A method for separating bacterial membrane proteins

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a method for separating bacterial membrane proteins, comprising the following steps: using an osmotic shock method to separate periplasmic proteins from bacterial liquid, resuspending and incubating the remaining precipitate, and then ultrasonically crushing it to obtain an ultrasonic lysate; removing intact cells from the ultrasonic lysate and centrifuging it, the resulting supernatant is cytoplasmic components and outer membrane components, and the precipitate is resuspended; adding anionic surfactants to the resuspended precipitate, incubating, centrifuging, the resulting supernatant is inner membrane protein, and the precipitate is resuspended to be outer membrane protein. The separation method provided by the present invention is not limited by high-end instruments, and can simply, efficiently and quickly separate protein components of bacterial cells at all levels.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for separating bacterial membrane proteins. Background Art

[0002] Biomembranes have important biological functions, such as providing cell recognition sites, mediating the connection between cells and cells, and cells and matrices, etc. The study of membrane proteins is also becoming a hot spot in protein research. Membrane proteins are the target sites of many drugs. The study of membrane proteins is not only conducive to the study of low-abundance proteins, but also provides targets and marker proteins for drug development and disease diagnosis.

[0003] There are many methods for separating cell membranes. Most of them rely on ultra-high-speed centrifuges with a speed of up to 39,000 rpm. However, there are the following technical problems: (1) The separation effect is poor; (2) The precipitate after centrifugation is difficult to dissolve and the dissolution process is very time-consuming; (3) The separation cycle is long and it is easy to denature the protein. In addition, most ordinary laboratories do not have ultra-high-speed centrifuges, and the separation of membrane proteins is limited by experimental conditions. Therefore, it is necessary to develop a simple, rapid method for separating membrane proteins that does not require large and advanced experimental equipment. Summary of the invention

[0004] In view of the above technical problems, the present invention provides a method for separating bacterial membrane proteins, which is not limited by high-end instruments and can simply, efficiently and quickly separate protein components of bacterial cells at all levels.

[0005] The specific technical solutions provided by the present invention are as follows:

[0006] The present invention provides a method for separating bacterial membrane proteins, comprising the following steps:

[0007] The periplasmic proteins were separated from the bacterial solution by osmotic shock, and the remaining precipitate was resuspended and incubated before being ultrasonically disrupted to obtain an ultrasonic lysate;

[0008] The ultrasonic lysate was centrifuged to remove intact cells, and centrifuged at 10,000 to 12,000 g for 1 to 1.5 h. The supernatant was the cytoplasmic components and outer membrane components, and the precipitate was resuspended;

[0009] An anionic surfactant is added to the resuspended precipitate, incubated, and centrifuged at 12000-15000g for 25-40 minutes. The obtained supernatant is the inner membrane protein, and the resuspended precipitate is the outer membrane protein.

[0010] Preferably, the specific separation process of the periplasmic protein comprises the following steps:

[0011] After the bacterial liquid is added to a Tris-HCl buffer containing sucrose and EDTA and resuspended, water is added for ice bath, and centrifuged at 12000-15000g for 15-20 minutes, and the obtained supernatant is filtered to obtain the periplasmic protein. Since many proteins can produce polymers through metal ions, in order to avoid the protein from producing polymers and thus affecting subsequent separation, the present invention adds EDTA to chelate with metal ions, thereby avoiding the presence of metal ions; in addition, EDTA as a chelating agent can inhibit metalloproteinases, thereby preventing protein degradation.

[0012] Preferably, the concentration of sucrose in the Tris-HCl buffer is 0.45-0.6 mM, and the concentration of EDTA is 0.45-0.55 M.

[0013] Preferably, the anionic surfactant is N-laurylsarcosy, sodium dodecyl sulfate (SDS), sodium stearate or an amino acid anionic surfactant. The amino acid anionic surfactant is selected from sodium myristoyl glutamate, sodium lauroyl glutamate, TEA cocoyl glutamate, sodium cocoyl glutamate, disodium sodium cocoyl glutamate, etc.

[0014] Preferably, after adding the anionic surfactant to the resuspended precipitate, the final mass concentration of the anionic surfactant is 2% to 3%.

[0015] Preferably, the ultrasonic lysate is centrifuged at 5000 g and 4° C. for 1 to 1.5 h.

[0016] Preferably, the supernatant obtained after centrifugation of the ultrasonic lysate is filtered through a 0.22 μm filter.

[0017] Preferably, the incubation is carried out at room temperature for 5 to 10 minutes.

[0018] Preferably, the bacterial liquid is the fermentation liquid of Escherichia coli BL21, Escherichia coli engineered bacteria MT strain or Escherichia coli engineered bacteria TC strain.

[0019] Compared with the prior art, the beneficial effects of the present invention are:

[0020] 1. The present invention provides a method for separating bacterial membrane proteins, which has good effects on separating periplasmic proteins, intracellular membrane proteins and extracellular membrane proteins, and can well separate proteins at all levels of cells.

[0021] 2. The method provided by the present invention does not require ultracentrifugation, overcomes the limitations of experimental equipment, greatly reduces experimental costs, shortens the experimental cycle, and has wide application value.

[0022] 3. Each reagent used in the method provided by the present invention can be used as a kit. According to the location of the target protein to be separated, this cell fractionation technology can be used for separation, and proteins in different locations can be separated separately, including periplasmic proteins, cytoplasmic proteins, inner membrane proteins and outer membrane proteins. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the SDS gel electrophoresis diagram of the cytoplasmic proteins and membrane proteins (including inner and outer membrane proteins) separated by the method of Comparative Example 1; wherein lane 1 is the cytoplasmic proteins of Escherichia coli BL21, and lane 2 is its membrane protein component; lane 3 is the cytoplasmic proteins of Escherichia coli MT, and lane 4 is the membrane protein component; lane 5 is the cytoplasmic proteins of Escherichia coli TC, and lane 6 is the membrane protein component;

[0024] Figure 2 This is the SDS gel electrophoresis diagram of the cell inner membrane protein and outer membrane protein separated by the method of Comparative Example 2; wherein lane 1 is the outer membrane protein of Escherichia coli BL21, and lane 2 is its inner membrane protein component; lane 3 is the outer membrane protein of Escherichia coli MT, and lane 4 is the inner membrane protein component;

[0025] Figure 3 It is an SDS gel image of the cell inner membrane protein and outer membrane protein separated by the method of Comparative Example 3; lane 1 is the inner membrane protein of Escherichia coli BL21, lane 2 is its outer membrane protein component; lane 3 is its cytoplasmic protein; lane 4 is the cytoplasmic protein component of recombinant Escherichia coli MT; lane 5 is its inner membrane protein component, and lane 6 is its outer membrane protein component.

[0026] Figure 4 This is the SDS gel electrophoresis diagram of proteins of various components of Escherichia coli BL21 and MT cells separated by the separation method provided in Example 1 of the present invention; wherein lane 1: periplasmic proteins of BL21 bacteria; lane 2: cytoplasmic proteins of BL21 bacteria; lane 3: inner membrane proteins of BL21 bacteria; lane 4: outer membrane proteins of BL21 bacteria. Lane 5: periplasmic proteins of MT bacteria; lane 6: cytoplasmic proteins of MT bacteria; lane 7: inner membrane proteins of MT cells; lane 8: outer membrane proteins of MT bacteria;

[0027] Figure 5This is the SDS gel electrophoresis diagram of proteins of various components of Escherichia coli BL21 and TC cells separated by the separation method provided in Example 2 of the present invention; wherein lane 1: periplasmic proteins of BL21 bacteria; lane 2: cytoplasmic proteins of BL21 bacteria; lane 3: inner membrane proteins of BL21 bacteria; lane 4: outer membrane proteins of BL21 bacteria. Lane 5: periplasmic proteins of TC bacteria; lane 6: cytoplasmic proteins of TC bacteria; lane 7: inner membrane proteins of TC cells; lane 8: outer membrane proteins of TC bacteria. DETAILED DESCRIPTION

[0028] In order to better explain the present invention, the present invention is further explained in detail below in conjunction with specific examples, but the embodiments of the present invention are not limited thereto.

[0029] The preparation method of the reagents used in the embodiments of the present invention is:

[0030] 200mmol / L Tris-HCl, pH=8.0: 24.228g Tris-Base was dissolved in 1L H2O, and then the pH was adjusted to 8.0 with HCl.

[0031] SDS-PAGE buffer: Tris 3.029 g, glycine 14.415 g, SDS 1 g, dissolve in ddH2O, adjust volume to 1 L, pH 8.3.

[0032] 20mM Tris-HCl buffer, pH 8.0: Dissolve 2.4228g Tris-Base in 1L H2O and adjust the pH to 8.0 with HCl.

[0033] N-laurylsarcosy is stored at room temperature.

[0034] The existing technology is based on ultra-high-speed centrifuge for centrifugal separation, with a speed of up to 39000rpm / min or 115000×g. The precipitate after centrifugation is very hard and difficult to dissolve. The present invention first uses sucrose solution to create high osmotic pressure to shrink the cells, and then treats them with low concentration to induce the release of periplasmic proteins. This method is low-cost and simple to operate; after the cells are ultrasonically broken, the lysate is centrifuged (5000g, 4℃, 1h) to remove the interference of intact cells on subsequent separation; in order to separate the inner and outer membrane proteins, anionic surfactants are added to dissolve the cell membrane to achieve the purpose of separating the proteins inside and outside the membrane. After the cells are dissolved, ordinary centrifuges can be used for centrifugation (15000g, centrifugation for 30min) to achieve the separation of proteins inside and outside the membrane, and other solvents act as protein buffers.

[0035] The recombinant E. coli MT used in the present invention is constructed according to the following method: (the construction method of the recombinant E. coli TC is the same as that of MT, and TC contains 73 amino acids, which will not be repeated here):

[0036] The polypeptide MT contains 61 amino acids. The codon sequence of the MT polypeptide gene is obtained by reversing the amino acid sequence and is optimized by the codon preference of Escherichia coli. The N-terminal domain of ice nucleation protein (INP-N) gene sequence comes from Pseudomonas syringae KCTC1832 (sequence number AF013159 in NCBI). This protein is an outer membrane protein. The MT and INP-N genes were synthesized by BGI (Beijing). The synthesized INP-N gene was used as a template, and primers 7INP-F2B and Mt2-R were used as forward and reverse primers, respectively, to obtain the INP-N gene sequence by PCR amplification. Primers I / Mt2-F and I / Mt2-R were used as forward and reverse primers, respectively, and the synthesized gene MT was used as a template to obtain the MT gene fragment by PCR expansion. Primers 7INP-F2B and I / Mt2-R were used as forward and reverse primers, respectively, and the above two PCR products were used as templates to perform Overlap PCR was used to fuse the INP-N and MT genes together, and the fusion gene fragment and plasmid pET-23b were digested with restriction endonucleases EcoRI and XhoI (Takara, Japan) (12h, 37℃), and the above digestion products were ligated with T4 ligase (Takara, Japan) (4℃ overnight) to form a recombinant plasmid. The recombinant plasmid containing the INP-N-MT gene was named pET23 / INP-N-MT.

[0037] PCR reaction system: The PCR system is 25 μl, including: 5×PCR buffer 5 μl, dNTP 2 μl, upstream and downstream primers 1 μl each, Taq enzyme 0.25 μl, template 1 μl, ddH2O 14.75 μl.

[0038] Overlap PCR reaction system: The PCR system is 25μl, including: 5×PCR buffer 5μl, dNTP 2μl, upstream and downstream primers 1μl each, Taq enzyme 0.25μl, two PCR product templates 1μl each, ddH2O 13.75μl.

[0039] The PCR reaction program was as follows: preheating at 94°C for 1 min, denaturation at 98°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 45 s, 30 cycles, and finally at 72°C for 7 min.

[0040] Enzyme digestion reaction system (20 μl):

[0041]

[0042] The gene sequence of polypeptide MT is shown in SEQ ID NO.1:

[0043] ATGGATCCGAATTGCAGCTGCGCGACCGATGGCAGCTGCAGCTGCGCGGGCAGCTGCAAATGCAAACAGTGCAAATGCACCAGCTGCAAAAAAAGCTGCTGCAGCTGCTGCCCGGTGGGCTGCGCGAAATGCAGCCAGGGCTGCATTTGCAAAGAAGCGAGCGATAAATGCAGCTGCTGCGCG

[0044] The gene sequence of the N-terminal domain of ice nucleation protein is shown in SEQ ID NO.2:

[0045] ATGACTCTCGACAAGGCGTTGGTGCTGCGTACCTGTGCAAATAACATGGCCGATCACTGCGGCCTTATATGGCCCGCGTCCGGCACGGTGGAATCCAGATACTGGCAGTCAACCAGGCGGCATGAGAATGGTCTGGTCGGTTTACTGTGGGGCGCTGGAACCAGCGCTTTTCTAAGCGTGCATGCCGATGCTCGATGGATTGT CTGTGAAGTTGCCGTTGCAGACATCATCAGTCTGGAAGAGCCGGGAATGGTCAAGTTTCCGCGGGCCGAGGTGGTTCATGTCGGCGACAGGATCAGCGCGTCACACTTCATTTCGGCACGTCAGGCCGACCCTGCGTCAACGTCAACGTCAACGTCAACGTCAACGTTAACGCCAATGCCTACGGCCATACCCACGCCCATGCCTGCGGTAGCAAGTGTCACGTTACCGGTGGCCGAACAGGCCCGTCATGAAGTGTTCGATGTCGCGTCGGTCAGCGCGGCTGCCGCCCCAGTAAACACCCTGCCGGTGACGACGCCGCAGAATTTGCAGACC

[0046] The primer sequences used for constructing the MT recombinant

[0047] (1) 7INP-F2B:

[0048] 5'CCGGAATTCTATGACTCTCGACAAGGCGTT 3', as shown in SEQ ID NO. 3;

[0049] (2)Mt2-R:

[0050] 5'CCGCTCGAGCGCGCAGCAGCAGCATTTAT 3', as shown in SEQ ID NO. 4;

[0051] (3)I / Mt2-R:

[0052] 5'GCAATTCGGATCCATGGTCTGCAAATTCTGCGGCG 3', as shown in SEQ ID NO.5;

[0053] (4)I / Mt2-F:

[0054] 5'CAGAATTTGCAGACCATGGATCCGAATTGCAGCTG 3', as shown in SEQ ID NO.6.

[0055] The recombinant plasmid was transformed into competent DH5α, and after 16 h of culture, the recombinant plasmid was extracted and sequenced, and the correct recombinant plasmid was transformed into E. coli BL21 (DE3) cells. The E. coli containing the plasmid pET23 / INP-N-MT was named E. coli MT.

[0056] Example 1

[0057] A method for separating bacterial membrane proteins comprises the following steps:

[0058] (1) E. coli BL21 and recombinant E. coli MT were inoculated into LB medium at a 1% inoculum, respectively, and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. The culture was centrifuged at 12000 g for 5 min, 1 mL of the bacterial suspension was collected, washed twice with PBS, and resuspended in 100 μl of SDS-PAGE buffer for lysis.

[0059] (2) Add 20 mM Tris-HCl buffer to the above lysate and resuspend in 15 μl of 4°C TES buffer. Resuspend at room temperature for 20 min, shaking every 2 min.

[0060] TES buffer: 0.2 M Tris-HCl, 0.5 M EDTA, 0.5 mM sucrose, pH 8.0.

[0061] (3) Add 22.5 μl of 4°C distilled water, place on ice for 30 min, centrifuge at 12,000 g for 20 min, filter the supernatant with a 0.22 μm filter to obtain periplasmic proteins, resuspend the precipitate in 10 mM Tris-HCl buffer, and incubate on ice for 1 h;

[0062] (4) Ultrasonic disruption, centrifugation of the lysate at 5000g, 4°C for 1 h, removal of intact cells, filtration of the supernatant with 0.22 μm, centrifugation of the filtrate at 10000g, 4°C for 1 h, the supernatant obtained is the cytoplasmic component and the outer membrane component, and the precipitate is the total membrane component. The precipitate is resuspended in sterile water to separate the inner membrane and the outer membrane in the subsequent steps.

[0063] (5) Add N-laurylsarcosy to the precipitate to a final concentration of 2%, incubate at room temperature for 5 min, centrifuge at 15000 g for 30 min, the supernatant is the inner membrane protein, and the precipitate is resuspended in 20 μl of 2% SDS buffer as the outer membrane protein.

[0064] Example 2

[0065] A method for separating bacterial membrane proteins comprises the following steps:

[0066] (1) E. coli BL21 and recombinant E. coli TC were inoculated into LB medium at a 1% inoculum, respectively, and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. The culture was centrifuged at 12000 g for 5 min, 1 mL of the bacterial suspension was collected, washed twice with PBS, and resuspended in 100 μl of SDS-PAGE buffer for lysis.

[0067] (2) Add 20 mM Tris-HCl buffer to the above lysate and resuspend in 15 μl of 4°C TES buffer. Resuspend at room temperature for 20 min, shaking every 2 min.

[0068] TES buffer: 0.2 M Tris-HCl, 0.5 M EDTA, 0.5 mM sucrose, pH 8.0.

[0069] (3) Add 22.5 μl of 4°C distilled water, place on ice for 30 min, centrifuge at 12,000 g for 20 min, filter the supernatant with a 0.22 μm filter to obtain periplasmic proteins, resuspend the precipitate in 10 mM Tris-HCl buffer, and incubate on ice for 1 h;

[0070] (4) Ultrasonic disruption, centrifugation of the lysate at 5000g, 4°C for 1 h, removal of intact cells, filtration of the supernatant with 0.22 μm, centrifugation of the filtrate at 10000g, 4°C for 1 h, the supernatant obtained is the cytoplasmic component and the outer membrane component, and the precipitate is the total membrane component. The precipitate is resuspended in sterile water to separate the inner membrane and the outer membrane in the subsequent steps.

[0071] (5) Add N-laurylsarcosy to the precipitate to a final concentration of 3%, incubate at room temperature for 5 min, centrifuge at 15000 g for 30 min, the supernatant is the inner membrane protein, and the precipitate is resuspended in 20 μl of 2% SDS buffer as the outer membrane protein.

[0072] Example 3

[0073] A method for separating bacterial membrane proteins comprises the following steps:

[0074] (1) Escherichia coli BL21 was inoculated into LB medium at a 1% inoculum size and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. The culture was centrifuged at 12,000 g for 5 min, 1 mL of the bacterial suspension was collected, washed twice with PBS, and resuspended in 100 μl of SDS-PAGE buffer to lyse the bacteria.

[0075] (2) Add 20 mM Tris-HCl buffer to the above lysate and resuspend in 15 μl of 4°C TES buffer. Resuspend at room temperature for 20 min, shaking every 2 min.

[0076] TES buffer: 0.2 M Tris-HCl, 0.5 M EDTA, 0.6 mM sucrose, pH 8.0.

[0077] (3) Add 22.5 μl of 4°C distilled water, place on ice for 30 min, centrifuge at 12,000 g for 20 min, filter the supernatant with a 0.22 μm filter to obtain periplasmic proteins, resuspend the precipitate in 10 mM Tris-HCl buffer, and incubate on ice for 1 h;

[0078] (4) Ultrasonic disruption, centrifugation of the lysate at 5000g, 4°C for 1 h, removal of intact cells, filtration of the supernatant with 0.22 μm, centrifugation of the filtrate at 10000g, 4°C for 1 h, the supernatant obtained is the cytoplasmic component and the outer membrane component, and the precipitate is the total membrane component. The precipitate is resuspended in sterile water to separate the inner membrane and the outer membrane in the subsequent steps.

[0079] (5) Add N-laurylsarcosy to the precipitate to a final concentration of 3%, incubate at room temperature for 5 min, centrifuge at 15000 g for 30 min, the supernatant is the inner membrane protein, and the precipitate is resuspended in 20 μl of 2% SDS buffer as the outer membrane protein.

[0080] Example 4

[0081] A method for separating bacterial membrane proteins comprises the following steps:

[0082] (1) Escherichia coli BL21 was inoculated into LB medium at a 1% inoculum size and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. The culture was centrifuged at 12,000 g for 5 min, 1 mL of the bacterial suspension was collected, washed twice with PBS, and resuspended in 100 μl of SDS-PAGE buffer to lyse the bacteria.

[0083] (2) Add 20 mM Tris-HCl buffer to the above lysate and resuspend in 15 μl of 4°C TES buffer. Resuspend at room temperature for 20 min, shaking every 2 min.

[0084] TES buffer: 0.2 M Tris-HCl, 0.5 M EDTA, 0.45 mM sucrose, pH 8.0.

[0085] (3) Add 22.5 μl of 4°C distilled water, place on ice for 30 min, centrifuge at 12,000 g for 20 min, filter the supernatant with a 0.22 μm filter to obtain periplasmic proteins, resuspend the precipitate in 10 mM Tris-HCl buffer, and incubate on ice for 1 h;

[0086] (4) Ultrasonic disruption, centrifugation of the lysate at 5000g, 4°C for 1 h, removal of intact cells, filtration of the supernatant with 0.22 μm, centrifugation of the filtrate at 10000g, 4°C for 1 h, the supernatant obtained is the cytoplasmic component and the outer membrane component, and the precipitate is the total membrane component. The precipitate is resuspended in sterile water to separate the inner membrane and the outer membrane in the subsequent steps.

[0087] (5) Add N-laurylsarcosy to the precipitate to a final concentration of 3%, incubate at room temperature for 5 min, centrifuge at 15000 g for 30 min, the supernatant is the inner membrane protein, and the precipitate is resuspended in 20 μl of 2% SDS buffer as the outer membrane protein.

[0088] Example 5

[0089] A method for separating bacterial membrane proteins comprises the following steps:

[0090] (1) Escherichia coli BL21 was inoculated into LB medium at a 1% inoculum size and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. The culture was centrifuged at 12,000 g for 5 min, 1 mL of the bacterial suspension was collected, washed twice with PBS, and resuspended in 100 μl of SDS-PAGE buffer to lyse the bacteria.

[0091] (2) Add 20 mM Tris-HCl buffer to the above lysate and resuspend in 15 μl of 4°C TES buffer. Resuspend at room temperature for 20 min, shaking every 2 min.

[0092] TES buffer: 0.2 M Tris-HCl, 0.45 M EDTA, 0.5 mM sucrose, pH 8.0.

[0093] (3) Add 22.5 μl of 4°C distilled water, place on ice for 30 min, centrifuge at 12,000 g for 20 min, filter the supernatant with a 0.22 μm filter to obtain periplasmic proteins, resuspend the precipitate in 10 mM Tris-HCl buffer, and incubate on ice for 1 h;

[0094] (4) Ultrasonic disruption, centrifugation of the lysate at 5000g and 4°C for 1 h, removal of intact cells, filtration of the supernatant with 0.22 μm, centrifugation of the filtrate at 12000g and 4°C for 1.5 h, the supernatant obtained is the cytoplasmic component and the outer membrane component, and the precipitate is the total membrane component. The precipitate is resuspended in sterile water to separate the inner membrane and the outer membrane in the subsequent steps.

[0095] (5) Add N-laurylsarcosy to the precipitate to a final concentration of 3%, incubate at room temperature for 5 min, centrifuge at 15000 g for 30 min, the supernatant is the inner membrane protein, and the precipitate is resuspended in 20 μl of 2% SDS buffer as the outer membrane protein.

[0096] Example 6

[0097] A method for separating bacterial membrane proteins comprises the following steps:

[0098] (1) Escherichia coli BL21 was inoculated into LB medium at a 1% inoculum size and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. The culture was centrifuged at 12,000 g for 5 min, 1 mL of the bacterial suspension was collected, washed twice with PBS, and resuspended in 100 μl of SDS-PAGE buffer to lyse the bacteria.

[0099] (2) Add 20 mM Tris-HCl buffer to the above lysate and resuspend in 15 μl of 4°C TES buffer. Resuspend at room temperature for 20 min, shaking every 2 min.

[0100] TES buffer: 0.2 M Tris-HCl, 0.55 M EDTA, 0.5 mM sucrose, pH 8.0.

[0101] (3) Add 22.5 μl of 4°C distilled water, place on ice for 30 min, centrifuge at 12,000 g for 20 min, filter the supernatant with a 0.22 μm filter to obtain periplasmic proteins, resuspend the precipitate in 10 mM Tris-HCl buffer, and incubate on ice for 1 h;

[0102] (4) Ultrasonic disruption, centrifugation of the lysate at 5000g and 4°C for 1.5 h, removal of intact cells, filtration of the supernatant with 0.22 μm, centrifugation of the filtrate at 10000g and 4°C for 1 h, the supernatant obtained is the cytoplasmic component and the outer membrane component, and the precipitate is the total membrane component. The precipitate is resuspended in sterile water to separate the inner membrane and the outer membrane in the subsequent steps.

[0103] (5) Add N-laurylsarcosy to the precipitate to a final concentration of 3%, incubate at room temperature for 5 min, centrifuge at 15000 g for 30 min, the supernatant is the inner membrane protein, and the precipitate is resuspended in 20 μl of 2% SDS buffer as the outer membrane protein.

[0104] Example 7

[0105] A method for separating bacterial membrane proteins comprises the following steps:

[0106] (1) Escherichia coli BL21 was inoculated into LB medium at a 1% inoculum size and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. The culture was centrifuged at 12,000 g for 5 min, 1 mL of the bacterial suspension was collected, washed twice with PBS, and resuspended in 100 μl of SDS-PAGE buffer to lyse the bacteria.

[0107] (2) Add 20 mM Tris-HCl buffer to the above lysate and resuspend in 15 μl of 4°C TES buffer. Resuspend at room temperature for 20 min, shaking every 2 min.

[0108] TES buffer: 0.2 M Tris-HCl, 0.5 M EDTA, 0.5 mM sucrose, pH 8.0.

[0109] (3) Add 22.5 μl of 4°C distilled water, place on ice for 30 min, centrifuge at 12,000 g for 20 min, filter the supernatant with a 0.22 μm filter to obtain periplasmic proteins, resuspend the precipitate in 10 mM Tris-HCl buffer, and incubate on ice for 1 h;

[0110] (4) Ultrasonic disruption, centrifugation of the lysate at 5000g, 4°C for 1 h, removal of intact cells, filtration of the supernatant with 0.22 μm, centrifugation of the filtrate at 10000g, 4°C for 1 h, the supernatant obtained is the cytoplasmic component and the outer membrane component, and the precipitate is the total membrane component. The precipitate is resuspended in sterile water to separate the inner membrane and the outer membrane in the subsequent steps.

[0111] (5) Sodium stearate was added to the precipitate to a final concentration of 3%, and the mixture was incubated at room temperature for 10 min. The mixture was centrifuged at 15,000 g for 30 min. The supernatant was the inner membrane protein, and the precipitate was resuspended in 20 μl of 2% SDS buffer as the outer membrane protein.

[0112] Example 8

[0113] A method for separating bacterial membrane proteins comprises the following steps:

[0114] (1) Escherichia coli BL21 was inoculated into LB medium at a 1% inoculum size and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. The culture was centrifuged at 12,000 g for 5 min, 1 mL of the bacterial suspension was collected, washed twice with PBS, and resuspended in 100 μl of SDS-PAGE buffer to lyse the bacteria.

[0115] (2) Add 20 mM Tris-HCl buffer to the above lysate and resuspend in 15 μl of 4°C TES buffer. Resuspend at room temperature for 20 min, shaking every 2 min.

[0116] TES buffer: 0.2 M Tris-HCl, 0.5 M EDTA, 0.5 mM sucrose, pH 8.0.

[0117] (3) Add 22.5 μl of 4°C distilled water, place on ice for 30 min, centrifuge at 15,000 g for 15 min, filter the supernatant with a 0.22 μm filter to obtain periplasmic proteins, resuspend the precipitate in 10 mM Tris-HCl buffer, and incubate on ice for 1 h;

[0118] (4) Ultrasonic disruption, centrifugation of the lysate at 5000g, 4°C for 1 h, removal of intact cells, filtration of the supernatant with 0.22 μm, centrifugation of the filtrate at 10000g, 4°C for 1 h, the supernatant obtained is the cytoplasmic component and the outer membrane component, and the precipitate is the total membrane component. The precipitate is resuspended in sterile water to separate the inner membrane and the outer membrane in the subsequent steps.

[0119] (5) Add N-laurylsarcosy to the precipitate to a final concentration of 3%, incubate at room temperature for 5 min, centrifuge at 15000 g for 30 min, the supernatant is the inner membrane protein, and the precipitate is resuspended in 20 μl of 2% SDS buffer as the outer membrane protein.

[0120] Example 9

[0121] A method for separating bacterial membrane proteins comprises the following steps:

[0122] (1) Escherichia coli BL21 was inoculated into LB medium at a 1% inoculum size and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. The culture was centrifuged at 12,000 g for 5 min, 1 mL of the bacterial suspension was collected, washed twice with PBS, and resuspended in 100 μl of SDS-PAGE buffer to lyse the bacteria.

[0123] (2) Add 20 mM Tris-HCl buffer to the above lysate and resuspend in 15 μl of 4°C TES buffer. Resuspend at room temperature for 20 min, shaking every 2 min.

[0124] TES buffer: 0.2 M Tris-HCl, 0.5 M EDTA, 0.5 mM sucrose, pH 8.0.

[0125] (3) Add 22.5 μl of 4°C distilled water, place on ice for 30 min, centrifuge at 12,000 g for 20 min, filter the supernatant with a 0.22 μm filter to obtain periplasmic proteins, resuspend the precipitate in 10 mM Tris-HCl buffer, and incubate on ice for 1 h;

[0126] (4) Ultrasonic disruption, centrifugation of the lysate at 5000g, 4°C for 1 h, removal of intact cells, filtration of the supernatant with 0.22 μm, centrifugation of the filtrate at 10000g, 4°C for 1 h, the supernatant obtained is the cytoplasmic component and the outer membrane component, and the precipitate is the total membrane component. The precipitate is resuspended in sterile water to separate the inner membrane and the outer membrane in the subsequent steps.

[0127] (5) SDS was added to the precipitate to a final concentration of 3%, and the mixture was incubated at room temperature for 5 min. The mixture was centrifuged at 15,000 g for 30 min. The supernatant was the inner membrane protein, and the precipitate was resuspended in 20 μL of 2% SDS buffer as the outer membrane protein.

[0128] Comparative Example 1

[0129] A method for separating bacterial cell membrane proteins comprises the following steps:

[0130] (1) E. coli BL21 and recombinant E. coli MT were inoculated into LB medium at 1% inoculum, respectively, and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. 100 mL of bacterial solution was collected and centrifuged at 8000 rpm / min for 15 min, washed twice with PBS, resuspended in 3 mL of binding buffer, and the bacteria were broken with an ultrasonic disruptor;

[0131] (2) Centrifuge at 13000 rpm / min and 4°C for 30 min. The supernatant is cytoplasmic protein and the precipitate is membrane protein component.

[0132] This method ultimately only obtains cytoplasmic proteins, integral membrane proteins and inclusion bodies. It is impossible to completely separate the inner membrane and outer membrane proteins among the membrane proteins, and other WB and other techniques are needed to further prove the location of the proteins.

[0133] Comparative Example 2

[0134] A method for separating bacterial cell membrane proteins comprises the following steps:

[0135] (1) E. coli BL21 and recombinant E. coli MT were inoculated into LB medium at a 1% inoculum, respectively, and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. The cells were collected by centrifugation at 8000 rpm / min for 15 min and washed twice with PBS;

[0136] (2) Resuspend the cells in PBS solution containing 1 mmol / L EDTA and 10 μg / mL lysozyme and adjust the OD 600 value to 1.0.

[0137] (3) After 2 h at room temperature, the pressure was crushed twice at 15,000 psi;

[0138] (4) Centrifuge at 115,000 × g for 1 h and transfer the supernatant, i.e., the cytoplasmic fraction, to a new sterile centrifuge tube;

[0139] (5) The precipitate was resuspended in PBS solution containing 0.01 mmol / L MgCl2 and 2% Triton X-100 and placed at room temperature for 30 min to dissolve the intracellular membrane components;

[0140] (6) Centrifuge at 115,000 × g for 1 h, transfer the supernatant intracellular membrane components to a new sterile centrifuge tube, and the precipitate is the extracellular membrane component;

[0141] (7) Further analysis of the cell components obtained by fractionating equal volumes of cells.

[0142] The protein bands obtained by this method are not clear enough. If the location of the protein needs to be verified, WB and other methods need to be used for further verification.

[0143] Comparative Example 3

[0144] A method for separating bacterial cell membrane proteins comprises the following steps:

[0145] (1) E. coli BL21 and recombinant E. coli MT were inoculated into LB medium at a 1% inoculum, respectively, and cultured at 37°C and 150 rpm / min for 18 h until the OD value reached 2.0. The cells were collected by centrifugation at 8000 rpm / min for 15 min and washed twice with PBS;

[0146] (2) Resuspend in 20 mL of buffer containing 1 mM EDTA and 10 μg / mL lysozyme, incubate at 37°C for 2 h, and then ultrasonicate the sample for 30 s × 4 times until the bacterial solution becomes clear.

[0147] (3) Centrifuge at 5000 r / min for 10 min to remove solid impurities of bacteria, transfer the supernatant to a centrifuge tube for ultracentrifugation, ensure that there is no air in the centrifuge tube, and ultracentrifuge at 39000 r / min for 1 h. The supernatant is separated as cytoplasmic components, and the precipitate is cell membrane and cell impurity components;

[0148] (4) Resuspend the precipitate in PBS containing 0.01 mM MgCl2 and 2% (v / v) Triton X-100, incubate at room temperature for 30 min to dissolve the intracellular membrane components, and then centrifuge at 39,000 rpm for 1 h. The resulting precipitate is the extracellular membrane component, and the supernatant is the intracellular membrane component.

[0149] The present invention uses engineered strains of Escherichia coli MT, TC and Escherichia coli BL21 containing cell membrane anchored proteins, wherein Escherichia coli BL21 is a control strain, and recombinant Escherichia coli MT and TC contain exogenous outer membrane proteins - ice nucleus proteins, and are separated respectively by the methods of comparative examples 1 to 3 and the method provided by the present invention.

[0150] The proteins separated in the examples and comparative examples were subjected to 12% SDS-PAGE gel. Figures 1 to 4 shown.

[0151] Figure 1 This is an SDS gel image of cytoplasmic proteins and membrane proteins (including inner membrane proteins and outer membrane proteins) separated by the method of Comparative Example 1, wherein lane 1 is the cytoplasmic proteins of E. coli BL21, and lane 2 is its membrane protein component; lane 3 is the cytoplasmic proteins of E. coli MT, and lane 4 is the membrane protein component; lane 5 is the cytoplasmic proteins of E. coli TC, and lane 6 is the membrane protein component. Among them, E. coli BL21 is the control strain, while E. coli MT and TC contain the expressed exogenous outer membrane protein ice nucleus protein. This method cannot separate the inner membrane and outer membrane proteins, and it is impossible to study the expression location of the target protein.

[0152] Figure 2This is an SDS gel image of the cell inner membrane protein and outer membrane protein separated by the method of Comparative Example 2, wherein lane 1 is the outer membrane protein of Escherichia coli BL21, and lane 2 is its inner membrane protein component; lane 3 is the outer membrane protein of Escherichia coli MT, and lane 4 is the inner membrane protein component; the cell inner membrane and outer membrane protein bands separated by this method are not clear, indicating that the separation effect is not good, and it is impossible to directly determine whether the target protein is in the inner membrane component or the outer membrane component. Further Western Blot experiments or other fluorescence positioning methods are needed to further identify the two separated components.

[0153] Figure 3 This is an SDS gel image of the inner membrane protein and outer membrane protein separated by the method of Comparative Example 3. Lane 1 is the inner membrane protein of E. coli BL21, lane 2 is its outer membrane protein component; lane 3 is its cytoplasmic protein; lane 4 is the cytoplasmic protein component of recombinant E. coli MT; lane 5 is its inner membrane protein component, and lane 6 is its outer membrane protein component. Although this method can separate the inner membrane and outer membrane proteins by ultra-high-speed centrifugation, the separated membrane protein bands are not clear, especially the outer membrane protein, and the position of the outer membrane protein cannot be accurately determined. If the expression position of the target protein needs to be studied, it cannot be achieved, and further experimental design and Western Blot experiments or other positioning methods are needed for further verification.

[0154] Figure 4 This is an SDS gel image of proteins of various cell components separated by the separation method provided in Example 1 (since the separation effects of the methods provided in Examples 1 to 9 are basically similar, Example 1 is used as an example here to illustrate the effect), wherein lane 1: periplasmic proteins of BL21 bacteria; lane 2: cytoplasmic proteins of BL21 bacteria; lane 3: inner membrane proteins of BL21 bacteria; lane 4: outer membrane proteins of BL21 bacteria. Lane 5: periplasmic proteins of MT bacteria; lane 6: cytoplasmic proteins of MT bacteria; lane 7: inner membrane proteins of MT cells; lane 8: outer membrane proteins of MT bacteria. The inner and outer membrane protein bands of bacterial cells separated by this newly proposed method are very clear, indicating that the separation effect is very good, and it can directly and clearly determine whether the target protein is in the inner membrane component or the outer membrane component.

[0155] Figure 5This is an SDS gel image of proteins of various cell components separated by the separation method provided in Example 2 (since the separation effects of the methods provided in Examples 1 to 9 are basically similar, Example 2 is used as an example to illustrate the effect here), wherein lane 1: periplasmic proteins of BL21 bacteria; lane 2: cytoplasmic proteins of BL21 bacteria; lane 3: inner membrane proteins of BL21 bacteria; lane 4: outer membrane proteins of BL21 bacteria. Lane 5: periplasmic proteins of TC bacteria; lane 6: cytoplasmic proteins of TC bacteria; lane 7: inner membrane proteins of TC cells; lane 8: outer membrane proteins of TC bacteria. The inner and outer membrane protein bands of bacterial cells separated by this newly proposed method are very clear, indicating that the separation effect is very good, and it can directly and clearly determine whether the target protein is in the inner membrane component or the outer membrane component.

[0156] Finally, it should be noted that the above examples are only specific implementation examples of the present invention. Obviously, the present invention is not limited to the above examples, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. A method for separating bacterial membrane proteins, characterized in that: The following steps are involved: The periplasmic protein is separated from the bacterial solution by an osmotic shock method, and the remaining precipitate is resuspended and incubated and then ultrasonically disrupted to obtain an ultrasonic lysate; the specific separation process of the periplasmic protein includes the following steps: The bacterial liquid is added to a Tris-HCl buffer containing sucrose and EDTA, resuspended, and then ice-bathed with water. The mixture is centrifuged at 12000-15000 g for 15-20 min, and the obtained supernatant is filtered to obtain the periplasmic protein. The ultrasonic lysate was centrifuged to remove intact cells, and centrifuged at 10,000-12,000 g for 1-1.5 h. The supernatant was the cytoplasmic components and outer membrane components, and the precipitate was resuspended; Add anionic surfactant to the resuspended precipitate, incubate, centrifuge at 12000~15000g for 25~40 min, the supernatant is the inner membrane protein, and the resuspended precipitate is the outer membrane protein; The anionic surfactant is N-laurylsarcosy; the anionic surfactant is added to the resuspended precipitate to a final concentration of 2% to 3%; The concentration of sucrose in Tris-HCl buffer is 0.45~0.6 mM, the concentration of EDTA is 0.45~0.55 M, and the concentration of Tris-HCl is 0.2 M; pH 8.

0.

2. The separation method according to claim 1, characterized in that The ultrasonic lysate was centrifuged at 5000 g and 4°C for 1-1.5 h.

3. The separation method according to claim 2, characterized in that The supernatant obtained after centrifugation of the sonicated lysate was filtered through a 0.22 μm filter.

4. The separation method according to claim 1, characterized in that The incubation is carried out at room temperature for 5 to 10 min.

5. The separation method according to claim 1, characterized in that The bacterial liquid is the fermentation liquid of Escherichia coli BL21, Escherichia coli engineered bacteria MT strain or Escherichia coli engineered bacteria TC strain.

Images