A circular RNA vaccine for treating canine melanoma

Abstract

The present invention discloses a circular RNA vaccine for treating canine melanoma. The circular RNA vaccine comprises a circular RNA molecule encoding an optimized canine tyrosinase, which comprises canine tyrosinase or a homologous sequence thereof, a linker, and an enhancer sequence or a homologous sequence thereof. The present invention optimizes and enhances the immunogenicity of canine tyrosinase, stimulating the immune system to recognize the canine tyrosinase. The canine tyrosinase circular RNA vaccine is prepared using both circular RNA technology and LNP delivery technology. This vaccine highly expresses the optimized canine tyrosinase in vivo, thereby activating the immune system and producing a therapeutic effect on canine melanoma.

Description

Technical Field

[0001] The present invention relates to the technical field of vaccines for treating canine melanoma, and in particular to a circular RNA vaccine for treating canine melanoma. Background Art

[0002] Canine melanoma, a common tumor found in the mouth, skin, eyes, and toes, is a common canine tumor and a leading cause of mortality in older dogs. Current clinical treatments for canine tumors primarily include surgery, chemotherapy, and radiotherapy. Common chemotherapy drugs, such as cyclophosphamide, doxorubicin, vincristine, and prednisolone, all have drawbacks such as poor tumor specificity and significant toxic side effects.

[0003] Tumor vaccine refers to the process of injecting tumor-associated antigens in tumor tissue into the body of a tumor patient in the form of a pharmaceutically acceptable carrier to activate the body's immune system to kill tumor cells in order to achieve the purpose of controlling and treating tumors.

[0004] Tyrosinase is the primary catalytic enzyme in melanin formation. Tyrosinase is expressed in complex melanocytic nevi, with reduced expression in the deep dermis and high expression in malignant melanomas. Therefore, tyrosinase is often used as a melanoma marker and specific antigen. However, since tyrosinase is an autologous protein, it is susceptible to immunosuppression and tolerance during immunization, making it ineffective for treating melanoma. Some companies abroad are using xenoantigens for immunization to overcome immune suppression. For example, Merial's ONCEPT vaccine, a DNA vaccine developed by incorporating human tyrosinase antigens into plasmid DNA, is designed to treat canine melanoma. Subsequent retrospective studies have shown limited therapeutic efficacy. Summary of the Invention

[0005] The present invention aims to provide a circular RNA vaccine for treating canine melanoma, as well as its preparation method and application. By delivering circular RNA expressing optimized canine tyrosinase into cells via liposomes, the optimized canine tyrosinase is efficiently expressed in vivo, stimulating an immune response and achieving a therapeutic effect.

[0006] The object of the present invention is achieved through the following technical solutions:

[0007] The present invention provides a circular RNA vaccine for treating canine melanoma. The circular RNA vaccine comprises a circular RNA molecule encoding an optimized canine tyrosinase. The optimized canine tyrosinase comprises canine tyrosinase or a homologous sequence thereof, a linker, and an enhancing sequence or a homologous sequence thereof.

[0008] The amino acid sequence of the canine tyrosinase is shown in SEQ ID NO: 1.

[0009] The nucleotide sequence of the canine tyrosinase is shown in SEQ ID NO: 2.

[0010] Said homologous sequences are sequences having at least 90%, optionally at least 95%, preferably at least 97%, more preferably at least 98%, and most preferably at least 99% sequence identity.

[0011] In one embodiment of the present invention, the linker is a flexible polypeptide consisting of 2-20 flexible amino acids, wherein the flexible amino acids are selected from at least one of Gly, Ser, Ala, and Thr. More preferably, the linker is (Gly-Gly-Gly-Gly-Ser)n, where n is an integer between 2 and 5 (e.g., 2, 3, 4, or 5).

[0012] The preferred linker amino acid sequence is as follows: GGGGSGGGGSGGGGS (SEQ ID NO: 3).

[0013] The preferred linker nucleotide sequence is as follows:

[0014] GGCGGCGGGGGCAGCGGCGGCGGGGGATCTGGCGGAGGAGGCAGC (SEQ ID NO: 4).

[0015] As one embodiment of the present invention, the enhancing sequence is selected from the enhancing sequence shown in the amino acid sequence of SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 or SEQ ID NO: 11.

[0016] The enhancing sequence whose amino acid sequence is shown in SEQ ID NO:5 is recorded as enhancing sequence ConA; the nucleotide sequence of enhancing sequence ConA is shown in SEQ ID NO:6.

[0017] The enhancing sequence whose amino acid sequence is shown in SEQ ID NO:7 is recorded as enhancing sequence T113G; the nucleotide sequence of enhancing sequence T113G is shown in SEQ ID NO:8.

[0018] The enhancing sequence whose amino acid sequence is shown in SEQ ID NO:9 is recorded as enhancing sequence K115T; the nucleotide sequence of enhancing sequence K115T is shown in SEQ ID NO:10.

[0019] The enhancing sequence whose amino acid sequence is shown in SEQ ID NO: 11 is recorded as enhancing sequence L87T; the nucleotide sequence of enhancing sequence L87T is shown in SEQ ID NO: 12.

[0020] As one embodiment of the present invention, the circular RNA comprises elements arranged in the order shown in any one of the following (a) to (d):

[0021] (a) first exon, second exon, 5' spacer, translation initiation element, coding element and 3' spacer;

[0022] (b) first exon, second exon, translation initiation element, and coding element;

[0023] (c) translation initiation elements and coding elements;

[0024] (d) translation initiation elements, coding elements, and insertion elements;

[0025] The coding element encodes the optimized canine tyrosinase.

[0026] As one embodiment of the present invention, the translation initiation element comprises one or more of the following sequences with translation initiation activity: IRES sequence, 5'UTR sequence, Kozak sequence, sequence comprising m6A modification, and complementary sequence of ribosomal 18S rRNA.

[0027] As one embodiment of the present invention, the insertion element comprises one or more of the following sequences: an untranslated region sequence, a polyN sequence, an adapter sequence, a ribosomal switch sequence, and a sequence that binds a transcriptional regulatory factor; wherein, in the polyN sequence, N is selected from at least one of A, T, G, and C.

[0028] As one embodiment of the present invention, the circular RNA molecule is formed by further cyclization of a linear RNA obtained by transcription of a recombinant nucleic acid molecule, and the coding region of the recombinant nucleic acid molecule has a nucleotide sequence as shown in SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22 or SEQ ID NO: 24.

[0029] The recombinant nucleic acid molecule comprises, from the 5' end to the 3' end, an intron fragment II, a translation initiation element truncation fragment II, a coding region, a polyAC element, a translation initiation element truncation fragment I and an intron fragment I; the coding region has a nucleotide sequence as shown in SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22 or SEQ ID NO: 24.

[0030] In some embodiments, the method for preparing the circular RNA molecule comprises the following steps:

[0031] S1, synthesizing a gene fragment comprising, from the 5' end to the 3' end, intron fragment II, translation initiation element truncated fragment II, coding region, polyAC element, translation initiation element truncated fragment I and intron fragment and cloning it into the pUC57 vector to obtain a DNA vector;

[0032] S2. The DNA vectors are transformed into DH5α competent cells to obtain engineered bacteria; the engineered bacteria are subjected to plasmid extraction and sequencing to verify that the sequence is correct;

[0033] S3. The engineered bacterial plasmid with the correct sequence is digested and purified to obtain a linearized plasmid;

[0034] S4, transcribing the linearized plasmid to obtain linear RNA;

[0035] S5. Circularization to obtain circular RNA.

[0036] In step S4, a LiCl solution is added to the transcription product for precipitation, and a linear RNA precipitate is obtained by centrifugation. The precipitate is resuspended in enzyme-free water to obtain a linear RNA aqueous solution; the linear RNA aqueous solution is cyclized, concentrated, purified by HPLC, and concentrated by ultrafiltration to obtain a circular RNA molecule.

[0037] As one embodiment of the present invention, the vaccine further comprises an ionizable cationic lipid carrier. By encapsulating the circular RNA into the lipid carrier, the body's uptake efficiency of the circular RNA can be improved, while also improving the storage stability of the circular RNA.

[0038] As one embodiment of the present invention, the ionizable cationic lipid carrier is a lipid nanoparticle, and the raw material composition of the lipid nanoparticle includes, by molar percentage, 45%-55% of cationic lipid, 35%-44% of cholesterol, 3%-10% of neutral lipid and 0.8%-1.8% of PEG-modified lipid; the cationic lipid is CMAX4; the cholesterol is 5-cholesten-3β-ol; the neutral lipid is DSPC or DOPE; and the PEG-modified lipid is PEG-DMG, PEG-DSG or PEG-DPG.

[0039] As an embodiment of the present invention, the circular RNA vaccine for canine melanoma further comprises a cryoprotectant, wherein the cryoprotectant composition includes but is not limited to at least one of sucrose, trehalose, and mannitol.

[0040] In the circular RNA vaccine, the content of the cryoprotectant is 5%-20% (w / v).

[0041] Compared with the prior art, the present invention has the following beneficial effects:

[0042] 1) Currently, there are no reports of canine melanoma mRNA antigens. The present invention optimizes and enhances the immunogenicity of canine tyrosinase, stimulates the immune system to recognize canine tyrosinase, and simultaneously uses circular RNA technology and LNP delivery technology to prepare a canine tyrosinase circular RNA vaccine, which highly expresses the optimized canine tyrosinase in vivo, thereby activating the immune system to produce a therapeutic effect on canine melanoma.

[0043] 2) Compared with the disclosed DNA vaccine human tyrosinase antigen, the canine melanoma vaccine prepared with the antigen of the present invention has more similar antigenic epitopes and T cell epitopes to the tyrosinase endogenously expressed in canine melanoma, is more likely to activate specific T cells in vivo, produces better therapeutic effects, and prolongs the survival of sick dogs.

[0044] 3) The circular RNA vaccine of the present invention has a lower immunization dose, is safe for sick dogs, and has no side effects. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings:

[0046] Figure 1 Capillary electrophoresis diagrams of different circular RNAs synthesized in vitro;

[0047] Figure 2 This is a graph showing the cellular immunity intensity induced by dogs immunized with different circular RNA vaccines;

[0048] Figure 3 Survival curves for dogs with melanoma treated with three circular RNA vaccines. DETAILED DESCRIPTION

[0049] The present invention will be described in detail below with reference to specific embodiments. The following embodiments will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those skilled in the art, several variations and improvements can be made without departing from the scope of the present invention. These all fall within the scope of protection of the present invention.

[0050] Example 1. Gene design and synthesis

[0051] Tyrosinase is a self-protein that is highly expressed during the growth and deterioration of melanoma. In order to break through the body's autoimmune barriers and enable high expression of circular RNA vaccines in the body, the present invention designs different tyrosinase antigens and optimizes the mRNA sequence to achieve high expression of circular RNA vaccines and break through autoimmunity, including canine tyrosinase dTYR, human tyrosinase hTYR, mouse tyrosinase mTYR, enhanced canine tyrosinase dTYR-ConA, enhanced canine tyrosinase dTYR-T113G, enhanced canine tyrosinase dTYR-K115T and enhanced canine tyrosinase dTYR-L87T.

[0052] The amino acid sequences and nucleotide sequences of the circular RNA coding regions corresponding to each antigen are as follows:

[0053] The amino acid sequence of canine tyrosinase dTYR is shown in SEQ ID NO: 1. The nucleotide sequence of canine tyrosinase dTYR is shown in SEQ ID NO: 2.

[0054] The amino acid sequence of human tyrosinase hTYR is shown in SEQ ID NO: 13. The nucleotide sequence of human tyrosinase hTYR is shown in SEQ ID NO: 14.

[0055] The amino acid sequence of mouse tyrosinase mTYR is shown in SEQ ID NO: 15. The nucleotide sequence of mouse tyrosinase mTYR is shown in SEQ ID NO: 16.

[0056] The amino acid sequence of the enhanced canine tyrosinase dTYR-ConA is shown in SEQ ID NO: 17. The nucleotide sequence of the enhanced canine tyrosinase dTYR-ConA is shown in SEQ ID NO: 18.

[0057] The amino acid sequence of the enhanced canine tyrosinase dTYR-T113G is shown in SEQ ID NO: 19. The nucleotide sequence of the enhanced canine tyrosinase dTYR-T113G is shown in SEQ ID NO: 20.

[0058] The amino acid sequence of the enhanced canine tyrosinase dTYR-K115T is shown in SEQ ID NO: 21. The nucleotide sequence of the enhanced canine tyrosinase dTYR-K115T is shown in SEQ ID NO: 22.

[0059] The amino acid sequence of the enhanced canine tyrosinase dTYR-L87T is shown in SEQ ID NO: 23. The nucleotide sequence of the enhanced canine tyrosinase dTYR-L87T is shown in SEQ ID NO: 24.

[0060] The nucleotide sequences of the above-mentioned antigens are described in patent CN114438127A to form each antigen target coding region, and intron fragment II and translation initiation element truncation fragment II are added before each antigen target coding region; polyAC element, translation initiation element truncation fragment I and intron fragment I are added after each antigen target coding region to form a linear RNA for preparing circular RNA.

[0061] The nucleotide sequence of intron fragment II is shown in SEQ ID NO: 25.

[0062] The nucleotide sequence of the translation initiation element truncated fragment II is as follows (SEQ ID NO: 26):

[0063] CTACTAAACTAGATATAGTTACATTTAAAACTCTTCTTTATATCATACAGTTGAATAGTAGAAAGAGAAA.

[0064] The polyAC nucleotide sequence is as follows (SEQ ID NO: 27):

[0065] AAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAAAACAAAAA ACAAAAAAAAAACAAAAAACAAAACAAAAAACAAAAAACAAAACAAAAAACA AAAAACAAAA.

[0066] The nucleotide sequence of the translation initiation element truncated fragment I is shown in SEQ ID NO: 28.

[0067] The nucleotide sequence of intron fragment 1 is as follows (SEQ ID NO: 29):

[0068] TAATTGAGGCCTGAGTATAAGGTGACTTATACTTGTAATCTATCTAAACGGG GAACCTCTCTAGTAGACAATCCCGTGCTAAATTGTAGGACTACCGTCAGTTGCTC ACTGTGCATCAGATT.

[0069] The above gene fragments were synthesized and cloned into the pUC57 vector by Suzhou Jinweizhi Biotechnology Co., Ltd., resulting in the recombinant plasmids P-dTYR, P-hTYR, P-mTYR, P-dTYR-ConA, P-dTYR-T113G, P-dTYR-K115T, and P-dTYR-L87T, all verified correct by gene sequencing. Linear RNA was transcribed from the vector DNA, and circular RNA was formed from the linear RNA according to the following mechanism: A ribozyme recognizes the junction between the translation initiation element truncated fragment I (IRES fragment I) and intron fragment I, first cleaving it and releasing intron fragment I. Then, a ribozyme recognizes the junction between the translation initiation element truncated fragment II (IRES fragment II) and intron fragment II, cleaving it and releasing intron fragment II. The 3' end of the translation initiation element truncated fragment I ligates to the 5' end of the translation initiation element truncated fragment II to form a circular molecule.

[0070] Example 2. Preparation of circular RNA

[0071] (a) Bacterial Preparation: The DNA vectors synthesized in Example 1 were transformed into DH5α competent cells, spread onto LB medium plates containing 100 μg / ml ampicillin, and cultured at 37°C. When colonies on the plates were clearly visible, single colonies were picked and transferred to 3 ml of LB liquid medium containing 100 μg / ml ampicillin. The culture was then incubated at 37°C. 1 ml of the bacterial suspension was then added to a final concentration of 8% glycerol and stored frozen at -80°C. The resulting engineered strains were designated DH5α-dTYR, DH5α-hTYR, DH5α-mTYR, DH5α-dTYR-ConA, DH5α-dTYR-T113G, DH5α-dTYR-K115T, and DH5α-dTYR-L87T. These served as seed strains for subsequent experiments.

[0072] (b) Plasmid extraction: The engineered bacteria prepared in the previous step were activated at 37°C / 220 rpm for 3-4 h; the activated bacterial solution was taken for expansion culture under the following culture conditions: overnight culture at 37°C / 220 rpm with shaking; plasmids were extracted using a commercial kit (Tiangen Endotoxin-Free Plasmid Extraction Kit), and the sequence was verified to be correct by sequencing.

[0073] (c) Plasmid digestion and purification: The plasmid was digested with the restriction endonucleases BsaI (Nearshore protein) / BsaI (Takara) using the following digestion system: 10× buffer: 100 μl, plasmid: 5 mg, BsaI: 150 μl (5000 U), and water was added to 1000 μl. Digestion was incubated at 37°C overnight. After digestion, the digestion product was column purified using a commercial DNA recovery kit (TIANGEN) to obtain a linearized plasmid.

[0074] (d) In vitro transcription: The transcription system is configured as shown in Table 1 below:

[0075] Table 1

[0076]

[0077]

[0078] Reaction conditions: Constant temperature shaking reaction at 37°C / 220 rpm for 2-4 hours, then add 2 ml of deoxyribonuclease I (DNase I) to the transcription system and constant temperature shaking reaction at 37°C / 220 rpm for 15 minutes.

[0079] (e) Precipitation of RNA: LiCl solution (final concentration 2.5 M) was added to the transcript obtained above and allowed to precipitate at -20°C overnight. The overnight treated solution was centrifuged to obtain an RNA precipitate, which was dried at room temperature and resuspended in enzyme-free water to obtain a linear RNA aqueous solution.

[0080] (f) RNA cyclization and concentration: The cyclization system and conditions are shown in Table 2 below:

[0081] Table 2

[0082]

[0083] The above solution was thoroughly mixed and heated at 55°C for 15 minutes. The circularized RNA product was concentrated by ultrafiltration and the filtrate was discarded; the ultrafiltration liquid was transferred to a new centrifuge tube.

[0084] (g) Circular RNA HPLC purification: Circular RNA was separated using a SEC-1000 (SEPAX) column in a 150 mM phosphate buffer mobile phase, and the main peak component was collected.

[0085] (h) Ultrafiltration and concentration of purified circular RNA: The circular RNA is concentrated by centrifugation in an ultrafiltration tube and the filtrate is discarded; enzyme-free water is added to the ultrafiltration tube and the circular RNA is washed twice; the ultrafiltration liquid is transferred to a new centrifuge tube.

[0086] (i) Circular RNA molecules were successfully prepared (see Table 3), numbered cmRNA-dTYR, cmRNA-hTYR, cmRNA-mTYR, cmRNA-dTYR-ConA, cmRNA-dTYR-T113G, cmRNA-dTYR-K115T, and cmRNA-dTYR-L87T, and RNA was tested and qualified according to the following items:

[0087] 1) Identification: Each RNA was sequenced and found to be qualified and consistent with the target sequence.

[0088] 2) Concentration analysis: The concentration of RNA was measured by UV spectrophotometer. The results are shown in Table 3.

[0089] 3) Integrity analysis: The RNA purity was determined by capillary gel electrophoresis (CGE), which was not less than 80%. The results are shown in Table 3 and Figure 1 shown.

[0090] Table 3

[0091] circular RNA molecules purity / % Concentration / mg / ml cmRNA-dTYR 89 2.6 cmRNA-hTYR 93 2.3 cmRNA-mTYR 96 2.4 cmRNA-dTYR-ConA 92 2.9 cmRNA-dTYR-T113G 94 2.8 cmRNA-dTYR-K115T 92 3.0 cmRNA-dTYR-L87T 90 3.1

[0092] Example 3. Preparation of canine melanoma circular RNA vaccine

[0093] (1) Preparation of solution I: cationic lipid CMAX4, cholesterol (5-cholesten-3β-ol), neutral lipid DSPC (distearoylphosphatidylcholine), and PEG-modified lipid PEG-DMG (polyethylene glycol-dimyristate) were dissolved in ethanol at a lipid molar ratio of 50:38.5:10:1.5 to obtain solution I.

[0094] Among them, the cationic lipid CMAX4 (4-[(3-{[3-({3-[bis(3-{4-[(2-butyloctanoyl)oxy]butoxy}-3-oxypropyl)amino]propyl}(methyl)amino)propyl](3-{4-[(2-butyloctanoyl)oxy]butoxy}-3-oxypropyl)amino}propoxy)oxy]butyl 2-octanoate) was purchased from Suzhou Cremaide Biopharmaceutical Technology Co., Ltd., and cholesterol (5-cholesten-3β-ol), neutral lipid DSPC (distearoylphosphatidylcholine), and PEG-modified lipid PEG-DMG (polyethylene glycol-dimyristate) were purchased from Avituo (Shanghai) Pharmaceutical Technology Co., Ltd.

[0095] (2) Preparation of Solution II: The circular RNA prepared in Example 2 was dissolved in 10 mM citric acid buffered saline solution at pH 4.0 and diluted to a final concentration of 200 μg / mL to obtain Solution II.

[0096] (3) Solution I and solution II were rapidly mixed at a volume ratio of 1:3 using microfluidics technology, and the buffer environment was replaced with PBS at pH 7.4 using tangential flow technology to remove ethanol, thereby preparing LNP-mRNA.

[0097] (4) Add cryoprotectant: Use Quant-iT TM RiboGreen TM RNA Assay Kit (Invitrogen TMR11490) kit was used to determine the mRNA concentration in the prepared LNP-mRNA, and the encapsulation efficiency was calculated. The LNP-mRNA solution was diluted to 50 ug / ml, and sucrose was added to a final concentration of 8% (w / v). After sterile filtration, the solution was aliquoted and frozen to obtain the circular RNA vaccines V-dTYR, V-hTYR, V-mTYR, V-dTYR-ConA, V-dTYR-T113G, V-dTYR-K115T, and V-dTYR-L87T, respectively.

[0098] (5) The particle size, polydispersity index (PDI), and surface potential of the LNP particles of the seven circular RNA vaccines were measured using a dynamic light scattering method on a Malvern Zetasizer Nano-ZEN 3600 (Malvern). The results are shown in Table 4:

[0099] Table 4

[0100] serial number Particle size (nm) PDI Surface potential (mV) Encapsulation efficiency (%) V-dTYR 102 0.13 -7.3 92 V-hTYR 106 0.11 -7.5 89 V-mTYR 95 0.16 -7.1 95 V-dTYR-ConA 98 0.12 -6.9 90 V-dTYR-T113G 91 0.19 -6.7 91 V-dTYR-K115T 99 0.14 -7.1 92 V-dTYR-L87T 96 0.12 -7.2 93

[0101] Example 4: Canine Immunization and Effect Detection

[0102] Beagle dogs aged 7-8 months were randomly divided into 8 groups, with 3 dogs in each group. The circular RNA vaccine prepared in Example 3 was used for intramuscular immunization at a dose of 50ug / dog. PBS was used as a negative control. Immunization was performed at 0 weeks and 3 weeks, respectively. Blood was collected on the 35th day after immunization, and PBMC in the blood was separated using lymphocyte separation fluid (Biyuntian). The number of antigen-specific T cells was detected using a canine IFN-gamma ELISPOT kit (R&D systems). The polypeptide pool is a canine tyrosinase 10aa, 5aa overlap polypeptide fragment, which was synthesized by GenScript Bio. The polypeptide pool stimulation concentration is 5ug / well. The PBMC cell plating concentration is 1*10E5 / well, and the reaction color is developed after 72h of polypeptide stimulation culture. The ELISPOT detection plate is automatically collected, counted and analyzed by an immunospot analyzer, and the results are as follows. Figure 2 The results showed that the optimized enhanced canine tyrosinase antigen of the present invention had a higher specific T cell activation level. During the immunization period, the experimental dogs in each group grew well and had no toxic side effects.

[0103] Example 5: Therapeutic Effect of Canine Melanoma Circular RNA Vaccine on Canine Melanoma

[0104] Twenty dogs with melanoma were screened, with an average age of 9 years (7-15 years), and the breeds included Labrador Retrievers, Golden Retrievers, Shepherds, Huskies, Samoyeds, and Alaskan dogs. According to the TNM tumor staging, all dogs were in stage II-III. All dogs were divided into four groups, with 5 dogs in each group, and intramuscularly injected with circular RNA vaccines V-dTYR, V-hTYR, and V-dTYR-K115T, 50ug / dog / time, and PBS, 1ml / dog / time, once a month for 6 consecutive times. After the end of the administration, the dogs were observed for one year. During the experiment, the tumor size was measured once a month by computed tomography to assess the tumor burden, and the complete remission rate and objective remission rate were compared; complete remission (CR): no tumor could be detected by computed tomography; partial remission (PR): the tumor diameter was reduced by more than 30%. Complete remission rate = dogs with complete remission / total number of dogs × 100%; objective remission rate = dogs with complete remission + dogs with partial remission / total number of dogs × 100%. The treatment effect is shown in Table 5. In addition, the survival of all dogs was recorded, and the survival rate of all groups was calculated at the end of the experiment. Figure 3 The treatment results showed that the optimized antigen of the present invention was more effective in suppressing tumors during the treatment period and the subsequent observation period, resulting in less tumor recurrence and longer survival.

[0105] Table 5

[0106]

[0107] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various variations or modifications within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A circular RNA vaccine for treating canine melanoma, characterized in that: The circular RNA vaccine comprises a circular RNA molecule encoding an optimized canine tyrosinase, the amino acid sequence of which is shown in SEQ ID NO:

21.

2. The circular RNA vaccine according to claim 1, characterized in that The circular RNA molecule comprises the elements arranged in the order shown in any one of the following (c) to (d): (c) translation initiation elements and coding elements; (d) translation initiation elements, coding elements, and insertion elements; The coding element encodes the optimized canine tyrosinase; The translation initiation element comprises one or more of the following sequences with translation initiation activity: an IRES sequence, a 5'UTR sequence, a Kozak sequence, a sequence comprising an m6A modification, and a complementary sequence to ribosomal 18S rRNA; the insertion element comprises one or more of the following sequences: an untranslated region sequence, a polyN sequence, an adapter sequence, a ribosomal switch sequence, and a sequence that binds to a transcriptional regulatory factor; wherein, in the polyN sequence, N is selected from at least one of A, T, G, and C.

3. The circular RNA vaccine according to claim 1, characterized in that The circular RNA molecule is formed by further circularization of a linear RNA obtained by transcription of a recombinant nucleic acid molecule, wherein the coding region of the recombinant nucleic acid molecule is a nucleotide sequence as shown in SEQ ID NO:

22.

4. The circular RNA vaccine according to claim 1, characterized in that The circular RNA vaccine also includes a cryoprotectant, which includes but is not limited to at least one of sucrose, trehalose, and mannitol.

Images