanthin in genetically engineered bacteria. The genetically engineered bacteria has the advantages of simple culture medium, fast reproduction, high bacterial concentration, etc., and has good application prospects.

[0042] The biological characteristics of the Yarrowia lipolytica YL_Xqs36 of the present invention are: an aerobic yeast, cultured on a YPD agar medium at 30°C for 24 hours, the colonies are round, brick red, dry, wrinkled, and hairy on the edges, and the cells have three morphologies: yeast type, hyphae type, and pseudohyphae type, see attached Figure 1 .

[0043] The invention provides a Yarrowia lipolytica strain capable of producing high amounts of astaxanthin, canthaxanthin and beta-carotene. The content ratio of astaxanthin, canthaxanthin and beta-carotene in the metabolites of the Yarrowia lipolytica strain is 1:0.1-0.5:0.1-0.6.

[0044] The present invention provides a fermentation method of a strain of Yarrowia lipolytica for high production of astaxanthin, canthaxanthin and β-carotene, comprising the following steps:

[0045] (1) Add 5-10 mL of 20% glycerol aqueous solution to Y. lipolytica strain YL_Xqs36, elute with an inoculating loop, and dispense into 2 mL glycerol tubes, 1 mL per glycerol tube, to obtain Y. lipolytica strain glycerol tubes, which are then stored in a -80°C low-temperature refrigerator;

[0046] (2) inoculating the above-mentioned Yarrowia lipolytica glycerol tube strain into a slant culture medium, wherein the slant culture medium formula is: 20 g / L tryptone, 10 g / L yeast extract powder, 20 g / L glucose, 20 g / L agar, and the solvent is water, and culturing for 65-75 hours at a temperature of 28-32° C. to obtain a slant strain;

[0047] (3) inoculating the obtained slant strain into a shake flask, wherein the shake flask seed culture medium formula is: peptone 5-20 g / L, yeast extract powder 2-10 g / L, glucose 5-20 g / L, and the solvent is water, and culturing is carried out for 8-16 hours under the culture conditions of a rotation speed of 200-250 rpm, a temperature of 28-32° C., and a pH of 5.0-7.2 to obtain a shake flask seed solution;

[0048] (4) inoculating the seed liquid of the shake flask into the seed tank at an inoculum amount of 1-3% by volume, wherein the culture medium formula of the seed tank is: 5-20 g / L glucose, 2-10 g / L yeast extract powder, 5-20 g / L peptone, 0.2-1.0 g / L defoamer, the solvent is water, and the culture conditions of the seed tank are: 28-32° C., rotation speed 180-250 rpm, ventilation volume 0.5-1.2 VVM, tank pressure 0.03-0.06 MPa, and culture for 8-12 hours to obtain the seed tank seed liquid;

[0049] (5) The obtained seed spawn liquid in the seed tank is transplanted into a fermentation tank at an inoculation rate of 3-10% by volume, wherein the fermentation tank culture medium comprises: 5-80 g / L glucose, 2-10 g / L yeast extract powder, 5-20 g / L peptone, 0.1-0.8 g / L potassium dihydrogen phosphate, 1-5 g / L ammonium sulfate, the solvent is water, and the pH value is 5.5-6.8; the culture conditions of the fermentation tank are: 28-32°C, the rotation speed is 100-30 0rpm, ventilation volume 0.5-1.2VVM, tank pressure 0.03-0.06MPa, culture time 90-180h; carbon source is added during the fermentation process, and nitrogen source is supplemented in 5 processes, and the supplementation time periods are 24-40h, 48-62h, 72-86h, 96-110h, and 120-134h respectively. Through the above culture, the lipolytic yeast fermentation liquid containing astaxanthin, canthaxanthin and β-carotene can be obtained.

[0050] The invention provides a method for using a strain of Yarrowia lipolytica for high production of astaxanthin, canthaxanthin and β-carotene, comprising the following steps:

[0051] (1) taking the fermentation liquid of the above-cultured Yarrowia lipolytica, centrifuging and discarding the supernatant, breaking the obtained bacterial cells with a high-pressure homogenizer, and spray drying to obtain a spray-dried powder containing astaxanthin, canthaxanthin, and β-carotene;

[0052] (2) The obtained spray-dried powder containing astaxanthin, canthaxanthin and β-carotene is added at a rate of 0.5-2 kg per ton of shrimp feed, 2.5-10 kg per ton of grouper feed and 0.5-2 kg per ton of yellow croaker feed for coloring these aquatic animals.

[0053] Preferably, the carbon source in the present invention is glucose or fructose.

[0054] Preferably, the nitrogen source in the present invention is hydrolyzed soybean cake powder or yeast extract powder.

[0055] Preferably, the inlet air temperature of the spray dryer in the present invention is 180-195°C, and the outlet air temperature is 85-95°C.

[0056] Compared with the prior art, the present invention has the following advantages:

[0057] (1) The lipolytica Y. roxanthosporum YL_Xqs36 of the present invention can simultaneously produce carotenoid products such as astaxanthin, canthaxanthin, β-carotene, etc., and the total pigment content of the dry bacteria is up to 36 mg / g (UV detection). The liquid chromatography detection of the dry bacteria can reach 15 mg / g astaxanthin, 4.2 mg / g β-carotene, and 2.4 mg / g canthaxanthin. The dry bacteria of this species are particularly suitable for the development of aquatic animal feed such as shrimps, crabs, salmon, large yellow croaker, grouper, and ornamental fish.

[0058] (2) Yarrowia lipolytica YL_Xqs36 is an unconventional strain with good safety. As a high-yield oil yeast, it can provide storage space for fat-soluble carotenoids and has the ability to use a wide range of substrates. This provides a guarantee for the subsequent optimization of fermentation process conditions and further improving the ability of Yarrowia lipolytica to produce astaxanthin and other carotenoids.

[0059] (3) The strain has been verified in a 3000L fermenter and can be easily scaled up to larger-scale fermenter production.

[0060] (4) The Yarrowia lipolytica of the present invention has the advantages of simple culture medium, fast reproduction, high bacterial concentration, etc. The biomass of the fermentation tank of the present invention can reach a dry weight of 80 g / L, the fermentation cycle can be as low as 90 h, and the overall production cost is low.

[0061] (5) After control tests, the spray-dried product of Yarrowia lipolytica fermented by the present invention is used in the coloring of shrimps and crabs such as giant shrimp, Macrobrachium rosenbergii, blue crab, and aquatic animals such as rainbow trout, large yellow croaker, and eastern grouper, and its coloring effect is significantly better than that of single astaxanthin, canthaxanthin, and β-carotene products.

[0062] Instruction Manual

[0063] Figure 1 This is a plate culture morphology of Yarrowia lipolytica YL_Xqs36;

[0064] Figure 2 It is the synthetic pathway of astaxanthin;

[0065] Figure 3 This is the HPLC detection spectrum of the Yarrowia lipolytica YL_Xqs36 of the present application. DETAILED DESCRIPTION

[0066] In order to better explain the present invention and facilitate understanding of the technical solution of the present invention, it is now further described in conjunction with the drawings and embodiments. It should be understood that the specific embodiments of the present invention are only for illustrative purposes and are not intended to limit the present invention.

[0067] The invention discloses a strain of Yarrowialipolytica YL_Xqs36 with high astaxanthin, canthaxanthin and beta-carotene production, which is deposited in China Center for Type Culture Collection on February 26, 2024, and has a deposit number of CCTCC NO: M 2024333.

[0068] Example 1

[0069] The fermentation method of a strain of Yarrowia lipolytica for high production of astaxanthin, canthaxanthin and β-carotene in this embodiment comprises the following steps:

[0070] (1) Add the strain of Yarrowia lipolytica YL_Xqs36 to 5 mL of a 20% glycerol aqueous solution, elute using an inoculating loop, and dispense into 2 mL glycerol tubes, with 1 mL in each glycerol tube, to obtain the strain of Yarrowia lipolytica glycerol tubes, which are then stored in a -80°C low-temperature refrigerator;

[0071] (2) inoculating the above-mentioned Yarrowia lipolytica glycerol tube strain into a slant culture medium, wherein the slant culture medium formula is: 20 g / L tryptone, 10 g / L yeast extract powder, 20 g / L glucose, 20 g / L agar, and the solvent is water, and culturing is carried out at a temperature of 30° C. for 70 hours to obtain a slant strain;

[0072] (3) inoculating the obtained slant strain into a shake flask, wherein the shake flask seed culture medium formula is: 20 g / L peptone, 10 g / L yeast extract powder, 20 g / L glucose, and the solvent is water, and culturing is carried out for 14 hours under the culture conditions of a rotation speed of 200 rpm, a temperature of 30° C., and a pH of 6.0 to obtain a shake flask seed solution;

[0073] (4) 1000 mL of the grown seed solution from the shake flask was inoculated into a 200 L seed tank. The culture medium formula of the seed tank was as follows: 20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, 1.0 g / L defoamer, and water as the solvent. The total volume was 100 L and sterilized at 121-123° C. for 30 min. The volume after sterilization was 100 L. The culture conditions of the seed tank were as follows: 30° C., 200 rpm rotation speed, and 6.0 m 3 / h, tank pressure 0.03-0.06Mpa, culture for 8h, and obtain seed tank seed liquid;

[0074] (5) The obtained seed liquid of the seed tank was transplanted into a 3000L fermentation tank, and the OD (600nm) was 5.85 during the transplantation; the fermentation tank culture medium composition was: 20g / L glucose, 10g / L yeast extract powder, 20g / L peptone, 0.5g / L potassium dihydrogen phosphate, 2g / L ammonium sulfate, 1.0g / L defoamer, the solvent was water, pH=6.5, the feed volume was 1500L, sterilized at 121-123°C for 30min, the volume after sterilization was 1300L, and the inoculation amount was 100L; the culture conditions of the fermentation tank were: 30°C, rotation speed 100-300rpm, ventilation volume 60-100m 3 / h, tank pressure 0.03-0.05MPa, culture time 135h; glucose is added as carbon source during the fermentation process to maintain the glucose concentration of the fermentation liquid at 1-10g / L; 5kg of hydrolyzed soybean cake powder is added 5 times at 30h, 54h, 78h, 102h and 120h respectively, and the tank is released at 135h. The astaxanthin unit of the fermentation liquid is 0.92g / L, and the lipolytic Yarrowia fermentation liquid with a bacterial concentration of 28% can be obtained.

[0075] The obtained Yarrowia lipolytica fermentation liquid was separated into solid and liquid by a disc centrifuge, the supernatant was discarded, the bacterial bodies were collected, 3L of purified water was added to the bacterial bodies and stirred evenly, and then the cells were broken by a high-pressure homogenizer, and the broken cell liquid was spray-dried, the spray-drying air inlet temperature was 185-190°C, and the air outlet temperature was 85-90°C, and 3.5kg of spray-dried powder was obtained. The total pigment content of the dry bacterial bodies reached 25.1mg / g (UV detection), and the astaxanthin content of the dry bacterial bodies detected by liquid chromatography reached 11.2mg / g, containing 2.2mg / g of canthaxanthin and 3.0mg / g of β-carotene, see the attached Figure 3 .

[0076] The liquid chromatography detection method is as follows: mobile phase A: acetonitrile-isopropanol (300:200), B: acetonitrile-methanol-water (150:300:50); octadecylsilane bonded silica gel is used as the filling column (Sunfire C185μm 4.6×150mm); gradient elution is performed with the above mobile phase as specified in the following table; the flow rate is 1.5mL / min, the column temperature is 30°C; and the detection wavelength is 480nm.

[0077] Time (min) Mobile phase A (%) Mobile phase B (%) 0～5 30 70 5～7 30→70 70→30 7～20 70 30 20～22 70→30 30→70 22～30 30 70

[0078] Accurately weigh 10 mg of astaxanthin reference substance and place it in a 100 mL volumetric flask, dissolve it in dimethyl sulfoxide (DMSO) as the standard stock solution. Accurately measure the astaxanthin standard stock solution and dilute it with dimethyl sulfoxide to a concentration gradient of 0.5 mg / L, 1 mg / L, 2 mg / L, 5 mg / L, 10 mg / L, 2 mg / L, and 50 mg / L. Shake well and use it as the standard solution to establish a standard curve.

[0079] Accurately weigh the sample to be tested and place it in a 10mL centrifuge tube, add 5mL of dimethyl sulfoxide, shake and mix, heat in a 55℃ water bath for 5min, centrifuge at 4000rpm for 5min, transfer the supernatant to a volumetric flask, add 5mL of dimethyl sulfoxide to the precipitate and heat in a 55℃ water bath for 5min, continue extraction and centrifugation, repeat the operation until there is no color in the precipitated solid, make up to volume with methanol, shake well, filter with a microporous filter membrane, inject the sample, and perform HPLC analysis. The final concentration of astaxanthin should be within the concentration range of the standard curve.

[0080] The spray-dried bacterial powder obtained in this example was added to 1.0 kg of shrimp feed per ton of shrimp feed, and the King Kong shrimp was fed continuously for one month before leaving the pond. At the same time, the coloring effects of three single component feedings were compared. The results showed that the coloring effect of the spray-dried bacterial powder was more significant than that of single astaxanthin, canthaxanthin, and β-carotene products, and the stress resistance of the King Kong shrimp was significantly improved. The mortality rate during transportation was reduced from 3-5% to less than 2%, and the color of the shrimp shell after cooking was significantly redder than that of the control group without addition.

[0081] Example 2

[0082] The fermentation method of a strain of Yarrowia lipolytica for high production of astaxanthin, canthaxanthin and β-carotene in this embodiment comprises the following steps:

[0083] (1) Add the strain of Yarrowia lipolytica YL_Xqs36 to 10 mL of a 20% glycerol aqueous solution, elute using an inoculating loop, and dispense into 2 mL glycerol tubes, with 1 mL in each glycerol tube, to obtain the strain of Yarrowia lipolytica glycerol tubes, which are then stored in a -80°C low-temperature refrigerator;

[0084] (2) inoculating the above-mentioned Yarrowia lipolytica glycerol tube strain into a slant culture medium, wherein the slant culture medium formula is: 20 g / L tryptone, 10 g / L yeast extract powder, 20 g / L glucose, 20 g / L agar, and the solvent is water, and culturing is carried out at a temperature of 30° C. for 70 hours to obtain a slant strain;

[0085] (3) inoculating the obtained slant strain into a shake flask, wherein the shake flask seed culture medium formula is: 20 g / L peptone, 10 g / L yeast extract powder, 20 g / L glucose, and the solvent is water, and culturing is carried out for 14 hours under the culture conditions of a rotation speed of 220 rpm, a temperature of 30° C., and a pH of 6.1 to obtain a shake flask seed solution;

[0086] (4) 1000 mL of the grown seed solution from the shake flask was inoculated into a 200 L seed tank. The seed tank culture medium formula was: 20 g / L glucose, 10 g / L yeast extract powder, 20 g / L peptone, 1.0 g / L defoamer, and the solvent was water. The total volume was 100 L and sterilized at 121-123° C. for 30 min. The volume after sterilization was 100 L. The culture conditions of the seed tank were: 30° C., 250 rpm, and 6.0 m 3 / h, tank pressure 0.03-0.05Mpa, culture for 8.5h, and obtain seed tank seed liquid;

[0087] (5) The obtained seed liquid of the seed tank was transplanted into a 3000L fermentation tank, and the OD (600nm) was 5.85 during the transplantation; the fermentation tank culture medium composition was: 20g / L glucose, 10g / L yeast extract, 20g / L peptone, 0.5g / L potassium dihydrogen phosphate, 2g / L ammonium sulfate, 1.0g / L defoamer, the solvent was water, pH=6.3, the material volume was 1500L, sterilized at 121-123°C for 30min, the volume after sterilization was 1350L, and the inoculation amount was 100L; the culture conditions of the fermentation tank were: temperature 30°C, rotation speed 180-300rpm, ventilation volume 60-100m 3 / h, tank pressure 0.03-0.05MPa, culture period 140h, glucose was added during the fermentation process to maintain the glucose concentration of the fermentation liquid at 1-5g / L, 5kg of yeast extract powder was added at 24h, 48h, 72h, 96h and 120h respectively, and the tank was released after 140h. The astaxanthin unit of the fermentation liquid was 1.32g / L, and the lipolytic Yarrowia saccharomyces fermentation liquid with a bacterial concentration of 32% was obtained.

[0088] The obtained Yarrowia lipolytica fermentation liquid was separated into solid and liquid by a disc centrifuge, the supernatant was discarded, the bacterial bodies were collected, 3L of purified water was added to the bacterial bodies and stirred evenly, and then the cells were broken by a high-pressure homogenizer, and the broken cell liquid was spray-dried, the spray-dried air inlet temperature was 190-195°C, and the air outlet temperature was 85-90°C, to obtain 4.1kg of spray-dried powder. The total pigment content of the dry bacterial bodies reached 30mg / g (UV detection), and the astaxanthin content of the dry bacterial bodies detected by liquid chromatography reached 12.3mg / g, containing 2.9mg / g of canthaxanthin and 3.7mg / g of β-carotene, and the detection method of liquid chromatography was the same as that of Example 1.

[0089] The spray-dried bacterial powder obtained in this example was added to the grouper feed at a standard of 4.0 kg per ton of feed, and the grouper was fed continuously for 3 months before leaving the pond. At the same time, the coloring effects of three single-component feedings were compared. The results showed that the coloring effect of the spray-dried bacterial powder was more significant than that of single astaxanthin, canthaxanthin, and β-carotene products.

[0090] Example 3

[0091] The fermentation method of a strain of Yarrowia lipolytica for high production of astaxanthin, canthaxanthin and β-carotene in this embodiment comprises the following steps:

[0092] (1) Add the strain of Yarrowia lipolytica YL_Xqs36 to 8 mL of a 20% glycerol aqueous solution, elute using an inoculating loop, and dispense into 2 mL glycerol tubes, with 1 mL in each glycerol tube, to obtain the strain of Yarrowia lipolytica glycerol tubes, which are then stored in a -80°C low-temperature refrigerator;

[0093] (2) inoculating the above-mentioned Yarrowia lipolytica glycerol tube strain into a slant culture medium, wherein the slant culture medium formula is: 20 g / L tryptone, 10 g / L yeast extract powder, 20 g / L glucose, 20 g / L agar, and the solvent is water, and culturing is carried out at a temperature of 30° C. for 70 hours to obtain a slant strain;

[0094] (3) inoculating the obtained slant strain into a shake flask, wherein the shake flask seed culture medium formula is: peptone 20 g / L, yeast extract powder 10 g / L, glucose 20 g / L, solvent is water, and culturing is carried out for 15 hours under the culture conditions of rotation speed of 220 rpm, temperature of 30° C., pH=5.0-7.2 to obtain a shake flask seed solution;

[0095] (4) 1000 mL of the grown seed solution from the shake flask was inoculated into a 200 L seed tank. The seed tank culture medium formula was: 20 g / L glucose, 10 g / L yeast extract powder, 20 g / L peptone, 1.0 g / L defoamer, and the solvent was water. The total volume was 100 L and sterilized at 121-123° C. for 30 min. The volume after sterilization was 100 L. The culture conditions of the seed tank were: 30° C., 250 rpm, and 6.0 m 3 / h, tank pressure 0.03-0.05Mpa, culture for 9h, and obtain seed tank seed liquid;

[0096] (5) The seed liquid obtained from the seed tank was transplanted into a 3000 L fermentation tank, and the OD (600 nm) was 6.35 during the transplantation. The fermentation tank culture medium composition was as follows: 20 g / L glucose, 10 g / L yeast extract, 20 g / L peptone, 0.5 g / L potassium dihydrogen phosphate, 2 g / L ammonium sulfate, 1.0 g / L defoamer, the solvent was water, pH=6.2, the material volume was 1500 L, sterilized at 121-123° C. for 30 min, the volume after sterilization was 1300 L, the inoculation amount was 100 L, and the culture conditions of the fermentation tank were as follows: temperature 30° C., rotation speed 180-300 rpm, ventilation volume 60-100 m 3 / h, tank pressure 0.03-0.05MPa, culture period 135h, fructose is added during the fermentation process to maintain the total sugar concentration of the fermentation liquid at 5-15g / L, 5kg of yeast extract powder is added at 30h, 45h, 78h, 102h and 120h respectively, the tank is released at 135h, the astaxanthin unit of the fermentation liquid is 1.52g / L (HPLC), and the lipolytic yeast fermentation liquid with a bacterial concentration of 30% is obtained.

[0097] The obtained Yarrowia lipolytica fermentation liquid was separated into solid and liquid by a disc centrifuge, the supernatant was discarded, the bacterial bodies were collected, 3L of purified water was added to the bacterial bodies and stirred evenly, and then the cells were broken by a high-pressure homogenizer, and the broken cell liquid was spray-dried, the spray-drying air inlet temperature was 185-190°C, and the air outlet temperature was 90-95°C, and 3.8kg of spray-dried powder was obtained. The total pigment content of the dry bacterial bodies reached 36mg / g (UV detection), and the astaxanthin content of the dry bacterial bodies detected by liquid chromatography reached 13.8mg / g, containing 3.3mg / g of canthaxanthin and 4.2mg / g of β-carotene, see the attached Figure 3 The detection method of liquid chromatography is the same as that of Example 1.

[0098] The spray-dried bacterial powder obtained in this example was added to large yellow croaker feed at a standard of 1.0 kg per ton, and was continuously fed to large yellow croaker for 3 months before being released from the pond. At the same time, the coloring effects of three single-component feedings were compared. The results showed that the coloring effect of the spray-dried bacterial powder was more significant than that of single astaxanthin, canthaxanthin, and β-carotene products.

[0099] The specific embodiments of the present invention have been described and explained in detail, but it should be appreciated that the present invention is not limited by the specific embodiments. Various improvements, modifications and variations may be made to the present invention without departing from the spirit and scope of the present invention, and these improvements, modifications and variations are within the scope of the present invention.

Claims

1. A strain of Yarrowia lipolytica YL_Xqs36 that produces high levels of astaxanthin, canthaxanthin and β-carotene. Features: The strain was deposited in the China Center for Type Culture Collection on February 26, 2024, with a deposit number of CCTCC NO: M 2024333. The content ratio of astaxanthin, canthaxanthin and beta-carotene in the metabolites of the Yarrowia lipolytica is 1:0.1-0.5:0.1-0.

6.

2. The fermentation method of the Yarrowia lipolytica strain for high production of astaxanthin, canthaxanthin and β-carotene according to claim 1, It is characterized in that The following steps are involved: (1) Add 5-10 mL of 20% glycerol aqueous solution to Y. lipolytica strain YL_Xqs36, elute with an inoculating loop, and dispense into 2 mL glycerol tubes, 1 mL per glycerol tube, to obtain Y. lipolytica glycerol tube strains, which are then stored in a -80 °C low-temperature refrigerator; (2) inoculating the above-mentioned Yarrowia lipolytica glycerol tube strain into a slant culture medium, wherein the slant culture medium formula is: 20 g / L tryptone, 10 g / L yeast extract powder, 20 g / L glucose, 20 g / L agar, and the solvent is water, and culturing for 65-75 h at a temperature of 28-32°C to obtain a slant strain; (3) Inoculating the obtained slant strain into a shake flask, the shake flask seed culture medium formula is: peptone 5-20 g / L, yeast extract powder 2-10 g / L, glucose 5-20 g / L, the solvent is water, and culturing for 8-16 hours under the culture conditions of a rotation speed of 200-250 rpm, a temperature of 28-32 ° C, and a pH of 5.0-7.2 to obtain a shake flask seed solution; (4) Inoculating the shake flask seed liquid into the seed tank at an inoculation rate of 1-3% by volume, the seed tank culture medium formula is: glucose 5-20 g / L, yeast extract 2-10 g / L, peptone 5-20 g / L, defoamer 0.2-1.0 g / L, the solvent is water, the culture conditions of the seed tank are: 28-32 ° C, rotation speed 180-250 rpm, ventilation volume 0.5-1.2 VVM, tank pressure 0.03-0.06 Mpa, culture for 8-12 h, and obtaining the seed tank seed liquid; (5) The obtained seed tank seed liquid is transplanted into a fermentation tank at an inoculation rate of 3-10% by volume, wherein the fermentation tank culture medium comprises: 5-80 g / L glucose, 2-10 g / L yeast extract, 5-20 g / L peptone, 0.1-0.8 g / L potassium dihydrogen phosphate, 1-5 g / L ammonium sulfate, the solvent is water, and the pH value is 5.5-6.8; the culture conditions of the fermentation tank are: 28-32 °C, the rotation speed is 100-300 rpm, the ventilation volume is 0.5-1.2 VVM, the tank pressure is 0.03-0.06 MPa, and the culture time is 90-180 h; during the fermentation process, a carbon source is added, and a nitrogen source is added in 5 processes, and the supplementation time periods are 24-40 h, 48-62 h, 72-86 h, 96-110 h, 120-134 h, respectively. h. Through the above culture, a fermentation liquid of Yarrowia lipolytica with high content of astaxanthin, canthaxanthin and β-carotene can be obtained; the carbon source is glucose or fructose; and the nitrogen source is hydrolyzed soybean cake powder or yeast extract powder.

3. Use of the Yarrowia lipolytica strain that produces high astaxanthin, canthaxanthin and β-carotene as claimed in claim 1, It is characterized in that The following steps are involved: (1) taking the fermentation broth of Yarrowia lipolytica as claimed in claim 2, centrifuging and discarding the supernatant, breaking the obtained bacterial cells by a high-pressure homogenizer, and spray drying to obtain a spray-dried powder containing astaxanthin, canthaxanthin and β-carotene; (2) The obtained spray-dried powder containing astaxanthin, canthaxanthin and β-carotene is added at a rate of 0.5-2 kg per ton of shrimp feed, 2.5-10 kg per ton of grouper feed and 0.5-2 kg per ton of yellow croaker feed for coloring these aquatic animals.

4. The use of a strain of Yarrowia lipolytica for high production of astaxanthin, canthaxanthin and β-carotene according to claim 3, Features: The inlet air temperature of the spray dryer in the spray drying is 180-195°C, and the outlet air temperature is 85-95°C.

Images