A method to improve the function of immune response cells

Abstract

This invention relates to a method for improving the function of immune response cells. The invention discloses an immune response cell that expresses at least one receptor capable of binding to antigens and type I interferon. Applying these immune response cells to the treatment of tumors, infectious diseases, and other diseases demonstrates a significantly superior ability to kill tumors or pathogens.

Description

[0001] This application is a divisional application of the invention patent application No. 2017800217918, filed on April 26, 2017, entitled "A method for improving the function of immune response cells". Technical Field

[0002] This invention belongs to the field of immunology, and more specifically, this invention relates to a method for improving the function of immune response cells. Background Technology

[0003] Chimeric antigen receptors (CARs) are artificially recombinant receptors, typically composed of an extracellular antigen recognition domain of a monoclonal antibody, a transmembrane domain, and an intracellular activation signaling domain of the immune response cell. In recent years, the use of CD19-targeting CAR-T cell therapy to treat B-cell leukemia has achieved great success in clinical trials. However, many leukemia patients relapse. Furthermore, it is not effective for all hematological malignancies. In addition, CAR-T cell therapy for solid tumors has shown limited efficacy. Therefore, improving existing CAR-T cell technology and enhancing its anti-tumor activity remains crucial.

[0004] Type I interferons were discovered more than half a century ago. Type I interferons include IFNα protein (a class of 13 identical proteins encoded by human genes, from IFNA1 to IFNA13), IFNβ (encoded by a single human and mouse gene IFNB1), and other less studied interferons such as IFNε, IFNκ, and IFNω (2. Trinchieri, G. Type I interferon: friend or foe? J. Exp. Med. 207, 2053-2063 (2010). 3. Kaur, S. & Platanias, LCIFN-β-specific signaling via a unique IFNAR1 interaction. Nat. Immunol. 14, 884-885 (2013)). Type I interferons are produced by various cell types upon activation of pattern recognition receptors (PRRs). PRRs respond to viral or bacterial components as well as ectopic endogenous molecules (such as cytoplasmic DNA and extracellular DNA and RNA) (Kawai, T. & Akira, S. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat. Immunol.). 11(373–384 (2010)). Type I interferons transmit signals via the isodimer IFNα / β receptor 1 (IFNAR1) (which has a particularly high affinity for IFNβ) or the IFNAR1-IFNAR2 heterodimer (which can bind to all type I interferons). Activation of these receptors leads to upregulation of IFN-stimulating genes (ISGs), triggering numerous immunostimulatory effects (Hervas-Stubbs, S. et al. Direct effects of type I interferons on cells of the immune system. Clin. Cancer Res. 17, 2619; Res.es.mmde; Weerd, NA et al. Structural basis of a unique interferon-β signaling axis mediated via the receptor IFNAR1. Nat. Immunol. 14, 901ol.nol.is; McNab, F., Mayer-Barber, K., Sher, A., Wack, A. & O A. & A. Type I interferons in infectious disease. Nat. Rev. Immunol. 15, 87nol. Immunol.). Previous studies have shown that type I interferons have anti-cancer effects on some tumors, possibly attributed to their immunostimulatory functions. However, systemic administration of type I interferon may have immunosuppressive effects (Lotrich, FEMajor depression during interferon-α treatment: vulnerability and prevention. Dialogues Clin. Neurosci.). 11It is associated with serious adverse events, the most common being fatigue, anorexia, hepatotoxicity, flu-like symptoms and severe depression (Kreutzer, K., Bonnekoh, B., Franke, I., Ulrich, J. & Gollnick, H. Sarcoidosis, myasthenia gravis and anteriorischaemic optic neuropathy: severe side effects of adjuvant interferon-α therapy in malignant melanoma? J. Dtsch. Dermatol. Ges. 2, 689-694 (in German) (2004)). These serious toxic side effects severely limit its application. Summary of the Invention

[0005] This invention overcomes the aforementioned problems and has additional advantages.

[0006] 1. An immune-response cell that expresses a receptor for binding antigens; and exogenous type I interferon.

[0007] 2. The immune response cells as described in item 1, wherein the immune response cells include: T cells, natural killer cells, cytotoxic T lymphocytes, natural killer T cells, DNT cells, and / or regulatory T cells.

[0008] 3. The immune response cells as described in any of the preceding items, wherein the antigen is a tumor antigen or a pathogen antigen.

[0009] 4. The immune response cells as described in any of the preceding items, wherein the exogenous type I interferon is constitutively expressed or inducibly expressed; preferably, the promoter for expressing the type I interferon includes: an immune cell-inducible promoter; preferably, the immune cell-inducible promoter is the NFAT6 promoter.

[0010] 5. An immune-response cell as described in any of the preceding items, the cell expressing an endogenous or recombinant receptor for binding antigen; preferably, the receptor for binding antigen comprises, in sequence: an antibody that specifically binds the antigen, a transmembrane region, and an intracellular signaling region.

[0011] 6. An immune response cell as described in any of the preceding claims, wherein the intracellular signaling region of the immune response cell contains a T cell stimulation signaling molecule or a combination of a T cell stimulation signaling molecule and a T cell activation co-stimulatory molecule; preferably, the T cell stimulation signaling molecule is selected from: CD3ζ or FcεRIγ; more preferably CD3ζ; or the T cell activation co-stimulatory molecule is selected from: the intracellular signaling region of CD27, CD28, CD137, CD134, ICOS protein, or a combination thereof.

[0012] 7. The immune response cell as described in any of the preceding items, wherein the amino acid sequence of the antigen-binding receptor has at least 90% identity with one of the following sequences:

[0013] SEQ ID NO: 49; SEQ ID NO: 50; SEQ ID NO: 51; SEQ ID NO: 54; SEQ ID NO: 55; SEQ ID NO: 56; SEQ ID NO: 61; SEQ ID NO: 62; SEQ ID NO: 63; SEQ ID NO: 64; SEQ ID NO:70; SEQ ID NO:71; SEQ ID NO:72; SEQ ID NO:73; SEQ ID NO:74; SEQ ID NO:75; and SEQ ID NO:77.

[0014] 8. The immune response cells as described in item 7, wherein the receptor that specifically binds to the antigen and the exogenous type I interferon are encoded by nucleotide sequences having at least 90% identity with SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60 or SEQ ID NO:76.

[0015] 9. The immune response cells as described in any of the preceding items, wherein the immune response cells do not contain exogenous co-stimulatory ligands.

[0016] 10. The immune response cells as described in any of the preceding items, wherein the type I interferon includes: IFNα or IFNβ.

[0017] 11. The immune response cell as described in any of the preceding items, wherein the antigen-binding receptor and / or type I interferon are constitutively or inducibly expressed on the surface of the immune response cell.

[0018] 12. An immune response cell as described in any of the preceding claims, wherein the immune response cell comprises an expression construct comprising: an expression cassette of the receptor that binds the antigen; and an expression cassette of the type I interferon.

[0019] 13. The immune response cells as described in any of the preceding items, wherein the receptor for binding the antigen and / or type I interferon is expressed using a viral vector; preferably, the viral vector is a retroviral vector; more preferably, the viral vector includes: a lentiviral vector, a retroviral vector, or an adenovirus vector.

[0020] 14. An immune response cell as described in any of the preceding items, wherein the receptor that binds the antigen recognizes and binds to the pathogenic microorganism.

[0021] 15. The immune response cells as described in item 14, wherein the pathogenic microorganism includes viruses, bacteria, fungi, protozoa, or parasites; more preferably, the pathogenic microorganism is a virus; or even more preferably, the pathogenic microorganism is selected from cytomegalovirus, Epstein-Barr virus, human immunodeficiency virus, and influenza virus.

[0022] 16. Immune response cells as described in any of the preceding items, wherein the antigens include: prostate-specific membrane antigen (PSMA), carcinoembryonic antigen (CEA), IL13Ralpha, HER-2, CD19, NY-ESO-1, HIV-1Gag, Lewis Y, MART-1, gp100, tyrosinase, WT-I, hTERT, mesothelin, EGFR, EGFRvIII, phosphatidylinositol proteoglycan 3, EphA2, HER3, EpCAM, MUC1, MUC16, CLDN18.2, folate receptor, CLDN6, CD30, CD138, ASGPR1, CDH16, GD2, 5T4, 8H9, αvβ6 integrin, B cell maturation antigen (BCMA), B7-H3, B7-H6, CAIX, CA9, CD20, CD22, and kappa light chain. (chain), CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD70, CD123, CD171, CSPG4, EGP2, EGP40, ERBB3, ERBB4, ErbB3 / 4, FAP, FAR, FBP, embryonic AchR, GD2, GD3, HLA-AI MAGE A1, MAGE3, HLA-A2, IL11Ra, KDR, Lambda, MCSP, NCAM, NKG2D ligand, PRAME, PSCA, PSC1, ROR1, Sp17, SURVIVIN, TAG72, TEM1, TEM8, VEGRR2, HMW-MAA, VEGF receptor, and / or fibronectin, tendinin, or carcinoembryonic variants of tumor necrosis.

[0023] 17. An expression construct comprising, in sequence: an expression cassette of an antigen-binding receptor; and an expression cassette of a type I interferon; wherein the antigen-binding receptor and the type I interferon are as defined in any of the preceding items.

[0024] 18. A method for enhancing the viability of immune response cells administered to an individual, said immune response cells expressing an antigen-binding receptor as described in any one of claims 1 to 16, wherein said method comprises administering said immune response cells and an effective amount of exogenous type I interferon to said individual.

[0025] 19. The method of claim 18, wherein the exogenous type I interferon is administered sequentially or simultaneously to the immune response cells expressing the receptor that binds the antigen.

[0026] 20. The method of claim 18 or 19, wherein the exogenous type I interferon is co-expressed in immune response cells and administered to the patient simultaneously with the immune response cells.

[0027] 21. The method of any one of claims 18 to 20, wherein the immune response cells include T cells, natural killer cells, cytotoxic T lymphocytes, natural killer T cells, DNT cells, and / or regulatory T cells.

[0028] 22. The method of any one of claims 18 to 21, wherein the method causes, after administration of the immune response cells to the individual, the sum of the number of cytotoxic T cells and helper T cells in the peripheral blood of the individual to be increased by at least 50% compared to the absence of the exogenous type I interferon.

[0029] 23. The method of any one of claims 18 to 22, wherein the method results in the sum of cytotoxic T cells and helper T cells in the peripheral blood of the individual being greater than 15,000 / μL after approximately 5 days of administration of the immune response cells; greater than 500 / μL after approximately 7 days of administration of the immune response cells; or greater than 50 / μL after approximately 10 days of administration of the immune response cells.

[0030] 24. Use of the immune response cells described in any one of items 1-16 in the preparation of pharmaceutical compositions for treating tumors, pathogen infections, or enhancing the immune tolerance of individuals in need.

[0031] 25. The use as described in item 24, wherein the tumor includes: pancreatic cancer, liver cancer, lung cancer, gastric cancer, head and neck squamous cell carcinoma, prostate cancer, colon cancer, breast cancer, lymphoma, gallbladder cancer, kidney cancer, leukemia, myeloma, ovarian cancer, cervical cancer, or glioma; or

[0032] The pathogens include viruses, bacteria, fungi, protozoa, or parasites; preferably, the viruses include cytomegalovirus, Epstein-Barr virus, human immunodeficiency virus, or influenza virus.

[0033] 26. The use as described in item 24 or 25, wherein, according to computed tomography measurements, the drug reduces the tumor by at least 30%.

[0034] 27. The use as described in item 24 or 25, wherein, according to computed tomography measurements, the drug causes the tumor to completely disappear.

[0035] 28. A pharmaceutical composition comprising:

[0036] The immune response cells described in any one of items 1-16; and

[0037] Pharmaceutically acceptable carriers or excipients.

[0038] 29. A kit comprising:

[0039] Immune response cells as described in any one of items 1-16; and

[0040] Instructions on how to administer the aforementioned immune response cells to an individual.

[0041] According to one aspect of the invention, the invention provides an immune-response cell that expresses a receptor for binding antigens; and exogenous type I interferon.

[0042] In some embodiments, the immune response cells of the present invention include T cells, natural killer cells, cytotoxic T lymphocytes, natural killer T cells, DNT cells, and / or regulatory T cells.

[0043] In some embodiments, the antigen-binding receptor is endogenous. In some embodiments, the antigen-binding receptor is recombinant. In some embodiments, the antigen-binding receptor is a chimeric antigen receptor. In some embodiments, the antigen-binding receptor comprises a sequentially linked extracellular antigen-binding region, a transmembrane region, and an intracellular signaling region. In some embodiments, the antigen-binding unit is an antibody or fragment thereof that specifically binds the antigen. In some embodiments, the intracellular signaling region may contain a signaling motif of a known immune receptor tyrosine activation motif (ITAM). In some embodiments, examples of ITAMs containing cytoplasmic signaling sequences include those derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d.

[0044] In some embodiments, the intracellular signaling region of the antigen-binding receptor includes one or more co-stimulatory domains. In some embodiments, the co-stimulatory domains are selected from one or more of those listed in Table 1. In some embodiments, the co-stimulatory domains are selected from one or more of CD28, OX40, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), 4-1BBL, MyD88, and 4-1BB. In some embodiments, the co-stimulatory domains are selected from two of CD28, OX40, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), 4-1BBL, MyD88, and 4-1BB.

[0045] In some embodiments, the amino acid sequence of the receptor that binds the antigen has at least 90% identity with one of SEQ ID NO:49; SEQ ID NO:50; SEQ ID NO:51; SEQ ID NO:54; SEQ ID NO:55; SEQ ID NO:56; SEQ ID NO:61; SEQ ID NO:62; SEQ ID NO:63; SEQ ID NO:64; SEQ ID NO:65; SEQ ID NO:66; SEQ ID NO:67; SEQ ID NO:68; SEQ ID NO:69; SEQ ID NO:70; SEQ ID NO:71; SEQ ID NO:72; SEQ ID NO:73; SEQ ID NO:74; SEQ ID NO:75; and SEQ ID NO:77.

[0046] In some embodiments, the receptor that binds the antigen is encoded by a nucleotide sequence that has at least 90% identity with SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60 or SEQ ID NO:76.

[0047] In some implementations, the immune response cells do not contain exogenous co-stimulatory ligands.

[0048] In some embodiments, the antigens that can be bound by the receptors of the said binding antigens include tumor antigens or pathogen antigens. In some embodiments, the tumor antigen is selected from prostate-specific membrane antigen (PSMA), carcinoembryonic antigen (CEA), IL13Ralpha, HER-2, CD19, NY-ESO-1, HIV-1Gag, Lewis Y, MART-1, gp100, tyrosinase, WT-I, hTERT, mesothelin, EGFR, EGFRvIII, phosphatidylinositol proteoglycan 3, EphA2, HER3, EpCAM, MUC1, MUC16, CLDN18.2, folic acid receptor, CLDN6, CD30, CD138, ASGPR1, CDH16, GD2, 5T4, 8H9, αvβ6 integrin, B cell maturation antigen (BCMA), B7-H3, B7-H6, CAIX, CA9, CD20, CD22, and kappa light chain. (chain), CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD70, CD123, CD171, CSPG4, EGP2, EGP40, ERBB3, ERBB4, ErbB3 / 4, FAP, FAR, FBP, embryonic AchR, GD2, GD3, HLA-AI MAGE A1, MAGE3, HLA-A2, IL11Ra, KDR, Lambda, MCSP, NCAM, NKG2D ligand, PRAME, PSCA, PSC1, ROR1, Sp17, SURVIVIN, TAG72, TEM1, TEM8, VEGRR2, HMW-MAA, VEGF receptor, and / or fibronectin, tendinin, or carcinoembryonic variants of tumor necrosis.

[0049] In some embodiments, the pathogen antigens include viral antigens, bacterial antigens, fungal antigens, or parasitic antigens. In some embodiments, the pathogen is a virus. The viruses include cytomegalovirus, Epstein-Barr virus, human immunodeficiency virus, and influenza virus.

[0050] In some embodiments, the expression of type I interferon is constitutive. In some embodiments, the expression of type I interferon is inducible. In some embodiments, the type I interferon is expressed on the surface of the immune-responding cells. In some embodiments, the type I interferon comprises IFNα or IFNβ.

[0051] According to one aspect of the present invention, an expression construct is provided, comprising, in sequence: an expression cassette of an antigen-binding receptor of the present invention; and an expression cassette of type I interferon. In some embodiments, the expression of type I interferon is constitutive expression. In some embodiments, the expression of type I interferon is inducible expression. In some embodiments, the expression of type I interferon is inducible expression, and the expression for the type I interferon is an inducible promoter. In some embodiments, the inducible promoter for the expression of type I interferon is the NFAT6 promoter. In some embodiments, the NFAT6 promoter comprises a nucleic acid sequence as described in SEQ ID NO:78.

[0052] According to one aspect of the invention, a vector is provided that expresses a receptor for the binding antigen of the invention and / or type I interferon. In some embodiments, the viral vector is a lentiviral vector, a retroviral vector, or an adenoviral vector. In some embodiments, the viral vector is a retroviral vector.

[0053] According to one aspect of the present invention, a method for enhancing the viability of immune response cells administered to an individual, the immune response cells expressing the receptors for binding antigens as described in the present invention, and wherein the method comprises administering the immune response cells and an effective amount of exogenous type I interferon to the individual. In some embodiments, the exogenous type I interferon is administered sequentially or simultaneously with the immune response cells expressing the receptors for binding antigens. In some embodiments, the exogenous type I interferon is administered to the patient simultaneously with the immune response cells by co-expression on the immune response cells.

[0054] According to one aspect of the invention, the invention provides the use of the immune-response cells of the invention in the preparation of pharmaceutical compositions for treating tumors, pathogen infections, or enhancing immune tolerance in individuals in need. The invention also provides a method for treating tumors or pathogen infections in individuals, or for enhancing immune tolerance in individuals, comprising administering the immune-response cells of the invention to the individual in need.

[0055] In some embodiments, the method of the present invention results in an increase of at least 50% in the sum of cytotoxic T cells and helper T cells in the peripheral blood of the individual after administration of the immune response cells, compared to the absence of the exogenous type I interferon. In some embodiments, the method results in the sum of cytotoxic T cells and helper T cells in the peripheral blood of the individual being greater than 15,000 cells / μL approximately 5 days after administration of the immune response cells; greater than 500 cells / μL approximately 5 days after administration of the immune response cells; or greater than 50 cells / μL approximately 5 days after administration of the immune response cells.

[0056] In some embodiments, the tumors include: pancreatic cancer, liver cancer, lung cancer, gastric cancer, head and neck squamous cell carcinoma, prostate cancer, colon cancer, breast cancer, lymphoma, gallbladder cancer, kidney cancer, leukemia, myeloma, ovarian cancer, cervical cancer, or glioma. In some embodiments, the pathogens include: viruses, bacteria, fungi, protozoa, or parasites; preferably, the viruses include: cytomegalovirus, Epstein-Barr virus, human immunodeficiency virus, or influenza virus.

[0057] In some embodiments, according to computed tomography measurements, the individual's tumor shrinks by at least 30% after treatment with the method of the present invention. In some embodiments, according to computed tomography measurements, the individual's tumor completely disappears after treatment with the method of the present invention.

[0058] According to one aspect of the present invention, a pharmaceutical composition is provided comprising the immune-responding cells of the present invention and a pharmaceutically acceptable carrier or excipient.

[0059] According to one aspect of the present invention, a kit is provided comprising the immune response cells of the present invention and instructions on how to administer the immune response cells to an individual.

[0060] Incorporate by reference

[0061] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference as if specifically and individually indicated that each individual publication, patent or patent application is incorporated by reference. Attached Figure Description

[0062] The accompanying drawings further illustrate the novel features disclosed herein. A better understanding of the features and advantages disclosed herein will be achieved by referring to these drawings; however, it should be understood that these drawings are for illustrating specific embodiments applying the principles disclosed herein and are not intended to limit the scope of the appended claims.

[0063] Figure 1 shows a schematic diagram of the recombinant lentiviral vector pRRL-EF-1α-92-CAR. Figure 1A ), and the construction of the 92-28Z-NFAT6-IFN-β plasmid ( Figure 1B ).

[0064] Figure 2 The graph shown is a positivity rate test result for lentivirus infection in PBMCs.

[0065] Figure 3 The graph shown is a positivity rate test result for lentivirus infection in PBMCs.

[0066] Figure 4 shows a comparison of cytokine release in GPC3 CAR-T cells containing and without IFN. Figure 4A The image shows the IFN-β expression induced by GPC3-28Z-IFN and GPC3-28Z CAR T cells. The results indicate that IFN-β expression only occurred when GPC3-28Z-IFN was co-incubated with Huh7 cells, suggesting that IFN-β can be successfully induced and secreted extracellularly after activation by the target antigen. Figure 4B The image shows a comparison of the effects of GPC3-28Z-IFN and GPC3-28Z CAR on the induction of INF-γ expression. Figure 4C The image shows a comparison of IL-2 release induced in vitro by GPC3-28Z-IFN and GPC3-28Z CAR T cells. The results show that GPC3-28Z-IFN can induce cytokine release more effectively, indicating that CAR T cells containing IFNβ can be activated more effectively.

[0067] Figure 5 The image shows a comparison of cytokine release induced in vitro by 85-28Z T cells and 85-28Z-IFN T cells in different cell lines. The results show that CAR T cells containing IFNβ can be activated more effectively.

[0068] Figure 6 shows the in vitro comparison of GPC3-28Z CAR T cells containing IFNβ and GPC3 CAR T cells without IFNβ against various cell lines. Figure 6A :Huh7; Figure 6B :Hep3B; Figure 6C : PLC / PRR / 5; Figure 6D:Hep G2; Figure 6E Comparison chart of the lethality of SK-hep-1.

[0069] Figure 7 The image shows the cytotoxic activity of CLD18A2 CAR-T cells containing and without IFN.

[0070] Figure 8 shows the comparison of CLD18A2 CAR-T cells containing IFNβ and CLD18A2 CAR-T cells without IFNβ in mouse peripheral blood after 5 days of infusion. Figure 8A The figure shown is for 7 days. Figure 8B ) and 10 days ( Figure 8C The results showed that at all time points, the number of surviving CLD18A2 CAR-T cells containing IFNβ was significantly higher than that of the CLD18A2 CAR-T cell group without IFNβ.

[0071] Figure 9 shows a comparison of the effect of GPC3-28Z CAR T cells containing IFNβ and GPC3-28Z CAR T cells without IFNβ on tumor volume over time in a mouse tumor model. Figure 9A ) and before-and after images of the tumor ( Figure 9B The results showed that GPC3-28Z CAR T cells containing IFNβ significantly reduced tumor volume compared to GPC3-28Z CAR T cells without IFNβ and the control group.

[0072] Figure 10 shows a comparison of the effect of CLD18A2 CAR-T cells containing IFNβ and CLD18A2 CAR-T cells without IFNβ on tumor volume over time in a mouse BGC-823-A2 cell subcutaneous transplantation tumor model. Figure 10A ) and before-and after images of the tumor ( Figure 10B The results showed that CLD18A2CAR-T cells containing IFNβ significantly reduced tumor volume compared to CLD18A2CAR-T cells without IFNβ and the control group.

[0073] Figure 11 The image shows a comparison of the antitumor activity of CLD18A2 CAR-T cells containing and without IFN in subcutaneous xenografts of a gastric cancer PDX model. The results showed that one mouse in the IFN-treated group experienced complete tumor regression.

[0074] Figure 12 shows a comparison of tumor infiltration in vivo by GPC3 CAR-T (92-28Z) cells containing and without IFN. Figure 12A For histochemical images, Figure 12B The image shows the number of T cells. The results indicate that there were no significant infiltrating CD3+ cells in the tumor tissue of the control group, while the number of CD3+ T cells in the INFβ-CAR-T treatment group was higher than that in the 28Z CART group.

[0075] Figure 13 The image shows a comparison of immunohistochemical images of CLD18A2 CAR-T cells containing and without IFN in vivo, indicating tumor infiltration. The results show that Mock T cells showed almost no T cell infiltration around the tumor tissue, 85-28Z and 85-2-28Z CAR T cells were visible at the edge of the tumor tissue, while 85-2-28Z-IFN T cells showed some infiltration within the tumor tissue.

[0076] Figure 14 The diagram shows the EGFR-CAR structures with and without IFN.

[0077] Figure 15 The figure shown is the infection positivity rate of retrovirus-infected mouse T lymphocytes.

[0078] Figure 16 The image shows a comparison of the ability of EGFR CAR T cells containing and without IFN to secrete mIFNβ in vitro. The results show that mCAR-806-mIFNβ was successfully activated and induced to express mIFNβ after stimulation by target cells, while no mIFNβ expression was detected in the control group.

[0079] Figure 17 shows the in vitro induction of cytokine release in EGFR CAR-T cells containing and without IFN. Figure 17A mIL-2; Figure 17B :mIFN-γ; Figure 17C Comparison of mTNF-α.

[0080] Figure 18 The figure shows a comparison of in vitro toxicity assays of EGFR CAR-T cells containing and without IFN. The results showed that EGFR-CAR and EGFR-CAR-IFN cells had significantly stronger killing effects on target-positive CT26VIII cells compared to UT cells (***P<0.001), with the percentage of killing showing a dose-dependent effect. Untransfected UT cells showed no killing effect on either CT26 or CT26VIII cells, and neither EGFR-CAR nor EGFR-CAR-IFN CAR-T cells had any killing effect on target-negative CT26 cells.

[0081] Figure 19The image shows a comparison of in vivo toxicity assays of EGFR CAR-T cells containing and without IFN. The results showed that EGFR-CAR-T cells did not inhibit tumor growth in tumors of similar size to the control group. However, after infusion of EGFR-CAR-IFN cells, tumor growth inhibition began to appear on day 7, with a tumor inhibition rate of 5.9%. This rate peaked at 18.5% on day 10 and remained at 12.4% on day 17, significantly superior to the EGFR-CAR-T cell group. Detailed Implementation

[0082] The following detailed description illustrates the embodiments disclosed herein. It should be understood that this specification is not intended to be limited to the specific embodiments disclosed herein, and changes are possible. Those skilled in the art will understand that the content disclosed herein can be varied or modified, all of which are covered within the scope and principles of the disclosure. Unless otherwise stated, each embodiment can be combined with any other embodiment.

[0083] Some embodiments disclosed herein include numerical ranges, and certain aspects of the invention may be described using ranges. Unless otherwise stated, it should be understood that numerical ranges or descriptions using ranges are for purposes of brevity and convenience only and should not be considered as a strict limitation of the scope of the invention. Therefore, descriptions using ranges should be considered as specifically disclosing all possible subranges and all possible specific numerical points within those ranges, as these subranges and numerical points have been explicitly stated herein. For example, a description of a range from 1 to 6 should be considered as specifically disclosing subranges from 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and specific numerical points within those ranges, such as 1, 2, 3, 4, 5, 6. The above principles apply equally regardless of the breadth of the numerical values. When a range description is used, the range includes the endpoints of the range.

[0084] To overcome the shortcomings of existing technologies, this invention has conducted in-depth research and discovered that inducing CAR-T cells to express type I interferon can effectively increase the anti-tumor activity of CAR-T cells and reduce their toxic side effects. Based on this, this invention provides an immune response cell that expresses at least one receptor capable of binding to antigens (such as tumor antigens or antigens from pathogens) and type I interferon. When applied to the treatment of tumors, infectious diseases, and other diseases, it exhibits significantly superior ability to kill tumors or pathogens.

[0085] As used herein, the terms “activation” and “activation” are used interchangeably, and they, along with their other grammatical forms, can refer to the process by which a cell transitions from a quiescent state to an active state. This process can include a response to antigens, migration, and / or phenotypic or genetic changes in a functionally active state. For example, the term “activation” can refer to the process of stepwise activation of T cells. For instance, T cells may require at least two signals to be fully activated. The first signal may occur after binding of the TCR by the antigen-MHC complex, while the second signal may occur through the binding of co-stimulatory molecules (see Table 1 for a list of co-stimulatory molecules). In vitro, anti-CD3 can mimic the first signal, and anti-CD28 can mimic the second signal. For example, engineered T cells can be activated by expressed CARs. As used herein, T cell activation or T cell triggering can refer to the state of T cells that have been adequately stimulated to induce detectable cell proliferation, cytokine production, and / or detectable effector function.

[0086] As used herein, the term "co-stimulatory ligand" includes molecules on antigen-presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to the same co-stimulatory molecule on T cells, thereby providing a signal that, together with a first signal provided by the binding of, for example, the TCR / CD3 complex to a peptide-loaded MHC molecule, mediates T cell responses, including but not limited to proliferation, activation, and differentiation. Co-stimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L, PD-L2, 4-1BBL, OX40L, inducible co-stimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin β receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies that bind to Toll ligand receptors, and ligands that specifically bind to B7-H3. Costimulatory ligands also include, in particular, antibodies that specifically bind to costimulatory molecules present on T cells, such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.

[0087] As used herein, the term "co-stimulatory molecule" refers to an identity binding partner on a T cell that specifically binds to a co-stimulatory ligand, thereby mediating a co-stimulatory response in the T cell, such as, but not limited to, proliferation. Co-stimulatory molecules include, but are not limited to, MHC class I molecules, BTLA, and Toll ligand receptors.

[0088] As used in this article, “co-stimulatory signal” refers to a signal that, in combination with a first signal, such as TCR / CD3, leads to T cell proliferation and / or upregulation or downregulation of key molecules.

[0089] As used herein, the term "antigen-binding unit" refers to the immunoglobulin molecule and the immunoactive portion of an immunomolecule, i.e., a molecule containing an antigen-binding site that specifically binds to an antigen ("immune response"). The term "antigen-binding unit" also includes immunoglobulin molecules from various species, including invertebrates and vertebrates. Structurally, the simplest naturally occurring antibody (e.g., IgG) consists of four polypeptide chains, two heavy (H) chains and two light (L) chains linked together by disulfide bonds. Immunoglobulins represent a large family of molecules including several types, such as IgD, IgG, IgA, IgM, and IgE. The term "immunoglobulin molecule" includes, for example, hybrid antibodies or modified antibodies and their fragments. Antigen-binding function of antibodies has been shown to be mediated by fragments of naturally occurring antibodies. These fragments are collectively referred to as "antigen-binding units." The term "antigen-binding unit" also includes any polypeptide-containing molecular structure with a specific shape that anastomoses with and recognizes an epitope, wherein one or more non-covalent interactions stabilize the complex between the molecular structure and the epitope.

[0090] If an antigen-binding unit binds to an antigen with a greater affinity or affinity than to other reference antigens (including peptides or other substances), then the antigen-binding unit is "specifically bound" to the antigen or "immunoreactive" to the antigen.

[0091] As used herein, “antigen” refers to a substance that is recognized and specifically bound by an antigen-binding unit. Antigens can include peptides, proteins, glycoproteins, polysaccharides, and lipids, portions thereof, and combinations thereof. Non-limiting exemplary antigens include tumor antigens or pathogen antigens. “Antigen” can also refer to a molecule that triggers an immune response. This immune response may involve antibody production or activation of specific immune-competent cells, or both. Those skilled in the art will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen.

[0092] As used in this article, the term "immunoglobulin" or "Ig" can refer to a class of proteins that function as antibodies. Antibodies expressed by B cells are sometimes called chimeric antigen receptors or antigen receptors. Five members of this class of proteins are IgA, IgG, IgM, IgD, and IgE, with IgG being the most common circulating antibody. It is the most effective immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in the defense against bacteria and viruses. For example, CARs can recognize tumor cell antigens (or "tumor antigens") or pathogen antigens.

[0093] The term “autologous” as used herein, and its other grammatical forms, can refer to something derived from the same source. For example, a sample (e.g., cells) can be removed, processed, and given to the same individual (e.g., a patient) at a later time. Autologous processes differ from allogeneic processes in which the donor and recipient are different individuals.

[0094] As used herein, "xenotransplantation" and its other grammatical forms can include any procedure in which cells, tissues, or organs are transplanted, implanted, or infused into a recipient, where the recipient and donor are of different species. The transplantation of cells, organs, and / or tissues described herein can be used for xenotransplantation into humans. Xenotransplantation includes, but is not limited to, vascularized xenografts, partially vascularized xenografts, non-vascularized xenografts, xenogeneic dressings, xenogeneic bandages, and xenogeneic structures.

[0095] As used herein, “allogeneic transplantation” and its other grammatical forms (e.g., allogeneic transplantation) can include any procedure in which the recipient and donor are of the same species but different individuals, involving the transplantation, implantation, or infusion of cells, tissues, or organs into the recipient. The transplantation of cells, organs, and / or tissues described herein can be used for allogeneic transplantation into the human body. Allogeneic transplantation includes, but is not limited to, vascularized allogeneic transplantation, partially vascularized allogeneic transplantation, avascularized allogeneic transplantation, allogeneic dressings, allogeneic bandages, and allogeneic structures.

[0096] As used herein, “autologous transplantation” and its other grammatical forms (e.g., autologous transplantation) can include any procedure in which the recipient and the donor are the same individual, involving the transplantation, implantation, or infusion of cells, tissues, or organs into the recipient. The transplantation of cells, organs, and / or tissues described herein can be used for autologous transplantation into the human body. Autologous transplantation includes, but is not limited to, vascularized autologous transplantation, partially vascularized autologous transplantation, non-vascularized autologous transplantation, autologous dressings, autologous bandages, and autologous structures.

[0097] As used in this article, the term "chimeric antigen receptor" or "CAR" refers to engineered molecules that can be expressed by immune cells, including but not limited to T cells. CARs are expressed in T cells and can redirect T cells to induce specific killing of target cells determined by the artificial receptor. The extracellular binding domain of a CAR can be derived from mouse, humanized, or fully human monoclonal antibodies.

[0098] As used herein, the term "epitope" and its other grammatical forms can refer to a portion of an antigen that can be recognized by antibodies, B cells, T cells, or engineered cells. For example, an epitope can be a tumor epitope or a pathogen epitope recognized by a TCR. Multiple epitopes within an antigen can also be recognized. Epitopes can also mutate.

[0099] As used herein, the term "engineering" and its other grammatical forms can refer to one or more alterations to nucleic acids, such as those within an organism's genome. The term "engineering" can also refer to changes, additions, and / or deletions of genes. Engineered cells can also refer to cells with added, deleted, and / or altered genes.

[0100] The term "cell" or "engineered cell" as used in this article, and its other grammatical forms, can refer to cells of human or non-human animal origin. Engineered cells can also refer to cells that express CAR.

[0101] As used in this article, the term "transfection" refers to the introduction of exogenous nucleic acids into eukaryotic cells. Transfection can be achieved through a variety of techniques known in the art, including calcium phosphate-DNA coprecipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion, lipid transfection, protoplast fusion, retroviral infection, and biolistics.

[0102] The term "stable transfection" or "stable transfection" refers to the introduction and integration of foreign nucleic acids, DNA, or RNA into the genome of a transfected cell. The term "stable transfectant" refers to a cell in which foreign DNA is stably integrated into the genomic DNA.

[0103] As used herein, the terms “nucleic acid molecule encoding,” “encoding DNA sequence,” and “encoding DNA” refer to the sequence or order of deoxyribonucleotides along a chain of deoxyribonucleic acid (DNA). This sequence of deoxyribonucleotides determines the sequence of amino acids along a polypeptide (protein) chain. Therefore, a nucleic acid sequence encodes an amino acid sequence.

[0104] As used herein, the term "individual" refers to any animal, such as a mammal or marsupial. Individuals of this invention include, but are not limited to, humans, non-human primates (such as rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cattle, sheep, rats, and any kind of poultry.

[0105] As used herein, the term "peripheral blood lymphocytes" (PBL) and its other grammatical forms can refer to lymphocytes circulating in the blood (e.g., peripheral blood). Peripheral blood lymphocytes can refer to lymphocytes not limited to organs. Peripheral blood lymphocytes can include T cells, NK cells, B cells, or any combination thereof.

[0106] As used in this article, the terms "immune-response cells" or "immunoreactive cells" can refer to cells that can elicit an immune response, including but not limited to T cells, B cells, and NKT cells, their respective precursor cells, and their progeny. Immune-response cells can also refer to cells of the lymphatic or bone marrow lineage.

[0107] The term "T cell" as used in this article, and its other grammatical forms, can refer to T cells from any source. For example, T cells can be primary T cells, such as autologous T cells. T cells can also be human or non-human.

[0108] As used herein, the terms “T cell activation” or “T cell triggering” and their other grammatical forms can refer to the state of T cells that are adequately stimulated to induce detectable cell proliferation, cytokine production, and / or detectable effector function. In some embodiments, “complete T cell activation” can be analogous to triggering T cell cytotoxicity. T cell activation can be measured using a variety of assays known in the art. These assays may include ELISA, ELISPOT for measuring cytokine secretion, flow cytometry assays (CD107) for measuring intracellular cytokine expression, flow cytometry assays for measuring proliferation, and cytotoxicity assays (51Cr release assays) for determining target cell elimination. These assays typically use a comparison between control (non-engineered cells) and engineered cells (CAR T) to determine the relative activation of engineered cells compared to the control. Furthermore, these assays may be compared with engineered cells incubated or contacted with target cells that do not express the target antigen. For example, the comparison may be a comparison with CD19-CAR T cells incubated with target cells that do not express CD19.

[0109] When used to refer to nucleotide sequences, the term "sequence" as used herein, and its other grammatical forms, can include DNA or RNA, and can be single-stranded or double-stranded. Nucleic acid sequences can mutate. Nucleic acid sequences can have any length, such as nucleic acids of 2 to 1,000,000 or more nucleotides (or any integer value between or above), for example, nucleic acids of about 100 to about 10,000 nucleotides or about 200 to about 500 nucleotides.

[0110] The term "effective amount" as used in this article refers to the amount that provides therapeutic or preventative benefits.

[0111] As used herein, the term "expression vector" refers to a vector containing recombinant polynucleotides that include expression regulatory sequences effectively linked to the nucleotide sequence to be expressed. Expression vectors contain sufficient cis-acting elements for expression; other elements for expression may be provided by the host cell or an in vitro expression system. Expression vectors include all those known in the art, such as viscera, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses).

[0112] As used in this article, the term "lentivirus" refers to the genus *Lentinvirus* within the family Retroviridae. Retroviruses are unique among retroviruses in their ability to infect non-dividing cells; they can deliver large amounts of genetic information into the host cell's DNA, making them one of the most efficient gene delivery vectors. HIV, SIV, and FIV are all examples of lentiviruses. Lentiviral vectors provide a means to achieve significant levels of gene transfer in vivo.

[0113] As used in this article, "operably ligated" refers to a functional link between a regulatory sequence and a heterologous nucleic acid sequence that results in the expression of the latter. For example, the first nucleic acid sequence is operably ligated to the second nucleic acid sequence when they are functionally related. Similarly, if a promoter affects the transcription or expression of a coding sequence, the promoter is operably ligated to the coding sequence. Typically, operably ligated DNA sequences are contiguous and, where necessary, link two protein-coding regions within the same reading frame.

[0114] The term “promoter” as used in this article is defined as a DNA sequence that is recognized by a cellular synthetic mechanism or an introduced synthetic mechanism required to initiate specific transcription of a polynucleotide sequence.

[0115] As used herein, the term "vector" refers to a composition containing isolated nucleic acids and capable of delivering those isolated nucleic acids into the cell. Many vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides associated with ionic or amphiphilic compounds, plasmids, and viruses. Therefore, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, etc. Examples of viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, etc.

[0116] The term "sequence identity" as used herein is determined by comparing two best-matched sequences across a comparison window (e.g., at least 20 positions), where portions of the polynucleotide or polypeptide sequence within the comparison window may contain additions or deletions (i.e., gaps), such as 20% or less gaps (e.g., 5 to 15%, or 10 to 12%) for two best-matched sequences compared to a reference sequence (which does not contain additions or deletions). The percentage is typically calculated by determining the number of positions where identical nucleic acid bases or amino acid residues occur in both sequences to produce the number of correctly matched positions. This number is then divided by the total number of positions in the reference sequence (i.e., the window size), and the result is multiplied by 100 to produce the percentage of sequence identity.

[0117] As used herein, the term "type I interferon" includes IFNα, IFNβ, and IFN-ε, IFN-κ, and IFN-ω. All type I interferons bind to specific cell surface receptors (i.e., the so-called IFN-α / β receptors) composed of two chains, IFNAR1 and IFNAR2. In some embodiments, the term "type I interferon" is used herein as IFNα or IFNβ. In some embodiments, the term "type I interferon" is used herein as IFNβ. In some embodiments, type I interferons as used herein include human, mouse, or synthetic type I interferons. In some embodiments, the term "interferon α" as used herein may be a polypeptide having the sequence shown in NCBI aaa52724.1, aaa52716.1, or aaa52725.1, or a polypeptide having at least 85% sequence identity with these sequences. In some implementations, the term “interferon β” (INF-β) as used herein may be a protein having at least 85% identity with NCBI aac41702.1 or np_002167.1 or aah96152.1p41273 or NP 001552, or a fragment thereof having tumor necrosis factor (TNF) ligand function.

[0118] In some embodiments, the elements used to construct the receptor that binds the antigen or the type I interferon can be naturally occurring, such as those isolated or purified from mammals; or they can be artificially prepared, such as recombinant elements or type I interferon produced using conventional genetic engineering recombination techniques. Preferably, the present invention uses recombinant elements or type I interferon.

[0119] Amino acid sequences formed by substitution, deletion, or addition of one or more amino acid residues based on the aforementioned elements or type I interferon polypeptide sequences are also included in this invention. Appropriate amino acid substitutions are techniques well-known in the art, which can be readily implemented and ensure no alteration of the resulting molecule's biological activity. These techniques have led those skilled in the art to recognize that, generally, altering a single amino acid in a non-essential region of a polypeptide does not substantially change its biological activity.

[0120] The bioactive fragments of the peptides of each element or type I interferon can be used in this invention. Here, "bioactive fragment" means a peptide that, as part of a full-length peptide, retains all or part of the function of the full-length peptide. Typically, the bioactive fragment retains at least 50% of the activity of the full-length peptide. Under more preferred conditions, the active fragment can retain 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the activity of the full-length peptide.

[0121] Based on the aforementioned elements or type I interferon polypeptide sequences, modified or improved polypeptides can also be used in this invention. For example, polypeptides modified or improved to enhance their half-life, efficacy, metabolism, and / or potency can be used. In other words, any variation that does not affect the biological activity of the polypeptide can be used in this invention.

[0122] As used herein, the terms “disease,” “symptom,” or “disorder,” etc., refer to any alteration or dysregulation that impairs or interferes with the normal function of cells, tissues, or organs. For example, “disease” includes, but is not limited to: tumors, pathogen infections, autoimmune diseases, T-cell dysfunction disorders, or deficiencies in immune tolerance (such as transplant rejection).

[0123] As used herein, the term "tumor" refers to a disease characterized by the pathological proliferation of cells or tissues, and their subsequent migration or invasion into other tissues or organs. Tumor growth is typically uncontrolled and progressive, neither inducing nor inhibiting the proliferation of normal cells. Tumors can affect a wide variety of cells, tissues, or organs, including but not limited to those selected from the bladder, bone, brain, breast, cartilage, glial cells, esophagus, fallopian tubes, gallbladder, heart, intestines, kidneys, liver, lungs, lymph nodes, nerve tissue, ovary, pancreas, prostate, skeletal muscle, skin, spinal cord, spleen, stomach, testes, thymus, thyroid gland, trachea, urethra, ureter, uterus, vagina, or related organs, tissues, or corresponding cells. Tumors include cancers such as sarcomas, carcinomas, or plasmacytomas (malignant tumors of plasma cells). The tumors described in this invention may include, but are not limited to, leukemia (such as acute leukemia, acute lymphoblastic leukemia, acute myeloid leukemia, acute myeloid leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute monocytic leukemia, acute leukemia, chronic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, polycythemia vera), lymphoma (Hodgkin's disease, non-Hodgkin's disease), primary macroglobulinemia, heavy chain disease, solid tumors such as sarcomas and cancers (such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, chordoma, endothelial sarcoma, lymphangiosarcoma, angiosarcoma, lymphangioendothelial sarcoma, synovial vioma, mesothelioma, Ewing's disease). Tumors, leiomyosarcomas, rhabdomyosarcomas, colon cancer, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, carcinoma, bronchial carcinoma, medullary carcinoma, renal cell carcinoma, liver cancer, Nile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, nephroblastoma, cervical cancer, uterine cancer, testicular cancer, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pineal tumor, hemangioblastoma, acoustic neuroma, oligodendroglioma, schwannoma, meningioma, melanoma, neuroblastoma, retinoblastoma, esophageal cancer, gallbladder cancer, kidney cancer, multiple myeloma. Preferably, the term "tumor" includes, but is not limited to: pancreatic cancer, liver cancer, lung cancer, stomach cancer, esophageal cancer, head and neck squamous cell carcinoma, prostate cancer, colon cancer, breast cancer, lymphoma, gallbladder cancer, kidney cancer, leukemia, multiple myeloma, ovarian cancer, cervical cancer, and glioma.

[0124] The tumor antigens mentioned in this invention can also be tumor-specific antigens (TSA) or tumor-associated antigens (TAAs). TSAs are unique to tumor cells and do not occur on other cells in the body. TAA-associated antigens are not unique to tumor cells but are expressed on normal cells under conditions that do not induce an immune tolerance state to the antigen. Antigen expression on tumors can occur under conditions that enable the immune system to respond to the antigen. When the immune system is immature and unable to respond, TAAs can be antigens expressed on normal cells during fetal development, or they can be antigens that are normally present at very low levels on normal cells but expressed at higher levels on tumor cells.

[0125] Non-limiting examples of TSA or TAA antigens include: differentiation antigens such as MART-1 / MelanA (MART-I), gp100 (Pmel17), tyrosinase, TRP-1, TRP-2, and tumor-specific multicentric antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor suppressor genes such as p53, Ras, HER-2 / neu; unique tumor antigens caused by chromosomal translocations, such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, and MYL-RAR; and viral antigens such as Epstein-Barr virus antigen EBVA and human papillomavirus (HPV) antigens E6 and E7. Other major protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72, CA 19-9, CA 72-4, CAM17.1, NuMa, K-ras, β-linkin, CDK4, Mum-1, p15, p16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, beta-HCG, BCA225, BTAA, CA 125, CA 15-3, CA 27.29, BCAA, CA 195, CA 242, CA-50, CAM43, CD68 / P1, CO-029, FGF-5, G250, Ga733 / EpCAM, HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 / Mac-2 binding protein / cyclic protein C-related protein, TAAL6, TAG72, TLP, and TPS.

[0126] In some embodiments, the “tumor antigen” includes, but is not limited to: prostate-specific membrane antigen (PSMA), carcinoembryonic antigen (CEA), IL13Ralpha, HER-2, CD19, NY-ESO-1, HIV-1Gag, Lewis Y, MART-1, gp100, tyrosinase, WT-I, hTERT, mesothelin, EGFR, EGFRvIII, phosphatidylinositol proteoglycan 3, EphA2, HER3, EpCAM, MUC1, MUC16, CLDN18.2, folic acid receptor, CLDN6, CD30, CD138, ASGPR1, CDH16, GD2, 5T4, 8H9, αvβ6 integrin, B cell maturation antigen (BCMA), B7-H3, B7-H6, CAIX, CA9, CD20, CD22, and kappa light chain. (chain), CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD70, CD123, CD171, CSPG4, EGP2, EGP40, ERBB3, ERBB4, ErbB3 / 4, FAP, FAR, FBP, embryonic AchR, GD2, GD3, HLA-AI MAGE A1, MAGE3, HLA-A2, IL11Ra, KDR, Lambda, MCSP, NCAM, NKG2D ligand, PRAME, PSCA, PSC1, ROR1, Sp17, SURVIVIN, TAG72, TEM1, TEM8, VEGRR2, HMW-MAA, VEGF receptor, and / or fibronectin, tendinin, or carcinoembryonic variants of tumor necrosis.

[0127] As used in this article, the term "pathogen" refers to protozoa capable of causing disease, including viruses, bacteria, fungi, or parasites. The term "viral antigen" refers to a polypeptide expressed by a virus that can induce an immune response.

[0128] Typical viruses include, but are not limited to, retroviridae (such as human immunodeficiency virus, such as HIV-1 (also known as HDTV-III, LAVE, or HTLV-III / LAV, or HIV-III; and other strains, such as HIV-LP); picoronoviruses (such as poliovirus, hepatitis A virus; human enteroviruses, Coxsackievirus, rhinovirus, echovirus); caliciviruses (e.g., strains causing gastroenteritis); caliciviruses (such as equine encephalitis virus, rubella virus); flaviviridae (such as dengue virus, Japanese encephalitis virus, yellow fever virus); coronavirusidae (e.g., coronavirus); rhabdoviridae (such as vesicular stomatitis virus, rabies virus); filoviridae (such as Ebola virus); paramyxoviridae (such as parainfluenza virus, mumps virus, measles virus, respiratory syncytial virus); orthomyxoviruses (such as influenza virus); subviridae (… Examples include Hantavirus, some viruses, sandfly and Nairovirus); Stage Virology (hemorrhagic fever viruses); Reoviridae (such as reovirus, circovirus and rotavirus); Dinucleotide viruses; Hepatitis viruses (hepatitis B virus); Parvoviridae (parvovirus); Papillomavirus (papillomavirus, polyomavirus); Adenoviridae (most adenoviruses); Herpesviruses (herpes simplex virus (HSV) 1 and 2, varicella-zoster virus, cytomegalovirus (CMV), herpes simplex virus); Poxviruses (smallpox virus, cowpox virus, poxvirus); Iridoviridae (such as African swine fever virus); and unclassified viruses (such as Delta hepatitis virus (considered a defective satellite TE hepatitis B virus), non-A, non-B hepatitis virus (Class 1 = internal transmission; Class 232 non-enteric transmission (i.e. hepatitis C); Norwalk and related viruses and astroviruses).

[0129] Typical bacteria include, but are not limited to, Pasteurella multocida, Staphylococcus aureus, Streptococcus, Escherichia coli, Salmonella, and Pseudomonas aeruginosa. Specific examples of infectious bacteria include, but are not limited to, Helicobacter pylori, spirochetes, Legionella pneumophila, SPS mycobacteria (such as Mycobacterium tuberculosis, Mycobacterium avium, Mycobacterium endomycobacterium, M. Kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococci), and Streptococcus agalactiae (Group B Streptococci, viridans streptococci). Enterococcus faecalis, Enterococcus bovis, Streptococcus (anaerobic SPS), Streptococcus pneumoniae, Campylobacter spp., Enterococcus spp., Haemophilus influenzae, Bacillus anthracis, Corynebacterium diphtheriae, Corynebacterium spp., Clostridium spp., Erysipelothrix rhusiopathiae, Clostridium perfringens, Clostridium tetani, Enterobacter cloacae, Klebsiella pneumoniae, Pasteurella multocida, Bacteroides spp., Fusobacterium nucleatum, Candida albicans, Treponema pallidum, Leptospira, Rickettsia, Actinomyces isatis.

[0130] In some embodiments, the immune response cells of the present invention are capable of recognizing and binding to parasitic antigens. The parasites include endoparasites and ectoparasites. The endoparasites include protozoa, worms, roundworms, and flukes. In some embodiments, the parasitic antigen is, for example, derived from species of the following families: *Entamoeba histolytica*; *Babesia B.divergens*, *B.bigemina*, *B.equi*, *B.microfti*, *B.duncani*; *Balantidium coli*; *Blastocystis* spp.; *Trypanosoma cruzi*; *Cryptosporidium* spp.; *Cyclosporacayetanensis*; *Dientamoeba fragilis*; *Giardia lamblia*; *Balamuthia mandrillaris*; *Acanthamoeba* spp.; *Isospora belli*; *Leishmania* spp.; *Plasmodium falciparum*, *Plasmodium vivax*, *Plasmodium ovale curtisi*, *Plasmodium ovale wallikeri*, *Plasmodium malariae*, *Plasmodium knowlesi*; *Naegleria fowleri*; *Rhinosporidium seeberi*; *Sarcocystis* bovihominis,Sarcocystis suihominis;Trypanosoma brucei;Toxoplasma gondii;Trichomonas vaginalis;Taenia saginata;Bertiella mucronata,Bertiella studeri;Taenia solium;Diphyllobothrium latum;Echinococcusgranulosus,Echinococcus multilocularis,E.vogeli,E.oligarthrus;Hymenolepisnana,Hymenolepis diminuta;Spirometra erinaceieuropaei;Cestoda,Taeniamulticeps;Clonorchis sinensis;Clonorchis viverrini;Dicrocoelium dendriticum;Fasciola hepatica,Fasciola gigantica;Fasciolopsis buski;Gnathostomaspinigerum,Gnathostoma hispidum;Metagonimus yokogawai;Metorchis conjunctus;Opisthorchis viverrini,Opisthorchis felineus,Clonorchis sinensis;Paragonimuswestermani;Paragonimus africanus;Paragonimus caliensis;Paragonimuskellicotti;Paragonimus skrjabini;Paragonimus uterobilateralis;Schistosomasp.;Schistosoma mansoni and Schistosoma intercalatum;Schistosoma haematobium;Schistosoma japonicum;Schistosoma mekongi;Echinostoma echinatum;Trichobilharzia regenti,Schistosomatidae;Ancylostoma duodenale,Necatoramericanus;Angiostrongylus costaricensis;Anisakis;Ascaris sp.Ascarislumbricoides;Baylisascaris procyonis;Brugia malayi,Brugia timori;Dioctophymerenale;Dracunculus medinensis;Enterobius vermicularis,Enterobius gregorii;Halicephalobus gingivalis;Loa loa filaria;Mansonella streptocerca;Onchocercavolvulus;Strongyloides stercoralis;Thelazia californiensis,Thelaziacallipaeda;Toxocara canis,Toxocara cati;Trichinella spiralis,Trichinellabritovi,Trichinella nelsoni,Trichinella nativa;Trichuris trichiura,Trichurisvulpis;Wuchereria bancrofti;Archiacanthocephala,Moniliformis moniliformis;Linguatula serrata;Oestroidea;Calliphoridae,Sarcophagidae;Cochliomyiahominivorax;Tunga penetrans;Cimex lectularius;Dermatobia hominis;Pediculushumanus;Pediculus humanus corporis;Pthirus pubis;Demodex folliculorum / brevis / canis; Sarcoptes scabiei; Trombiculidae; Pulex irritans; Ixodidae and Argasidae.

[0131] As used in this article, the term "autoimmune disease" is defined as a condition caused by an autoimmune response. Autoimmune diseases are the result of an inappropriate and excessive reaction to self-antigens. Examples of autoimmune diseases include, but are not limited to, appendicitis, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune mumps, Crohn's disease, type I diabetes, malnutrition-related epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barré syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, spondyloarthritis, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, and ulcerative colitis.

[0132] "Tolerance," or "immune tolerance," is the failure of the immune system to produce a defensive immune response to a specific antigen. Tolerance can be innate or autoimmune, in which the body does not attack its own proteins and antigens, or it can be induced through manipulation of the immune system. Central tolerance occurs during lymphocyte development and plays a role in the thymus and bone marrow. In this process, T lymphocytes and B lymphocytes that recognize self-antigens are absent before developing into fully immune-active cells. This process is most active during fetal development but continues throughout life with the generation of immature lymphocytes. Peripheral T-cell tolerance refers to the functional non-reactivity to self-antigens present in peripheral tissues and occurs after T and B cells mature and enter the periphery. These processes include the suppression of self-reactive cells by "regulatory" T cells and the production of hyporeactivity (non-reactivity) in lymphocytes that encounter antigens in the absence of co-stimulatory signals accompanied by inflammation. "Acquired" or "inducible tolerance" refers to the adaptation of the immune system to external antigens, characterized by the specific non-reactivity of lymphoid tissues to a given antigen, which may otherwise induce cell-mediated or humoral immunity. In adults, tolerance can be clinically induced by repeated administration of very large doses of antigen or small doses below the threshold required to stimulate an immune response (e.g., via intravenous or sublingual administration of soluble antigens). The antigen that induces immune tolerance is called a tolerogen. Immunosuppression also favors the induction of tolerance. Disruption of self-tolerance can lead to autoimmunity.

[0133] Immune recognition of non-self antigens often complicates the transplantation and grafting of foreign tissues from organisms of the same species (allogeneic grafts), leading to transplant rejection. Lymphocytes, particularly T lymphocytes, play a crucial role in allogeneic transplant rejection, transplant failure, and GVHD. There are generally two situations in which allogeneic transplantation can be accepted. One is when cells or tissues are transplanted to immune-exempt sites isolated from the immune surveillance system (such as in the eye or testis), or when they possess strong molecular signals to prevent dangerous inflammation (such as in the brain). The second is when a state of tolerance has already been induced, either previously through exposure to donor antigens in a manner that leads to immune tolerance rather than recipient sensitization, or after chronic rejection. Successful allogeneic transplantation requires a certain degree of immune tolerance against allogeneic antigens. The achievement of immune tolerance prevents host-versus-graft reactions that lead to transplant rejection and failure, and prevents graft-versus-host disease (GVHD).

[0134] As used herein, the term "enhancing immune response cell function" includes, for example, enhancing T cell function. Taking T cells as an example, enhancing T cell function includes inducing, eliciting, or stimulating T cells to possess sustained or enhanced biological functions, or renewing or reactivating exhausted or inactive T cells. Examples of enhanced T cell function include: increased interferon secretion by CD8+ T cells relative to pre-intervention levels, increased proliferation, and increased antigen reactivity (e.g., viral or pathogen clearance). In one embodiment, the enhancement level is at least 50%, or 60%, 70%, 80%, 90%, 100%, 120%, 150%, or 200%. Methods for measuring such enhancement are known to those skilled in the art.

[0135] As used herein, the term "T-cell dysfunction disorder" includes conditions or disorders of T cells characterized by reduced responsiveness to antigen stimulation. In some embodiments, the T-cell dysfunction disorder is a condition associated with inappropriately increased signaling specificity via PD-1. In some embodiments, the T-cell dysfunction disorder is a disease in which T cells are impotent or have a reduced ability to secrete cytokines, proliferate, or perform cytolytic activities. Examples of T-cell dysfunction disorders characterized by T-cell dysfunction include unabsorbed acute infections, chronic infections, and tumor immunity.

[0136] As used in this article, the term "exogenous" refers to a nucleic acid molecule or polypeptide that is not endogenously expressed in cells, or whose expression level is insufficient to achieve the function it would have if overexpressed. Therefore, "exogenous" includes recombinant nucleic acid molecules or polypeptides expressed in cells, such as exogenous, heterologous, and overexpressed nucleic acid molecules and polypeptides.

[0137] As used in this article, the term "receptor" refers to a polypeptide, or a portion thereof, that selectively binds one or more ligands to the cell membrane.

[0138] In some embodiments, the receptor of the present invention specifically binds to an antigen that can bind thereto.

[0139] In some embodiments, the receptor for binding antigens in this invention is a chimeric antigen receptor. As used herein, the term "chimeric antigen receptor (CAR)" refers to a tumor antigen-binding domain fused to an intracellular signal transduction domain that activates T cells. Typically, the extracellular binding domain of a CAR is derived from mouse, humanized, or human monoclonal antibodies.

[0140] Chimeric antigen receptors typically include an extracellular antigen-binding region or antigen-binding unit. In some embodiments, the extracellular antigen-binding region may be entirely human. In other cases, the extracellular antigen-binding region may be humanized. In still other cases, the extracellular antigen-binding region may be murine, or the chimera in the extracellular antigen-binding region may consist of amino acid sequences from at least two different animals. In some embodiments, the extracellular antigen-binding region may be non-human.

[0141] A variety of antigen-binding regions can be designed. Non-limiting examples include single-chain variable fragments (scFv) derived from antibodies, fragment antigen-binding regions (Fab) selected from libraries, single-domain fragments, or natural ligands that bind to their homologous receptors. In some embodiments, the extracellular antigen-binding region may comprise scFv, Fab, or a natural ligand, and any derivatives thereof. The extracellular antigen-binding region can refer to a molecule other than the intact antibody, which may contain a portion of the intact antibody and can bind to the antigen bound to the intact antibody. Examples of antibody fragments may include, but are not limited to, Fv, Fab, Fab', Fab'-SH, F(ab')2; bifunctional antibodies, linear antibodies; single-chain antibody molecules (e.g., scFv); and multispecific antibodies formed from antibody fragments.

[0142] Extracellular antigen-binding regions, such as scFv, Fab, or natural ligands, can be part of a CAR that determines antigen specificity. Extracellular antigen-binding regions can bind to any complementary target. They can be derived from antibodies with known variable region sequences. Extracellular antigen-binding regions can be obtained from antibody sequences derived from available mouse hybridomas. Alternatively, they can be obtained from whole-extracellular cleavage sequencing of tumor cells or primary cells such as tumor-infiltrating lymphocytes (TILs).

[0143] In some implementations, the binding specificity of the extracellular antigen-binding region can be determined by a complementarity-determining region or a CDR, such as a light chain CDR or a heavy chain CDR. In many cases, binding specificity can be determined by both light chain CDRs and heavy chain CDRs. A given combination of heavy chain CDRs and light chain CDRs can provide a given binding bag that can confer greater affinity and / or specificity to an antigen (e.g., GPC3) compared to other reference antigens. For example, a CDR specific to phosphatidylinositol proteoglycan-3 can be expressed in the extracellular binding region of a CAR, allowing a GPC3-targeting CAR to target GPC3-expressing tumor cells with immune-responding cells.

[0144] In some aspects of any of the embodiments disclosed herein, the extracellular antigen-binding region, such as scFv, may comprise an antigen-specific light chain CDR. The light chain CDR may be a complementarity-determining region of the scFv light chain of an antigen-binding unit, such as a CAR. The light chain CDR may comprise a continuous sequence of amino acid residues, or two or more continuous sequences of amino acid residues separated by non-complementarity-determining regions (e.g., framework regions). In some embodiments, the light chain CDR may comprise two or more light chain CDRs, which may be referred to as light chain CDR-1, CDR-2, etc. In some embodiments, the light chain CDR may comprise three light chain CDRs, which may be referred to as light chain CDR-1, light chain CDR-2, and light chain CDR-3, respectively. In some instances, a group of CDRs present on a common light chain may be collectively referred to as light chain CDRs.

[0145] In some aspects of any of the embodiments disclosed herein, the extracellular antigen-binding region, such as the scFv, may comprise an antigen-specific heavy chain CDR. The heavy chain CDR may be a heavy chain complementarity-determining region of the antigen-binding unit, such as the scFv. The heavy chain CDR may comprise a continuous sequence of amino acid residues, or a continuous sequence of two or more amino acid residues separated by non-complementarity-determining regions (e.g., framework regions). In some embodiments, the heavy chain CDR may comprise two or more heavy chain CDRs, which may be referred to as heavy chain CDR-1, CDR-2, etc. In some embodiments, the heavy chain CDR may comprise three heavy chain CDRs, which may be referred to as heavy chain CDR-1, heavy chain CDR-2, and heavy chain CDR-3, respectively. In some embodiments, a group of CDRs present on a common heavy chain may be collectively referred to as heavy chain CDRs.

[0146] Extracellular antigen-binding regions can be modified in various ways using genetic engineering. In some embodiments, the extracellular antigen-binding region can be mutated to select for a higher affinity for its target. In some embodiments, the affinity of the extracellular antigen-binding region for its target can be optimized for targets that are expressed at low levels in normal tissues. This optimization can be performed to minimize potential toxicity. In other cases, clones of extracellular antigen-binding regions with higher affinity for the membrane-bound form of the target may be superior to their soluble counterparts. This modification can be performed because different levels of the soluble form of the target can also be detected, and their targeting can cause undesirable toxicity.

[0147] In some embodiments, the extracellular antigen-binding region includes a hinge or spacer region. The terms hinge and spacer region are used interchangeably. A hinge can be considered as part of the CAR used to provide flexibility to the extracellular antigen-binding region. In some embodiments, the hinge can be used to detect CARs on the cell surface of cells, particularly when antibodies that detect the extracellular antigen-binding region are ineffective or available. For example, the length of the hinge derived from immunoglobulins may need to be optimized depending on the location of the epitope on the target of the extracellular antigen-binding region.

[0148] In some embodiments, the hinge may not belong to an immunoglobulin, but rather to the natural hinge of another molecule, such as the CD8α molecule. The CD8α hinge may contain cysteine ​​and proline residues known to play a role in the interaction between the CD8 co-receptor and the MHC molecule. These cysteine ​​and proline residues can affect the performance of the CAR.

[0149] CAR hinges can be size-adjustable. This morphology of the immune synapse between immune-responding cells and target cells also limits the distance at which CARs cannot functionally bridge the synaptic distance due to distal membrane epitopes on target molecules on the cell surface; even using short-hinge CARs cannot achieve a synaptic distance close enough for signal transduction. Similarly, signal output is only observed against the background of long-hinge CARs for proximal membrane CAR target antigen epitopes. The hinge can be adjusted according to the extracellular antigen-binding region used. The hinge can be of any length.

[0150] The transmembrane domain can anchor the CAR to the cell's plasma membrane. The native transmembrane portion of CD28 can be used in the CAR. In other cases, the native transmembrane portion of CD8α can also be used in the CAR. "CD8" can be a protein having at least 85, 90, 95, 96, 97, 98, 99, or 100% identity with NCBI reference number: NP_001759 or a fragment thereof that has stimulatory activity. "CD8 nucleic acid molecule" can be a polynucleotide encoding a CD8 polypeptide. In some cases, the transmembrane region can be the native transmembrane portion of CD28, and "CD28" can refer to a protein having at least 85, 90, 95, 96, 97, 98, 99, or 100% identity with NCBI reference number: NP_006130 or a fragment thereof that has stimulatory activity. "CD28 nucleic acid molecule" can be a polynucleotide encoding a CD28 polypeptide. In some embodiments, the transmembrane portion can include the CD8α region.

[0151] The intracellular signaling region of a CAR can be responsible for activating at least one of the effector functions of an immune response cell in which the CAR has been placed. CARs can induce effector functions of T cells, such as cytolytic activity or co-operational activity, including cytokine secretion. Therefore, the term intracellular signaling region refers to a protein portion that transduces effector function signals and directs the cell to perform specific functions. While the entire intracellular signaling region can generally be used, in many cases it is not necessary to use the entire chain of the signaling domain. In some embodiments, a truncated portion of the intracellular signaling region is used. In some embodiments, the term intracellular signaling region is therefore intended to include any truncated portion of the intracellular signaling region sufficient to transduce effector function signals.

[0152] Preferred examples of signaling domains used in CARs may include cytoplasmic sequences of T-cell receptors (TCRs) and co-receptors that work together to initiate signal transduction after target-receptor binding, as well as any derivative or variant sequences thereof and any synthetic sequences of the same functionality.

[0153] In some embodiments, the intracellular signaling domain may contain a signaling motif of a known immune receptor tyrosine activation motif (ITAM). Examples of ITAMs containing cytoplasmic signaling sequences include those derived from TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d. However, in a preferred embodiment, the intracellular signaling domain is derived from the CD3ζ chain.

[0154] An example of a T cell signaling domain containing one or more ITAM motifs is the CD3ζ domain, also known as the T cell receptor T3ζ chain or CD247. This domain is part of the T cell receptor-CD3 complex and plays a crucial role in linking antigen recognition with the main effector activation of T cells in several intracellular signal transduction pathways. As used herein, CD3ζ primarily refers to human CD3ζ and its isotypes, including proteins with substantially identical sequences, as known from the Swissprot entry p20963. Again, as part of a chimeric antigen receptor, the entire T cell receptor T3ζ chain is not required, and any derivative containing the signaling domain of the T cell receptor T3ζ chain is appropriate, including any functional equivalents thereof.

[0155] Intracellular signal transduction domains can be selected from any of the domains in Table 1. In some embodiments, the domains can be modified such that the identity with the reference domain can be from about 50% to about 100%. Any of the domains in Table 1 can be modified such that the modified form can contain about 50, 60, 70, 80, 90, 95, 96, 97, 98, 99 or up to about 100% identity.

[0156] The intracellular signaling region of a CAR may further include one or more co-stimulatory domains. The intracellular signaling region may contain a single co-stimulatory domain, such as the ζ chain (first-generation CAR) or its combination with CD28 or 4-1BB (second-generation CAR). In other instances, the intracellular signaling region may contain two co-stimulatory domains, such as CD28 / OX40 or CD28 / 4-1BB (third-generation).

[0157] Along with intracellular signaling domains such as CD8, these co-stimulatory domains can generate downstream activation of kinase pathways, thereby supporting gene transcription and functional cellular responses. The co-stimulatory domains of CARs can activate proximal signaling proteins associated with the CD28 (phosphatidylinositol-4,5-bisphosphate 3-kinase) or 4-1BB / OX40 (TNF-α receptor-associated factor adaptor) pathways, as well as MAPK and Akt activation.

[0158] In some cases, signals generated via CAR may combine with auxiliary or co-stimulatory signals. For co-stimulatory signaling domains, chimeric antigen receptor-like complexes can be engineered to include several possible co-stimulatory signaling domains. As is well known in the art, in naive T cells, binding of the T cell receptor alone is insufficient to induce complete activation of T cells into cytotoxic T cells. Complete activation of productive T cells requires a second co-stimulatory signal. Several receptors that provide co-stimulation for T cell activation have been reported, including but not limited to CD28, OX40, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), 4-1BBL, MyD88, and 4-1BB. The signaling pathways used by these co-stimulatory molecules all synergize with the main T cell receptor activation signal. The signals provided by these co-stimulatory signaling regions can synergize with the main effector activation signal derived from one or more ITAM motifs (e.g., the CD3zeta signaling domain) and can fulfill the requirements for T cell activation.

[0159] In some embodiments, adding a co-stimulatory domain to the chimeric antigen receptor-like complex can enhance the efficacy and durability of engineered cells. In another embodiment, the T cell signaling domain and the co-stimulatory domain are fused together to form a signal transduction region.

[0160] Table 1. Costimulatory domains

[0161]

[0162]

[0163] Chimeric antigen receptors bind to target antigens. Target antigens can be obtained or isolated from various sources when T cell activation is measured in vitro or in vitro. The target antigens used in this article are antigens or immunoepitaxes on antigens that are essential in mammals for immune recognition and ultimately the elimination or control of pathogenic factors or disease states. Immune recognition can be cellular and / or humoral. In the case of intracellular pathogens and cancer, immune recognition can be, for example, a T lymphocyte response.

[0164] The target antigen can be derived from or isolated from antigens of, for example, viral microorganisms such as the viruses described herein. In some embodiments, the chimeric antigen receptor of the present invention binds to viruses including, for example, HIV (Korber et al., eds. HIV Molecular Immunology Database, Los Alamos National Laboratory, Los Alamos, N.Mex. 1977), influenza, herpes, herpes simplex human papillomavirus (US Patent No. 5,719,054), hepatitis B (US Patent No. 5,780,036), hepatitis C (US Patent No. 5,709,995), EBV, cytomegalovirus (CMV), etc.

[0165] The target antigen may also be derived from or isolated from the pathogenic bacteria described above. In some embodiments, the chimeric antigen receptor of the present invention binds antigens such as those derived from Chlamydia (US Patent No. 5,869,608), mycobacteria, Legionella, meningococci, group A streptococci, Salmonella, Listeria, Haemophilus influenzae (US Patent No. 5,955,596), etc.

[0166] In some implementations, the target antigen may be derived from or isolated from pathogenic yeasts, such as Aspergillus, Candida invasiveis (US Patent No. 5,645,992), Nocardia, histoplasmosis, cryptosporidiosis, etc.

[0167] In some implementations, the target antigen may be derived from, for example, pathogenic protozoa and pathogenic parasites, including but not limited to Pneumocystis carinii, trypanosomiasis, Leishmania (US Patent No. 5,965,242), Plasmodium (US Patent No. 5,589,343), and Toxoplasma gondii.

[0168] In some embodiments, the target antigen includes antigens associated with precancerous or proliferative states. The target antigen may also be cancer-related or cancer-causing. For example, in some embodiments, the chimeric antigen receptor of the present invention recognizes and binds to tumor antigens including the TSA and TAA described above.

[0169] The term "adjustment" as used in this article refers to positive or negative changes. Examples of adjustments include changes of 1%, 2%, 10%, 25%, 50%, 75%, or 100%.

[0170] As used in this article, the term "treatment" refers to a clinical intervention in the process of attempting to alter an individual's or treat a disease caused by cells, which can be preventative or intervention in the clinicopathological process. Treatment effects include, but are not limited to, preventing the onset or recurrence of disease, alleviating symptoms, reducing any direct or indirect pathological consequences of the disease, preventing metastasis, slowing the rate of disease progression, improving or alleviating the condition, and alleviating or improving prognosis.

[0171] As used in this article, "immunodeficiency" refers to a subject's immune deficiency, making them highly susceptible to infection. Organisms that cause opportunistic infections typically do not cause illness in individuals with healthy immune systems, but can infect those with compromised or suppressed immune systems.

[0172] The term “constitutive expression” as used in this article refers to expression under all physiological conditions.

[0173] As used herein, the term "induced expression" refers to expression under specific conditions, such as when T cells bind to an antigen. This section discusses how those skilled in the art perform routine "induced expression."

[0174] In some embodiments, the present invention provides an immune-response cell that expresses an antigen-binding receptor and exogenous type I interferon.

[0175] In some embodiments, the immune response cells of the present invention can target antigens expressed on cancer. These antigens or epitopes may be expressed on cancer or cancer-related tissues. In some cases, the target antigen may be overexpressed on cancer and have reduced or absent expression in normal tissues. In some cases, cancer-specific antigens and their epitopes can be targeted by the immune response cells of the present invention. Antigens can be derived from a wide variety of tumor antigens, such as tumor antigens generated by mutations, shared tumor-specific antigens, differentiation antigens, and antigens overexpressed in tumors. To name just a few examples, antigens that can be targeted or bound by the immune response cells of the present invention may be or derived from, including but not limited to: folic acid receptor α, 707-AP, adipophilin, AFP, AIM-2, ALDH1A1, Annexin II, ART-4, ARTC1, BAGE, BAGE-1, BCLX(L), BCMA, BING-4, BRACHYURY(IVS7). T / C polymorphism), BRACHYURY (TIVS7-2 polymorphism), BRACHYURY, B-RAF, CAMEL, CAR-ABL fusion protein (b3a2), CASP-5, CASP-8, Cdc27, CDC27 / m, CDK4, CDK-4 / m, CDKN2A, CEA, COA-1, CPSF, Cyp-B, DAM-6, -10, dek-can fusion protein, DKK1, EFTUD2, EGFR, ELF2M, ENAH (hMena), EP-CAM, EphA3, ESO-1 / LAGE-2, ETV6-AML1 fusion protein, ETV6 / AML, EZH2, FGF5, FLT3-ITD, FN1, G250, G250 / MN / CAIX, Gage 3,4,5,6,7,GAGE-1,2,8,GAGE-3,-4,-5,-6,-7B,GnT-V,GnTVf,Gp100,gp100 / Pmel17,GPC3,GPNMB,Her2 / neu,Her3,HERV-K-MEL,HLA-A1ld,HLA-A2d,HPV E6,HPV E7, hsp70-2, HSP70-2M, HST-2, hTERT, hTRT, iCE, IL13Rα2, KIAA0205, KK-LC-1, KM-HN-1, K-ras, LDLR / FUT, LDLR-fucosyltransferase fusion protein, MAGE-A1, MAGE-A10, MAGE-A12, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A9, MAGE-C2, MART-1, MART2, MC1R, M-CSFT, MCSP, mdm-2, ME1Melan-A / MART-1, MMP-2, MUC1(VNTR polymorphism)-c, MUC1, MUC1-n, MUC2, MUM-1, MUM-1f, MUM-2, MUM-3, NA-88, NA88-A, NFYC, N-ras, NY-BR-1, NY-ESO-1, OA1, OGT, OS-9, P15, p53, PAP, PBF, Pml / RARα and TEL / AML1pml-RARα fusion protein, PRAME, PRDX5, PSA, PSCA, PSMA, PTPRK, RAB38 / NY-MEL-1, RAGE, RAGE-1, RBAF600, RGS5, RNF43, RU1, RU2, RU2AS, SAGE, SART-1, SART-2, SART-3, seternin 1, SIRT2, SNRPD1, SOX10, Sp17, SSX-2, SSX-4, STEAP, STEAP1, SYT-SSX1-or-SSX2 fusion protein, TBRACHYURY, T, TAG-1, TAG-2, TGF-βRII, TPI / mbcr-abl, TRAG-3, TRP-2, TRP-1, TRP-1 / gp75, TRP-2, TRP-2 / INT2, TRP2-INT2g, VEGF and / or WT1, XA GE-1b, α-actin-4, β-catenin, β-catenin / m, triphosphate isomerase, mammary globulin-A, human papillomavirus (HPV), human epidermal growth factor receptor 2 (HER2 / neu), human epidermal growth factor receptor 3 (HER3), elongation factor 2, prostate-specific antigen (PSA), survivin, neo-PAP, kallikrein 4, alpha-fetoprotein, telomerase, mucin, cyclin D1, myosin / m, myosin I, intestinal carboxylesterase, caspase-8 / m, tyrosinase.

[0176] Furthermore, the immune response cells of the present invention can target tumor-associated antigens. Tumor-associated antigens can be host-abnormally expressed antigens, which may be mutated, truncated, misfolded, or otherwise aberrantly expressed molecules; they may be the same as normally expressed molecules but expressed at abnormally high levels; or they may be expressed in an aberrant environment. Tumor-associated antigens can be, for example, proteins or protein fragments, complex carbohydrates, gangliosides, haptens, nucleic acids, other biomolecules, or any combination thereof. In some cases, the antigen can be a neoantigen. Neoantigens can be derived from somatic mutations in cancer cells. For example, a neoantigen can be a mutated form of triphosphate isomerase (TPI). Mutated fibronectin (FN) is another example of a neoantigen that can be targeted by the immune response cells of the present invention. Neoantigens can be identified by screening platforms such as biochemistry, whole-exterior sequencing, genetically targeted expression (GTE), or combinations thereof.

[0177] In some cases, the targets that can be bound by the immune response cells of this invention may be associated with the cancer stroma. The cancer stroma may be associated with the tumor microenvironment. The antigens may be matrix antigens. For example, matrix antigens and epitopes may be present on, but are not limited to, tumor endothelial cells, tumor vascular system, tumor fibroblasts, tumor pericytes, tumor stroma, and / or tumor mesenchymal cells. Those antigens may, for example, be selected from CD34, MCSP, FAP, CD31, PCNA, CD117, CD40, MMP4, and / or tendinin.

[0178] Tissue expression of antigens can be measured by immunohistochemistry (IHC) analysis and / or flow cytometry. Tissue expression can also be measured by copy number obtained by quantitative PCT (qPCR). In some cases, target antigens can be expressed on the surface of cancer cells. In some cases, the targetable antigen may not be expressed in the MHC or HLA environment. The immune response cells of the present invention can target cell surface antigens in a non-MHC-restricted manner. In some cases, antigens that can be targeted by CAR-T may be overexpressed compared to their expression in normal tissues. Measured by IHC, qPCR, or flow cytometry, overexpression can be approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or up to 100 times that expressed in normal tissues.

[0179] In some embodiments, the antigen-binding receptor comprises an antigen-binding domain (extracellular binding region) and an intracellular signaling domain capable of activating immune response cells. Preferably, a transmembrane region is also included between the antigen-binding domain and the intracellular signaling domain (intracellular signaling region). As one embodiment, the extracellular binding region contains an antibody against an antigen, which is a tumor antigen or a pathogen antigen. Expressing this antigen-binding receptor on the surface of immune response cells allows the immune response cells to exhibit highly specific cytotoxic effects against tumor cells or pathogens expressing that antigen.

[0180] In some embodiments, the receptor for binding antigens described in this invention contains a single-chain antibody that is connected to a transmembrane region, which is immediately followed by an intracellular signaling region.

[0181] In some embodiments, the antigen-binding domain of the present invention is a binding domain for binding tumor antigens. In some embodiments, the tumor antigen is a differentiation antigen selected from MART-1 / MelanA (MART-I), gp100 (Pmel17), tyrosinase, TRP-1, TRP-2, and tumor-specific multicentric antigens such as MAGE-1, MAGE-3, BAGE, GAGE-1, GAGE-2, p15; overexpressed embryonic antigens such as CEA; overexpressed oncogenes and mutated tumor suppressor genes such as p53, Ras, HER-2 / neu; unique tumor antigens caused by chromosomal translocations, such as BCR-ABL, E2A-PRL, H4-RET, IGH-IGK, and MYL-RAR; and viral antigens, such as Epstein-Barr virus antigen EBVA and human papillomavirus (HPV) antigens E6 and E7. Other major protein-based antigens include TSP-180, MAGE-4, MAGE-5, MAGE-6, RAGE, NY-ESO, p185erbB2, p180erbB-3, c-met, nm-23H1, PSA, TAG-72, CA 19-9, CA 72-4, CAM 17.1, NuMa, K-ras, β-linkin, CDK4, Mum-1, p15, p16, 43-9F, 5T4, 791Tgp72, alpha-fetoprotein, beta-HCG, BCA225, BTAA, CA 125, CA 15-3, CA 27.29, BCAA, CA 195, CA 242, CA-50, CAM43, CD68 / P1, CO-029, FGF-5, G250, Ga733 / EpCAM, HTgp-175, M344, MA-50, MG7-Ag, MOV18, NB / 70K, NY-CO-1, RCAS1, SDCCAG16, TA-90 / Mac-2 binding protein / cyclic protein C-related protein, TAAL6, TAG72, TLP, and one or more of TPS.In some embodiments, the tumor antigen is selected from prostate-specific membrane antigen (PSMA), carcinoembryonic antigen (CEA), IL13Ralpha, HER-2, CD19, NY-ESO-1, HIV-1Gag, Lewis Y, MART-1, gp100, tyrosinase, WT-I, hTERT, mesothelin, EGFR, EGFRvIII, phosphatidylinositol proteoglycan 3, EphA2, HER3, EpCAM, MUC1, MUC16, CLDN18.2, folic acid receptor, CLDN6, CD30, CD138, ASGPR1, CDH16, GD2, 5T4, 8H9, αvβ6 integrin, B cell maturation antigen (BCMA), B7-H3, B7-H6, CAIX, CA9, CD20, CD22, and κ light chain (kappa). The following are some of the following: lightchain, CD33, CD38, CD44, CD44v6, CD44v7 / 8, CD70, CD123, CD171, CSPG4, EGP2, EGP40, ERBB3, ERBB4, ErbB3 / 4, FAP, FAR, FBP, embryonic AchR, GD2, GD3, HLA-AI, MAGE A1, MAGE3, HLA-A2, IL11Ra, KDR, Lambda, MCSP, NCAM, NKG2D ligand, PRAME, PSCA, PSC1, ROR1, Sp17, SURVIVIN, TAG72, TEM1, TEM8, VEGRR2, HMW-MAA, VEGF receptor, and / or fibronectin, tendinin, or carcinoembryonic variants of tumor necrosis. In some embodiments, the tumor antigen is selected from one or more of the following: prostate-specific membrane antigen, carcinoembryonic antigen, IL13Ralpha, HER-2, CD19, NY-ESO-1, HIV-1Gag, Lewis Y, MART-1, gp100, tyrosinase, WT-I, hTERT, mesothelin, EGFR, EGFRvIII, phosphatidylinositol proteoglycan 3, EphA2, HER3, EpCAM, MUC1, MUC16, claudin 18.2, folate receptor, claudin 6, CD30, CD138, MAGE3, ASGPR1, and CDH16.

[0182] In some embodiments, the transmembrane region of the antigen-binding receptor may be selected from the transmembrane region of proteins such as CD8 or CD28. Human CD8 protein is a heterodimer composed of either αβ or γδ chains. In some embodiments, the transmembrane region is selected from the transmembrane region of CD8α or CD28. Furthermore, the CD8α hinge region is a flexible region; therefore, CD8 or CD28 and the transmembrane region, along with the hinge region, are used to connect the target recognition domain (scFv) of the antigen-binding receptor CAR to the intracellular signaling region.

[0183] The intracellular signaling domain of this invention can be selected from CD3ζ, FcεRIγ, CD28 co-stimulatory signaling domain, CD137 co-stimulatory signaling domain, and combinations thereof. The CD3 molecule consists of five subunits, among which the CD3ζ subunit (also known as CD3zeta, abbreviated as Z) contains three ITAM motifs, which are important signal transduction regions in the TCR-CD3 complex. Furthermore, as mentioned above, CD28 and CD137 are co-stimulatory signaling molecules. Upon binding to their respective ligands, the co-stimulatory effect of their intracellular signaling regions induces sustained proliferation of immune response cells (mainly T lymphocytes) and can increase the levels of cytokines such as IL-2 and IFN-γ secreted by immune response cells, thereby improving the survival time and anti-tumor effect of CAR immune response cells in vivo. In some embodiments, the intracellular signaling domain is the CD3ζ signaling domain or a combination of the CD3ζ signaling domain and other co-stimulatory signals such as CD28.

[0184] In some embodiments, the immune response cells of the present invention may include an expression construct containing elements sequentially linked in the following manner: an antibody, a CD28 co-stimulatory signaling domain, CD3ζ, and an NFAT6 and type I interferon expression unit connected in reverse to the aforementioned elements. Preferably, the antibody and the CD28 co-stimulatory signaling domain are connected via a CD8α transmembrane region and a CD8α hinge region.

[0185] In some implementations, the nuclear factor of activated T cells (NFAT) plays a crucial role in the transcriptional expression of cytokines during T cell activation. Based on this consideration, the inventors placed the IFN-beta coding sequence under the regulation of the NFAT6 promoter, ensuring that IFN-beta is expressed at a high level only when CAR-T cells come into contact with an antigen, triggering T cell activation.

[0186] The NFAT6 promoter is a promoter composed of six NFAT binding sites linked together with the minimal promoter of IL2 (Hooijberg E, Bakker AQ, Ruizendaal JJ, Spits H. NFAT-controlled expression of GFP permits visualization and isolation of antigen-stimulated primary human T cells. Blood. 2000 Jul 15; 96(2):459-66). It can be used to regulate the expression of cytokines such as IL-12 in T lymphocytes such as TCR-T (Zhang L, Kerkar SP, Yu Z, Zheng Z, Yang S, Restifo NP, Rosenberg SA, Morgan RA. Improving adoptive T cell therapy by targeting and controlling IL-12 expression to the tumor environment. Mol Ther. 2011 Apr; 19(4):751-9).

[0187] According to one aspect of the invention, the invention also includes a nucleic acid encoding a receptor for the said antigen-binding antigen. The invention also relates to variants of the aforementioned polynucleotide that encode polypeptides or fragments of polypeptides, analogs, and derivatives having the same amino acid sequence as those of the invention.

[0188] This invention also provides a vector containing nucleic acid encoding the receptor protein that binds to the antigen expressed on the surface of immune-responding cells. In one specific embodiment, the vector used in this invention is a lentiviral plasmid vector pRRLSIN-cPPT.PGK-GFP.WPRE. It should be understood that other types of viral vectors and non-viral vectors can also be used.

[0189] The present invention also includes viruses comprising the aforementioned vectors. The viruses of the present invention include packaged infectious viruses, and also include unpackaged viruses containing the components necessary for packaging into infectious viruses. Other viruses and their corresponding plasmid vectors known in the art for the transfer of exogenous genes into immune response cells can also be used in the present invention.

[0190] The immune response cells of the present invention are transduced with a construct, expression vector, or virus containing a plasmid that expresses a receptor binding to an antigen and an exogenous type I interferon. Conventional nucleic acid transduction methods in the art, including non-viral and viral transduction methods, can be used in the present invention.

[0191] The immune response cells described in this invention may further carry the coding sequences of exogenous cytokines; these cytokines include, but are not limited to, IL-12, IL-15, or IL-21. These cytokines possess further immunomodulatory or antitumor activity, enhancing the function of effector T cells and activated NK cells, or directly exerting antitumor effects. Therefore, those skilled in the art will understand that the use of these cytokines helps the immune response cells to function better.

[0192] The immune response cells described in this invention can also express another antigen-binding receptor besides the aforementioned antigen-binding receptors.

[0193] The immune response cells described in this invention may also express chemokine receptors; these chemokine receptors include, but are not limited to, CCR2. Those skilled in the art will understand that the CCR2 chemokine receptor allows for competitive binding of CCR2 in the body, which is advantageous for blocking tumor metastasis.

[0194] The immune response cells described in this invention can also express siRNAs that reduce PD-1 expression or proteins that block PD-L1. Those skilled in the art will understand that competitively blocking the interaction between PD-L1 and its receptor PD-1 is beneficial for restoring anti-tumor T cell responses, thereby inhibiting tumor growth.

[0195] The immune response cells described in this invention may also express safety switches; preferably, the safety switches include iCaspase-9, Truncated EGFR, or RQR8.

[0196] In some embodiments, the immune response cells of the present invention do not express co-stimulatory ligands such as 4-1BBL.

[0197] Transgenic genes encoding receptors or CARs that target antigens can be incorporated into cells. For example, transgenic genes can be incorporated into immune-responding cells, such as T cells. When inserted into cells, transgenic genes can be complementary DNA (cDNA) fragments, copies of messenger RNA (mRNA), or the gene itself (with or without introns) located in its original genomic DNA region.

[0198] Nucleic acids, such as DNA, encoding transgenic sequences can be randomly inserted into the chromosomes of a cell. Random integration can be achieved by any method of introducing nucleic acids (e.g., DNA) into the cell. For example, such methods may include, but are not limited to, electroporation, sonication, the use of a gene gun, lipid transfection, calcium phosphate transfection, the use of dendritic macromolecules, microinjection, and the use of viral vectors, including adenoviruses, AAVs, and retroviral vectors, and / or type II ribozymes.

[0199] The DNA encoding the transgene can also be designed to include a reporter gene, allowing the detection of the transgene or its expression product by the activation of the reporter gene. Any reporter gene can be used, such as those mentioned above. Cells containing the transgene can be selected by choosing cells in a cell culture where the reporter gene has been activated.

[0200] CAR expression can be verified using expression assays such as qPCR or by measuring RNA levels. Expression levels can also indicate copy number. For example, very high expression levels may indicate that more than one copy of the CAR has been integrated into the genome. Alternatively, high expression may indicate that the transgene is integrated into a highly transcribed region, such as near a highly expressed promoter. Expression can also be verified by measuring protein levels, such as through Western blotting.

[0201] In some embodiments, the immune response cells of the present invention may contain one or more transgenic genes. The one or more transgenic genes may express a CAR protein that recognizes and binds to at least one epitope on an antigen or binds to a mutated epitope on an antigen. The CAR may be a functional CAR. In some embodiments, the immune response cells of the present invention may contain one or more CARs, or they may contain a single CAR and a secondary engineered receptor.

[0202] In some implementations, the transgene may encode a suicide gene. As demonstrated by many effective treatments for cancer patients, CAR immune-response cells lead to tumor regression but can be accompanied by toxicity. In some implementations, CAR immune-response cells may be unable to distinguish between tumor and normal tissue when the target antigen is shared in both normal and tumor cells (“on-target / off-target toxicity”). In other cases, a systemic perturbation of the immune system, known as cytokine release syndrome (CRS), can occur. CRS may comprise systemic inflammatory response syndrome or a cytokine storm, which may be a consequence of the rapid expansion of CAR immune-response cells in vivo. CRS is a condition characterized by fever and hypotension, and in severe cases, can lead to multiple organ failure. In most cases, the toxicity is associated with the in vivo expansion of the infused CAR immune-response cells, which can cause a systemic perturbation of the immune system and the release of high levels of pro-inflammatory cytokines such as TNFα and IL-6. A suicide gene can induce the elimination of CAR immune-response cells. The suicide gene can be any gene that induces apoptosis in the CAR immune-response cells. The suicide gene may be encoded within a viral vector along with a receptor that binds the antigen. Encoding a suicide gene allows for the mitigation or complete cessation of toxicity caused by the proliferation of infused CAR immune response cells in vivo under specific conditions.

[0203] In some implementations, CAR-immunoreactive cells containing antigens present in normal tissues can be generated, enabling them to transiently express CAR, for example, after electroporation encoding the receptor's mRNA. Furthermore, significant efforts to further enhance CAR-immunoreactive cells by including a safety switch can greatly eliminate CAR-immunoreactive cells in cases of severe on-target toxicity. The CAR-encoding vector can be combined with a safety switch such as an inducible caspase-9 gene (activated by a dimerization chemical inducer) or a truncated form of the EGF receptor R (activated by the monoclonal antibody cetuximab) or RQR8.

[0204] The one or more transgenic genes used in this article may originate from different species. For example, one or more transgenic genes may contain human genes, mouse genes, rat genes, pig genes, bovine genes, dog genes, cat genes, monkey genes, chimpanzee genes, or any combination thereof. For example, the transgenic gene may originate from a human with a human genetic sequence. One or more transgenic genes may contain human genes. In some cases, one or more transgenic genes are not adenovirus genes.

[0205] As described above, transgenes can be inserted into the genome of immune-responsive cells in a random or site-specific manner. For example, transgenes can be inserted into random sites within the genome of immune cells. These transgenes can be functional, for example, fully functional wherever they are inserted into the genome. For instance, a transgene can encode its own promoter or can be inserted into a site controlled by its own promoter. Alternatively, a transgene can be inserted into a gene, such as an intron or exon, promoter, or non-coding region. Transgene insertion can cause the insertion to disrupt genes, such as endogenous immune checkpoints.

[0206] In some implementations, more than one copy of the transgene can be inserted into multiple random sites within the genome. For example, multiple copies can be inserted into random sites in the genome. This may result in increased overall expression compared to a single random insertion of the transgene. Alternatively, one copy of the transgene can be inserted into a gene, and another copy of the transgene can be inserted into a different gene. The transgene can be targeted so that it can be inserted into a specific site in the genome of immune-responsive cells.

[0207] In some embodiments, the polynucleotide containing the receptor sequence encoding the binding antigen can be in the form of a plasmid vector. The plasmid vector may contain a promoter. In some cases, the promoter may be constitutive. In some embodiments, the promoter is inducible. The promoter may be or can be derived from CMV, U6, MND, or EF1a. In some embodiments, the promoter may be adjacent to the CAR sequence. In some embodiments, the plasmid vector also contains a splice acceptor. In some embodiments, the splice acceptor may be adjacent to the CAR sequence. The promoter sequence may be a PKG or MND promoter. The MND promoter may be a synthetic promoter containing the U3 region of a MoMuLV LTR modified with a myeloproliferative sarcoma virus enhancer.

[0208] In some implementations, polynucleotides encoding target receptors can be engineered for delivery to cells via non-viral technologies. In certain cases, polynucleotides can be well-manufacturing specification (GMP) compliant reagents.

[0209] The expression of polynucleotides encoding receptors or CARs that target antigens can be controlled by one or more promoters. Promoters can be ubiquitous, constitutive (unrestricted promoters that allow for continuous transcription of the associated gene), tissue-specific, or inducible promoters. The expression of transgenes inserted near or adjacent to a promoter can be regulated. For example, a transgene can be inserted near or next to a ubiquitous promoter. Some ubiquitous promoters can be CAGGS, hCMV, PGK, SV40, or ROSA26 promoters.

[0210] The promoter can be endogenous or exogenous. For example, one or more transgenes can be inserted near or adjacent to an endogenous or exogenous ROSA26 promoter. Furthermore, the promoter can be specific to immune-responsive cells. For example, one or more transgenes can be inserted near or adjacent to a porcine ROSA26 promoter.

[0211] Tissue-specific or cell-specific promoters can be used to control the location of expression. For example, one or more transgenes can be inserted near or adjacent to a tissue-specific promoter. Tissue-specific promoters can be FABP promoter, Lck promoter, CamKII promoter, CD19 promoter, keratin promoter, albumin promoter, aP2 promoter, insulin promoter, MCK promoter, MyHC promoter, WAP promoter, or Col2A promoter.

[0212] Inducible promoters can also be used. These inducible promoters can be turned on and off by adding or removing the inducer if needed. Expected inducible promoters can be, but are not limited to, Lac, Tac, Trc, Trp, araBAD, phoA, recA, proU, cst-1, tetA, cadA, nar, PL, cspA, T7, VHB, Mx and / or Trex.

[0213] As used herein, the term "inducible promoter" is a controlled promoter that does not express or expresses at low levels the gene operatively linked to it before the desired conditions are met, but expresses or expresses the gene operatively linked to it at high levels when the desired conditions are met. For example, in some embodiments, the inducible promoter of this application does not express or expresses at low levels the gene operatively linked to it under normal or high oxygen conditions in the cell, but expresses or expresses the gene operatively linked to it at high levels under hypoxic conditions in response to reduced oxygen levels in the cell. In some embodiments, the inducible promoter used herein includes hypoxia-inducible transcription factor-1α (HIF-1α). In some embodiments, the term "inducible promoter" used herein refers to an "immune cell-inducible promoter" that does not express or expresses at low levels the gene operatively linked to it before the immune responding cell comes into contact with the antigen or before the immune responding cell is activated, but only drives the gene operatively linked to it to be expressed at high levels or under hypoxic conditions when the immune responding cell comes into contact with the antigen. In some implementations, the “immune cell-inducible promoter” includes the NFAT (activated T cell nuclear factor) promoter.

[0214] The term "NFAT-type promoter" as used in this article refers to a class of promoters that regulate the expression of genes operatively linked to them based on NFAT binding activity.

[0215] NFAT is a family of transcription factors that play an important role in the immune response. One or more members of the NFAT family are expressed in most cells of the immune system. NFAT is also involved in the development of the heart, skeletal muscle, and nervous system.

[0216] The NFAT transcription factor family consists of five members: NFAT1, NFAT2, NFAT3, NFAT4, and NFAT5. NFAT1 through NFAT4 are regulated by calcium signaling. Calcium signaling is crucial for NFAT activation because calmodulin (CaM) activates the serine / threonine phosphatase calcineurin (CN). Activated CN rapidly dephosphorylates the serine-rich region (SRR) and SP repeat sequence at the N-terminus of the NFAT protein, leading to a conformational change that exposes nuclear localization signals, resulting in NFAT importation into the nucleus.

[0217] Based on the role of NFAT in the transcriptional expression of cytokines during T cell activation, it can be used to regulate the immune cell inducible promoter described in this article, thereby expressing or expressing at high levels the gene operatively linked to it when immune response cells are activated by contact with antigens.

[0218] The nucleic acids of this invention can contain any suitable nucleotide sequence encoding an NFAT-type promoter (or its functional portion or functional variant). As used herein, an "NFAT-type promoter" refers to one or more NFAT-responsive elements linked to the minimal promoter of any gene expressed by a T cell. Preferably, the minimal promoter of a gene expressed by a T cell is the minimal human IL-2 promoter. NFAT-responsive elements may include, for example, NFAT1, NFAT2, NFAT3, and / or NFAT4 responsive elements. In some embodiments, the "NFAT-type promoter" described herein may include more than one NFAT-binding motif. For example, the "NFAT-type promoter" may include 2, 3, 4, 5, 6, 7, 8, 9, 10, or more NFAT-binding motifs. In some embodiments, the "NFAT-type promoter" includes up to 12 NFAT-binding motifs. In some embodiments, the "NFAT-type promoter" may be a promoter consisting of multiple NFAT-binding motifs tandem with a promoter such as the minimal IL-2 promoter. In some embodiments, the NFAT-type promoter described herein comprises six NFAT-binding motifs, denoted as (NFAT)6. For convenience, (NFAT)6 is also referred to as NFAT6. In some embodiments, NFAT6 also represents six repeating NFAT-binding motifs (SEQ ID NO:78) in the NFAT-type promoter.

[0219] In addition, although not essential for expression, transgenic sequences may also include transcriptional or translational regulatory sequences, such as promoters, enhancers, insulators, internal ribosome entry sites, sequences encoding 2A peptides and / or polyadenylation signals.

[0220] In some embodiments, the transgene encodes a receptor or CAR that targets and binds to an antigen, wherein the transgene is inserted into a safe harbor such that the receptor that binds the antigen is expressed. In some embodiments, the transgene is inserted into the PD1 and / or CTLA-4 loci. In other cases, the transgene is delivered to cells for random insertion via lentivirus, with a PD1- or CTLA-4 specific nuclease provided as mRNA. In some embodiments, the transgene is delivered via a viral vector system such as a retrovirus, AAV, or adenovirus, along with mRNA encoding a safe harbor-specific nuclease (e.g., AAVS1, CCR5, albumin, or HPRT). Cells may also be treated with mRNA encoding PD1 and / or CTLA-4 specific nucleases. In some embodiments, the polynucleotide encoding the CAR is provided via a viral delivery system along with mRNA encoding HPRT-specific and PD1- or CTLA-4 specific nucleases. CARs that can be used with the methods and compositions disclosed herein may comprise all types of these chimeric proteins, including the first, second, and third generation designs described above.

[0221] In some implementations, retroviral vectors (gamma-retroviruses or lentiviral vectors) can be used to introduce transgenes into immune-responsive cells. For example, a transgene encoding a CAR or any receptor that binds to an antigen, or a variant or fragment thereof, can be cloned into a retroviral vector and can be driven by its endogenous promoter, a retroviral long terminal repeat sequence, or a promoter specific to the target cell type. Non-viral vectors can also be used. Non-viral vector delivery systems can include DNA plasmids, naked nucleic acids, and nucleic acids complexed with delivery vectors such as liposomes or poloxamers.

[0222] Numerous virus-based systems have been developed for transferring genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. Selected genes can be inserted into vectors and packaged into retroviral particles using techniques known in the art. Vectors derived from retroviruses, such as lentiviruses, are suitable tools for achieving long-term gene transfer because they allow for the long-term stable integration of transgenes and their propagation in daughter cells. Lentiviral vectors have additional advantages over vectors derived from retroviruses, such as murine leukemia virus, because they can transduce non-proliferating cells. They also have the added advantage of low immunogenicity. Adenoviral vectors have the advantage that they do not fuse into the genome of the target cell, thus bypassing negative integration-related events.

[0223] Cells can be transfected with a transgene encoding a receptor that binds the antigen. The transgene concentration can be from about 100 picograms to about 50 micrograms. In some embodiments, the amount of nucleic acid (e.g., ssDNA, dsDNA, or RNA) introduced into the cells can be varied to optimize transfection efficiency and / or cell viability. For example, 1 microgram of dsDNA can be added to each cell sample for electroporation. In some embodiments, the amount of nucleic acid (e.g., double-stranded DNA) required for optimal transfection efficiency and / or cell viability varies depending on the cell type. In some embodiments, the amount of nucleic acid (e.g., dsDNA) used for each sample can directly correspond to transfection efficiency and / or cell viability. For example, a range of transfection concentrations. The transgene encoded by the vector can be integrated into the cell genome. In some embodiments, the transgene encoded by the vector is integrated forward. In other cases, the transgene encoded by the vector is integrated backward.

[0224] In some implementations, the immune-reactive cells may be stem memory T cells composed of CD45RO(-), CCR7(+), CD45RA(+), CD62L+ (L-selectin), CD27+, CD28+ and / or IL-7Rα+. SCM The stem memory cells may also express CD95, IL-2Rβ, CXCR3, and / or LFA-1, and exhibit many functional properties different from those of the stem memory cells. Alternatively, the immunoreactive cells may also be central memory T cells containing L-selectin and CCR7. CM Cells, including central memory cells, can secrete, for example, IL-2, but not IFNγ or IL-4. Immunoreactive cells can also be effector memory T cells containing L-selectin or CCR7. EM Cells produce effector cytokines such as IFNγ and IL-4.

[0225] Typically, the vector is delivered to an individual patient via systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial infusion) or local application, as described below. Alternatively, the vector can be delivered ex vivo to cells, such as cells removed from an individual patient (e.g., lymphocytes, T cells, bone marrow aspirate, tissue biopsy), and then typically re-implanted into the patient after selecting cells incorporating the vector. Cell expansion can be performed before or after selection.

[0226] Suitable immune-reactive cells used to express receptors that bind antigens can be autologous or non-autologous cells for the individual in need.

[0227] Suitable sources of immune response cells can be obtained from an individual. In some cases, T cells can be obtained. These T cells can be obtained from many sources, including PBMCs, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, and tissues from sites of infection, ascites, pleural effusion, spleen tissue, and tumors. In some cases, any number of techniques known to those skilled in the art can be used, such as Ficoll. TM T cells are obtained from blood collected from the individual. In one embodiment, cells from the individual's circulating blood are obtained via apheresis. Apheresis products typically contain lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes, and platelets. In one embodiment, the cells collected via apheresis can be washed to remove plasma fractions and placed in a suitable buffer or culture medium for subsequent processing steps.

[0228] Alternatively, cells can be derived from healthy donors, from patients diagnosed with cancer, or from patients diagnosed with an infection. In some embodiments, the cells may be part of a mixed cell population with different phenotypic characteristics. Cell lines can also be obtained from transformed T cells according to the methods described above. Cells can also be obtained from cell therapy libraries. Modified cells resistant to immunosuppressive therapy can be obtained by any of the methods described herein. A suitable cell population can also be selected before modification. Engineered cell populations can also be selected after modification. Engineered cells can be used for autologous transplantation. Alternatively, the cells can be used for allogeneic transplantation. In some embodiments, the cells are administered to the same patient whose sample was used to identify cancer-related target sequences. In other cases, the cells are administered to a patient different from the patient whose sample was used to identify cancer-related target sequences.

[0229] In some embodiments, suitable primary cells include peripheral blood mononuclear cells (PBMCs), peripheral blood lymphocytes (PBLs), and other blood cell subsets, such as, but not limited to, T cells, natural killer cells, monocytes, natural killer T cells, monocyte precursor cells, hematopoietic stem cells, or non-pluripotent stem cells. In some embodiments, the cells can be any immune cell, including any T cell such as tumor-infiltrating cells (TILs), such as CD3+ T cells, CD4+ T cells, CD8+ T cells, or any other type of T cell. T cells may also include memory T cells, memory stem T cells, or effector T cells. T cells can also be selected from a large population, such as from whole blood. T cells can also be expanded from a large population. T cells may also be predisposed to specific populations and phenotypes. For example, T cells may be predisposed to phenotypes including CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+), and / or IL-7Rα(+). Suitable cells may be selected from one or more markers from the following list: CD45RO(-), CCR7(+), CD45RA(+), CD62L(+), CD27(+), CD28(+), and / or IL-7Rα(+). Suitable cells also include stem cells, such as embryonic stem cells, induced pluripotent stem cells, hematopoietic stem cells, neuronal stem cells, and mesenchymal stem cells. Suitable cells may comprise any number of primary cells, such as human cells, non-human cells, and / or mouse cells. Suitable cells may be progenitor cells. Suitable cells may be derived from the subject to be treated (e.g., a patient).

[0230] The amount of therapeutically effective cells required in a patient can vary depending on cell viability and the efficiency of cell genetic modification (e.g., the efficiency of transgene integration into one or more cells, or the expression level of proteins encoded by the transgene). In some embodiments, the product of genetically modified cell viability (e.g., doubling) and the efficiency of transgene integration may correspond to the therapeutic amount of cells available for administration to the subject. In some embodiments, an increase in genetically modified cell viability may correspond to a reduction in the amount of cells required for therapeutic efficacy in the patient. In some embodiments, an increase in the efficiency of transgene integration into one or more cells may correspond to a reduction in the number of cells required for therapeutic efficacy in the patient. In some embodiments, determining the required amount of therapeutically effective cells may include determining the function associated with changes in cell function over time. In some embodiments, determining the required amount of therapeutically effective cells may include determining the function corresponding to changes in the efficiency of transgene integration into one or more cells based on time-related variables (e.g., cell culture time, electroporation time, cell stimulation time). In some embodiments, therapeutically effective cells may be a cell population comprising approximately 30% to approximately 100% expression of antigen-binding receptors on the cell surface. In some implementations, measured by flow cytometry, therapeutically effective cells can express approximately 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or more than approximately 99.9% of the receptors binding the said antigen on their cell surface.

[0231] In some embodiments, when the receptor for binding the antigen is present on the cell's plasma membrane and is activated by binding to a target, it can result in cytotoxicity of cells having a target that the receptor for binding the antigen expresses on its cell surface is capable of binding. For example, in some cases, when the cell is present in the cell's plasma membrane, the cell can be a cytotoxic cell (e.g., NK cells or cytotoxic T lymphocytes), the receptor for binding the antigen described herein, and when activated by binding to its target, it can increase the cytotoxic activity of the cytotoxic cell against the target cell. For example, in some embodiments, the receptor for binding the antigen described herein, when activated by binding to its target, can increase cytotoxicity by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 75%, at least 2-fold, at least 2.5-fold, at least 5-fold, at least 10-fold, or more than 10-fold compared to cytotoxicity against cells without a binding target.

[0232] The immune response cells of the present invention can be used to prepare pharmaceutical compositions. In addition to comprising an effective amount of immune response cells, the pharmaceutical compositions may also contain a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" means that when the molecular matrix and composition are appropriately administered to animals or humans, they do not produce adverse, allergic, or other adverse reactions.

[0233] Specific examples of substances that can serve as pharmaceutically acceptable carriers or components include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethyl cellulose, ethyl cellulose, and methyl cellulose; tragacanth gum powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; and emulsifiers such as... Wetting agents, such as sodium lauryl sulfate; coloring agents; flavoring agents; tableting agents; stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic salt solutions; and phosphate buffer solutions, etc.

[0234] The compositions of the present invention can be formulated into various dosage forms as needed, and the dosage beneficial to the patient can be determined by a physician based on factors such as patient type, age, weight, general disease condition, and route of administration. The route of administration can be, for example, parenteral administration (e.g., injection) or other treatment methods.

[0235] "Parenteral" administration of immunogenic compositions includes techniques such as subcutaneous (sc), intravenous (iv), intramuscular (im), or intrasternal injection or infusion.

[0236] A formulation containing a population of immune-reactive cells administered to an individual comprises multiple immune-reactive cells effective in treating and / or preventing a specific indication or disease. Therefore, a therapeutically effective population of immune-reactive cells can be administered to an individual. Typically, an administration of approximately 1 × 102 4 To approximately 1×10 10 A formulation containing approximately 1 × 10⁶ immune reactive cells. In most cases, the formulation will contain approximately 1 × 10⁶ immune reactive cells. 5 To approximately 1×10 9 5 × 10 immune reactive cells 5 Approximately 5×10 8 One immune reactive cell, or approximately 1 × 102 6 To approximately 1×10 7 The number of CAR immune-reactive cells administered to an individual will vary widely depending on factors such as the location, origin, identity, extent, and severity of the cancer, as well as the individual's age and physical condition. The physician will ultimately determine the appropriate dose to use.

[0237] In some embodiments, chimeric antigen receptors are used to stimulate immune cell-mediated immune responses. For example, a T cell-mediated immune response is an immune response involving T cell activation. Activated antigen-specific cytotoxic T cells are able to induce apoptosis in target cells displaying exogenous antigen epitopes on their surfaces, such as cancer cells displaying tumor antigens. In another embodiment, chimeric antigen receptors are used to deliver antitumor immunity in mammals. Due to the T cell-mediated immune response, the subject will develop antitumor immunity.

[0238] In some cases, methods of treating subjects with cancer may involve administering one or more of the immune response cells described in this invention to the subject requiring treatment. These immune response cells can bind to tumor target molecules and induce cancer cell death. As described above, this invention also provides a method of treating pathogen infection in an individual, comprising administering a therapeutically effective amount of the immune response cells of this invention to the individual.

[0239] The frequency of administration of the immune-responsive cells of the present invention will vary depending on factors including the disease being treated, the specific immune-responsive cell components, and the route of administration. For example, administration may be performed four, three, two times daily, or once daily, every other day, every three days, every four days, every five days, every six days, once a week, once every eight days, once every nine days, once every ten days, once a week, or twice a month. As described herein, because the immune-responsive cells of this application have improved activity, they can be administered not only at a lower therapeutically effective amount than similar immune-responsive cells that do not express exogenous type I interferon, but also at a lower frequency to achieve at least a similar, and preferably more significant, therapeutic effect.

[0240] In some embodiments, the immune-response cells of the present invention can be administered in combination with another therapeutic agent. In some embodiments, the other therapeutic agent is a chemotherapeutic agent. Chemotherapeutic agents that can be used in combination with the immune-response cells of the present invention include, but are not limited to, mitotic inhibitors (vinblastine alkaloids), including vincristine, vinblastine, vindesin, and novibine™ (vinorelbine, 5'-dehydrosulfuride); topoisomerase I inhibitors, such as camptothecin compounds, including Camptothecin TM (irinotecan HCl), Hycamtin TMTopotecan HCl and other compounds derived from camptothecin and its analogues; podophyllotoxin derivatives, such as etoposide, teniposide, and midoxozolium; alkylating agents cisplatin, cyclophosphamide, nitrogen mustard, trimethylene thiophosphamide, carmustine, busulfan, chlorambucil, briquette, uracil mustard, chlorprofen, and dacarbazine; antimetabolites, including cytarabine, fluorouracil, methotrexate, mercaptopurine, azathioprine, and procarbazine; antibiotics, including but not limited to doxorubicin, bleomycin, daunorubicin, daunorubicin, mitomycin, sarcomacin C, and donomycin; and other chemotherapeutic agents, including but not limited to antitumor antibodies, dacarbazine, cytidine, amsacon, melphalan, ifosfamide, and mitoxantrone.

[0241] In some embodiments, chemotherapeutic agents that can be used in combination with the immune response cells of the present invention include, but are not limited to, anti-angiogenic agents, including anti-VEGF antibodies (including humanized and chimeric antibodies, anti-VEGF aptamers and antisense oligonucleotides) and other angiogenesis inhibitors, such as angiostatin, endostatin, interferon, interleukin-1 (including α and β), interleukin-12, retinoic acid and tissue inhibitors of metalloproteinases-1 and-2.

[0242] In some embodiments, the compositions may be isotonic, meaning they may have the same osmotic pressure as blood and tears. The desired isotonicity of the compositions of the present invention can be achieved using sodium chloride or other pharmaceutically acceptable agents such as glucose, boric acid, sodium tartrate, propylene glycol, or other inorganic or organic solutes. If desired, the viscosity of the composition can be maintained at a selected level using a pharmaceutically acceptable thickener. Suitable thickeners include, for example, methylcellulose, xanthan gum, carboxymethylcellulose, hydroxypropylcellulose, carbomer, etc. The preferred concentration of the thickener will depend on the chosen agent. Clearly, the selection of a suitable carrier and other additives will depend on the exact route of administration and the nature of the specific dosage form, such as a liquid dosage form.

[0243] The present invention also provides a kit containing the immune-response cells of the present invention. The kit can be used to treat or prevent cancer, pathogen infection, immune disorders, or allogeneic transplantation. In one embodiment, the kit may include a therapeutic or preventative composition containing an effective amount of one or more unit dosage forms of immune-response cells. In some embodiments, the kit includes a sterile container that may contain the therapeutic or preventative composition; such a container may be a box, ampoule, bottle, vial, tube, bag, blister pack, or other suitable container form known in the art. Such a container may be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding the drug. In some embodiments, immune-response cells, such as CAR T cells, and instructions for administering CAR immune-response cells to a subject at risk of developing cancer, pathogen infection, immune disorders, or allogeneic transplantation may be provided. The instructions will typically include information about the use of the composition for the treatment or prevention of cancer, pathogen infection, immune disorders, or allogeneic transplantation. In some embodiments, the kit may include about 1 × 10⁻⁶ cells. 4 One to approximately 1 × 10⁹ cells 6 Cells. In some embodiments, the kit may include at least about 1 × 10⁶ cells. 5 1 × 10⁶ cells, at least approximately 1 × 10⁶ 6 1 × 10⁶ cells, at least approximately 1 × 10⁶ 7 10 cells, at least approximately 4 × 10 7 10 cells, at least approximately 5 × 10 7 10 cells, at least approximately 6 × 10 7 10 cells, at least approximately 6 × 10 7 8 × 10 cells 7 10 cells, at least approximately 9 × 10 7 1 × 10⁶ cells, at least approximately 1 × 10⁶ 8 10⁸ cells, at least approximately 2 × 10⁸ cells, at least approximately 3 × 10⁸ cells. 8 10 cells, at least approximately 4 × 10 8 10 cells, at least approximately 5 × 10 8 10 cells, at least approximately 6 × 10 8 10 cells, at least approximately 6 × 10 8 Cells, at least approximately 8 × 10 8 10 cells, at least approximately 9 × 10 8 Cells, at least about 1 × 10 9 10 cells, at least approximately 2 × 10 9 10 cells, at least approximately 3 × 10 9 10 cells, at least approximately 4 × 10 9 10 cells, at least approximately 5 × 10 9 10 cells, at least approximately 6 × 10 9 10 cells, at least approximately 8 × 10 910 cells, at least approximately 9 × 10 9 1 × 10⁶ cells, at least approximately 1 × 10⁶ 10 10 cells, at least approximately 2 × 10 10 10 cells, at least approximately 3 × 10 10 10 cells, at least approximately 4 × 10 10 10 cells, at least approximately 5 × 10 10 10 cells, at least approximately 6 × 10 10 10 cells, at least ab, at least approximately 9 × 10 10 10 cells, at least approximately 9 × 10 10 1 × 10⁶ cells, at least approximately 1 × 10⁶ 11 10 cells, at least approximately 2 × 10 11 10 cells, at least approximately 3 × 10 11 10 cells, at least approximately 4 × 10 11 10 cells, at least approximately 5 × 10 11 10 cells, at least approximately 8 × 10 11 10 cells, at least approximately 9 × 10 11 One cell, or at least about 1 × 10⁻⁶ cells. 12 Cells. For example, approximately 5 × 10⁶ cells can be included in the kit. 10 100 cells. In another example, the kit may include 3 × 10⁶ cells. 6 10 cells; cells can be expanded to approximately 5 × 102 10 One cell was administered to the subject.

[0244] In some embodiments, the kit may include allogeneic cells. In some embodiments, the kit may include cells that may contain genomically modified cells. In some embodiments, the kit may contain "off-the-shelf" cells. In some embodiments, the kit may include cells that can be expanded for clinical use. In some cases, the kit may contain contents for research purposes.

[0245] In some embodiments, the instructions include at least one of the following: a description of the therapeutic agent; a dosage regimen and administration for the treatment or prevention of tumors, pathogen infections, immune diseases, or allogeneic transplants or their symptoms; precautions, warnings, contraindications, overdose information, adverse reactions, animal pharmacology, clinical studies, and / or cited literature. The instructions may be printed directly on the container (if any), as a label on the container, or as separate sheets of paper, brochures, cards, or folders provided inside or within the container. In some embodiments, the instructions provide a method of administering the immune-responsive cells described herein for the treatment or prevention of tumors, pathogen infections, immune diseases, or allogeneic transplants or their symptoms. In some cases, the instructions provide a method of administering the immune-responsive cells of the present invention before, after, or simultaneously with the administration of a chemotherapeutic agent.

[0246] According to one aspect of the invention, the invention also provides a method for treating an individual's tumor or pathogen infection, or for enhancing an individual's immune tolerance. In some embodiments, the method includes administering to an individual in need an immune response cell of the invention, the immune cell expressing a receptor for the binding antigen and exogenous type I interferon. In some embodiments, the method includes administering to an individual in need the receptor for the binding antigen and exogenous type I interferon of the invention. In some embodiments, the exogenous type I interferon is administered sequentially or simultaneously with the immune response cell expressing the receptor for the binding antigen. In some embodiments, the exogenous type I interferon is administered to the patient simultaneously with the immune response cell by co-expression in the immune response cell.

[0247] This invention provides a method for enhancing the viability of immune response cells administered to an individual, the immune response cells expressing the antigen-binding receptors described in this invention, and wherein the method comprises administering the immune response cells and an effective amount of exogenous type I interferon to the individual. In some embodiments, the exogenous type I interferon and the immune response cells expressing the antigen-binding receptors are administered sequentially or simultaneously. In some embodiments, the exogenous type I interferon is administered to the patient simultaneously with the immune response cells by co-expression on the immune response cells.

[0248] In some embodiments, it is precisely because the viability of the immune response cells of the present invention is enhanced that the immune response cells of the present invention can be administered at a lower dose and / or a lower frequency compared to the case where no exogenous type I interferon is administered or where the immune response cells do not co-express the exogenous type I interferon.

[0249] In some embodiments, the amount of the immune response cells of the present invention administered to individuals in need is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to the case where no exogenous type I interferon is administered or the immune response cells do not co-express the exogenous type I interferon. In some embodiments, the frequency of administering the immune response cells of the present invention to individuals in need is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% compared to the case where no exogenous type I interferon is administered or the immune response cells do not co-express the exogenous type I interferon. Alternatively, compared to the case where no exogenous type I interferon is administered or the immune response cells do not co-express the exogenous type I interferon, in cases where the immune response cells of the present invention need to be administered multiple times to individuals in need, the interval between each administration is extended by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 500%, 750%, or 1000%.

[0250] In some embodiments, the method of the present invention causes the sum of the number of cytotoxic T cells and helper T cells in the peripheral blood of the individual to increase by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 140%, 160%, 180%, 200%, 500%, 750%, or 1000% after the individual is given the immune response cells, compared to the absence of the exogenous type I interferon. In some embodiments, the method results in the sum of cytotoxic T cells and helper T cells in the peripheral blood of the individual being greater than 5,000 / μL, 10,000 / μL, 15,000 / μL, 20,000 / μL, and 25,000 / μL approximately 5 days after administration of the immune response cells; and the sum of cytotoxic T cells and helper T cells in the peripheral blood of the individual being greater than 100 / μL, 200 / μL, 300 / μL, 400 / μL, 500 / μL, 600 / μL, 700 / μL, and 800 / μL approximately 7 days after administration of the immune response cells. / μL, 900 / μL, 1,000 / μL, 1,500 / μL, 2,000 / μL, 2,500 / μL, 3,000 / μL, 3,500 / μL, 4,000 / μL, 4,500 / μL, or 5,000 / μL; or approximately 10 days after administration of the immune response cells, the sum of the number of cytotoxic T cells and helper T cells in the peripheral blood of the individual is greater than 10 / μL, 20 / μL, 30 / μL, 40 / μL, 50 / μL, 60 / μL, 70 / μL, 80 / μL, 90 / μL, or 100 / μL.

[0251] The present invention also provides a method for modulating an immune response in an individual, the method comprising administering the individual any effective amount of immune response cells of the present invention.

[0252] The present invention also provides a method for enhancing individual immune tolerance, the method comprising administering to an individual an effective amount of the immune response cells of the present invention, the cells comprising receptors binding to tumor antigens and carriers encoding type I interferon. Preferably, the method can prevent or reduce autoimmune diseases or diseases associated with allogeneic transplantation.

[0253] The present invention also provides a method for treating or preventing an individual from being infected with a pathogen, the method comprising administering an effective amount of immune response cells containing receptors that bind viral antigens and carriers encoding type I interferon.

[0254] Autologous lymphocyte infusion can be used for treatment. Autologous peripheral blood mononuclear cells (PBMCs) can be collected from patients in need of treatment, and T cells can be activated and expanded using methods described herein and known in the art, before being infused into the patient. In other cases, allogeneic cells can be used to treat patients.

[0255] The methods disclosed herein may include transplantation. Transplantation can refer to adoptive transplantation of cell products. Transplantation can be autologous transplantation, allogeneic transplantation, xenotransplantation, or any other type of transplantation. For example, transplantation can be xenotransplantation. Transplantation can also be allogeneic transplantation.

[0256] In some implementations, the subject may be given immunoreactive cells, wherein the immunoreactive cells that can be administered can be approximately 1 to approximately 35 days old. For example, the administered cells can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or up to approximately 40 days old. The age of the CAR immunoreactive cells can be calculated from the time of stimulation. The age of the immunoreactive cells can be calculated from the time of blood collection. The age of the immunoreactive cells can be calculated from the time of transduction. In some implementations, the immunoreactive cells that can be administered to the subject are approximately 10 to approximately 14 days old or approximately 20 days old. In some implementations, the “age” of the immunoreactive cells can be determined by telomere length. For example, “young” immunoreactive cells may have longer telomere lengths than “depleted” or “old” immunoreactive cells. Without being bound by any particular theory, it can be assumed that immune-reactive cells lose an estimated telomere length of approximately 0.8 kb per week in culture, and that young immune-reactive cell cultures can have telomeres approximately 1.4 kb longer than those of approximately 44-day-old immune-reactive cells. Without being bound by any particular theory, it is believed that longer telomere lengths may be associated with positive objective clinical responses in patients and cell persistence in vivo.

[0257] Before, after, and / or during transplantation, the cells (e.g., engineered cells or engineered primary T cells) can be functional. For example, the transplanted cells can function for at least approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 6, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or 100 days post-transplantation. The transplanted cells can function for at least approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months post-transplantation. The transplanted cells can function for at least approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, or 30 years post-transplantation. In some embodiments, the transplanted cells can function for the recipient's entire lifespan.

[0258] Furthermore, transplanted cells can function at 100% of their normal expected function. Transplanted cells can also perform their normal expected function approximately 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50. 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or up to approximately 100% functionality.

[0259] Transplanted cells can also perform more than 100% of their normal expected function. For example, transplanted cells can perform approximately 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1000, or up to approximately 5000% of their normal expected function.

[0260] Transplantation can be performed using any type of graft. Local locations may include, but are not limited to, the subhepatic bursal space, the subsplenic bursal space, the subrenal bursal space, the omentum, the submucosa of the stomach or intestine, segments of small intestinal vessels, venous sacs, the testis, the brain, the spleen, or the cornea. For example, a subcystic graft can be performed. Intramuscular grafts can also be performed. Portal vein grafts can also be performed.

[0261] Immunoreceptive cell therapy of the present invention can improve transplant rejection compared to when one or more wild-type cells are transplanted into a recipient. For example, transplant rejection can be hyperacute rejection. Transplant rejection can also be acute rejection. Other types of rejection may include chronic rejection. Transplant rejection can also be cell-mediated or T-cell-mediated. Transplant rejection can also be natural killer cell-mediated rejection.

[0262] Improving transplantation may mean mitigating hyperacute rejection, which can include reducing, alleviating, or lowering adverse effects or symptoms. Transplantation can refer to adoptive transplantation of cell products.

[0263] Another indication of successful transplantation can be the number of days the recipient does not require immunosuppressive therapy. For example, after providing the immune-responsive cells of the present invention, the recipient may not require immunosuppressive therapy for at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more days. This can indicate a successful transplant. It can also indicate that the transplanted cells, tissues and / or organs have not been rejected.

[0264] In some cases, the recipient may not require immunosuppressive therapy for at least 1 day. The recipient may also not require immunosuppressive therapy for at least 7 days. The recipient may not require immunosuppressive therapy for at least 14 days. The recipient may not require immunosuppressive therapy for at least 21 days. The recipient may not require immunosuppressive therapy for at least 28 days. The recipient may not require immunosuppressive therapy for at least 60 days. Furthermore, the recipient may not require immunosuppressive therapy for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more years.

[0265] Another indication of a successful transplant may be the reduced number of days of immunosuppressive therapy required by the recipient. For example, following the treatments described herein, the recipient may require at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days of reduced immunosuppressive therapy. This can indicate a successful transplant. It can also indicate that the transplanted cells, tissues, and / or organs have little or no rejection.

[0266] For example, a recipient may require at least 1 day of reduced immunosuppressive therapy. A recipient may also require at least 7 days of reduced immunosuppressive therapy. A recipient may require at least 14 days of reduced immunosuppressive therapy. A recipient requires at least 21 days of reduced immunosuppressive therapy. A recipient requires at least 28 days of reduced immunosuppressive therapy. A recipient requires at least 60 days of reduced immunosuppressive therapy. Furthermore, a recipient may require at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more years of reduced immunosuppressive therapy.

[0267] Reduced immunosuppressive therapy can refer to less immunosuppressive therapy compared to the immunosuppressive therapy required when one or more wild-type cells are transplanted into a recipient.

[0268] Immunosuppressive therapy can include any treatment that suppresses the immune system. It can help alleviate, reduce, or eliminate transplant rejection in patients. For example, immunosuppressants can be used before, during, and / or after transplantation, including immunosuppressants such as MMF (mycophenolate mofetil (Cellcept)), ATG (anti-thymocyte globulin), anti-CD154 (CD4OL), anti-CD40 (2C10), anti-IL-6R antibodies (tocilizumab, Actemra), anti-IL-6 antibodies (sarilumab, olokizumab), CTLA4-Ig (Abatacept / Orencia), anti-IL-6 antibodies (ASKP1240, CCFZ533X2201), and amphetamines (Campath). Anti-CD20 (rituximab), bevacizumab (LEA29Y), sirolimus (Rapimune), everolimus, tacrolimus (Prograf), datizumab (Ze-napax), baliximab (Similect), infliximab (Remicade), cyclosporine, deoxyprotein, soluble complement receptor 1, cobra venom, anti-C5 antibody (eculizumab / Soliris), methylprednisolone, FTY720, everolimus, leflunomide, anti-IL-2R-Ab, rapamycin, anti-CXCR3 antibody, anti-ICOS antibody, anti-OX40 antibody, and anti-CD122 antibody. In addition, one or more immunosuppressants / drugs may be used together or sequentially. One or more immunosuppressants / drugs may be used for induction or maintenance therapy. The same or different drugs may be used during the induction and maintenance phases. In some cases, daclizumab (Zenapax) can be used for induction therapy, while tacrolimus (Prograf) and sirolimus (Rapimune) can be used for maintenance therapy. Immunosuppression can also be achieved using non-pharmacological regimens, including but not limited to whole-body irradiation, thymic irradiation, and total and / or partial splenectomy. These techniques can also be used in combination with one or more immunosuppressive agents.

[0269] Example

[0270] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the manufacturer's recommendations.

[0271] In the following embodiments of the present invention, when constructing the antigen-binding receptor or CAR, the CD28 co-stimulatory signaling domain is abbreviated as 28; CD3ζ is abbreviated as Z; and 4-1BB or CD137 is abbreviated as BB. For example, a chimeric antigen receptor constructed by using scFv with code 85-2 as the intracellular signaling domain along with CD3ζ and CD28 can be denoted as 85-2-28Z. This principle applies to the construction of CARs for different antigens.

[0272] 1. Experimental Materials

[0273] The liver cancer cell lines SK-HEP-1 and PLC / PRF / 5 were purchased from the ATCC cell bank, and Huh-7 was purchased from the RIKEN cell bank in Japan.

[0274] PBMC comes from the Shanghai Blood Center.

[0275] AIM V medium: CTS, Cat#1665773.

[0276] Human T-Activator CD3 / CD28: Life technologies, Cat#11161D.

[0277] Fetal bovine serum (FCS): Gibco, Cat#10099-141.

[0278] IL-2: Shanghai Huaxin, Recombinant Human Interleukin-2 for Injection.

[0279] Goat anti-human F(ab')2 antibody: Jackson ImmunoResearch, Cat#109-066-006.

[0280] PE-Streptavidin: BD pharmingen, Cat#554061.

[0281] CytoTox Non-radioactive cytotoxicity assay: Promega, Cat#G1780.

[0282] 2. Experimental Methods

[0283] 2.1 Construction of Lentiviral Vector

[0284] 2.1.1 Construction of pRRL-EF1α-92-CAR lentiviral vector

[0285] As an example, the vector system used to construct the lentiviral plasmid vector of the present invention belongs to the third-generation self-inactivated lentiviral vector system. The system has four plasmids: the packaging plasmid pMDLg RRE (purchased from addgene) encoding the Gag / Pol protein, the packaging plasmid pRSV-REV (purchased from addgene) encoding the Rev protein, the envelope plasmid pCMV-VSV-G (purchased from addgene) encoding the VSV-G protein, and the recombinant expression vector encoding the target gene CAR based on the empty vector pRRLSIN-cPPT.PGK-GFP.WPRE (purchased from addgene). This system can effectively reduce the risk of forming reproducible lentiviral particles.

[0286] In this system, the inventors first modified the empty vector pRRLSIN-cPPT.PGK-GFP.WPRE using conventional molecular cloning techniques. The original vector's promoter was replaced with an elongation factor-1α (EF-1α) promoter, and a MluI restriction site was added between the promoter and the CD8αsp signal peptide. Specifically, the vector pWPT-EGFP (purchased from Addgene) was digested with ClaI / SalI (from NEB), and a 1.1 kb DNA fragment was recovered. This fragment was ligated into the ClaI / SalI-digested vector pRRLSIN-cPPT.PGK-GFP.WPRE using T4 DNA ligase and transformed into the host bacterium TOP10. Positive clones were identified by colony PCR and confirmed by sequencing to obtain the recombinant plasmid pRRLSIN-cPPT.EF-1α-EGFP.WPRE.

[0287] Chinese Patent 201510481235.1 describes an antibody 92 that has been humanized and can specifically recognize human GPC3 protein. To construct the 92-CAR lentiviral plasmid, a plasmid containing the 92 heavy chain variable region (SEQ ID NO: 80 in patent 201510481235.1) fragment was used as a template. The heavy chain variable region fragment was amplified using the upstream primer 5'-ctccacgccgccaggccggaggtgcagctggtgcag-3' (SEQ ID NO: 1) and the downstream primer 5'-GCGGTGTCCTCGCTCCGCAGGCTGCTCAGCTCCATGTAGGCGGTG-3' (SEQ ID NO: 2). Using a plasmid containing the 92 light chain variable region (SEQ ID NO: 79 in patent 201510481235.1) fragment as a template, the upstream primer 5'-GCGGAGCGAGGACACCGCCGTGTACTACTGCGCCCGGTTCTACAGCTAC-3' (SEQ ID NO: 80) was used to amplify the heavy chain variable region fragment. The light chain variable region fragment was amplified using primer 5'-CGGCGCTGGCGTCGTGGTACGTTTGATCTCCAGCTTGGTG-3' (SEQ ID NO:3) and downstream primer 5'-CGGCGCTGGCGTCGTGGTACGTTTGATCTCCAGCTTGGTG-3' (SEQ ID NO:4). The above heavy chain and light chain variable region primers were then used for bridging PCR to further amplify a 92scFv fragment (SEQ ID NO:5) containing repeat sequences with the upstream CD8α signal peptide and the downstream hinge region, named fragment 1, with a size of 765 bp. PCR amplification conditions were: pre-denaturation: 94℃, 4 min; denaturation: 94℃, 40 s; annealing: 58℃, 40 s; extension: 68℃, 40 s; 25 cycles, followed by a final extension at 68℃ for 10 min. The PCR amplification bands were confirmed by agarose gel electrophoresis to be the expected fragment size.

[0288] Using the upstream primer 5'-gcaggggaaagaatagtagaca-3' (SEQ ID NO:6) and the downstream primer 5'-CGGCCTGGCGGCGTGGAG-3' (SEQ ID NO:7), and with the vector plasmid pRRLSIN-cPPT.EF-1α-EGFP.WPRE constructed in this embodiment as a template, an EF-1α promoter containing the CD8α signal peptide (SEQ ID NO:8) (containing an MluI restriction site) was amplified and named fragment 2, with a size of 442 bp. The PCR amplification conditions were: pre-denaturation: 94℃, 4 min; denaturation: 94℃, 30 s; annealing: 53℃, 30 s; extension: 68℃, 30 s; 25 cycles, followed by a final extension at 68℃, 10 min. The PCR amplification bands were confirmed by agarose gel electrophoresis to be the expected fragment size.

[0289] Using upstream primer 5'-accacgacgccagcgccg-3' (SEQ ID NO:9) and downstream primer 5'-aatccagaggttgattgtcgacctagcgagggggcagggcctgc-3' (SEQ ID NO:10), and with pWPT-eGFP-F2A-GPC3-BBZ, pWPT-eGFP-F2A-GPC3-28Z, and pWPT-eGFP-F2A-GPC3-28BBZ as templates (for details, refer to Chinese Patent CN 104140974 A), fragment 3 containing Hinge-BBZ (SEQ ID NO:11), fragment 4 containing Hinge-28Z (SEQ ID NO:12), and fragment 5 containing Hinge-28BBZ (SEQ ID NO:13) (all containing Sal I restriction sites) were amplified, with sizes of 694bp, 703bp, and 829bp, respectively. PCR amplification conditions were as follows: pre-denaturation: 94℃, 4 min; denaturation: 94℃, 30 s; annealing: 60℃, 30 s; extension: 68℃, 30 s; 25 cycles were performed, followed by a final extension at 68℃, 10 min. PCR amplification bands were confirmed to be the expected fragment size by agarose gel electrophoresis.

[0290] Equimolar amounts of approximately 50 ng of fragments 2, 1, and 3 were used for splicing PCR. The splicing conditions were as follows: pre-denaturation 94℃, 4 min; denaturation: 94℃, 40 s; annealing: 60℃, 40 s; extension: 68℃, 140 s, for 5 cycles, followed by a total extension at 68℃, 10 min. DNA polymerase and upstream primer 5'-gcaggggaaagaatagtagaca-3' (SEQ ID NO: 6) and downstream primer 5'-aatccagaggttgattgtcgacctagcgagggggcagggcctgc-3' (SEQ ID NO: 10) were added. PCR amplification was performed for 25 cycles, with the following amplification conditions: pre-denaturation: 94℃, 4 min; denaturation: 94℃, 40 s; annealing: 60℃, 40 s; extension: 68℃, 140 s; total extension at 68℃, 10 min. The amplified DNA fragment (SEQ ID NO:14) of 92-BBZ was theoretically 1865 bp in size. Agarose gel electrophoresis confirmed that the amplified product was consistent with the theoretical size.

[0291] Equimolar amounts of approximately 50 ng of fragments 2, 1, and 4 were subjected to splicing PCR under the same splicing reaction conditions as described above. The resulting DNA fragments (SEQ ID NO: 15) with a theoretical size of 1874 bp were amplified to a range of 92-28 Z. Agarose gel electrophoresis confirmed that the amplified products were consistent with the theoretical size.

[0292] Equimolar amounts of approximately 50 ng of fragments 2, 1, and 5 were subjected to splicing PCR under the same splicing reaction conditions as described above. This amplified DNA fragments (SEQ ID NO: 16) of 92-28 BBZ, with a theoretical size of 2000 bp. The amplified products were confirmed to be consistent with the theoretical size by agarose gel electrophoresis.

[0293] The vector plasmid pRRLSIN-cPPT.EF-1α-EGFP.WPRE and fragments 92-BBZ, 92-28Z, and 92-28BBZ were digested with restriction endonucleases Mlu I and SalI (purchased from NEB), respectively. Ligation was performed using T4 ligase (purchased from NEB), and the mixture was transformed into TOP10. Clones were selected for PCR identification of positive bacteria, and the sequences were confirmed to be correct by Invitrogen sequencing. Thus, pRRL-EF-1α-92-BBZ, pRRL-EF-1α-92-28Z, and pRRL-EF-1α-92-28BBZ were obtained.

[0294] 2.1.2 Construction of a 92-CAR lentiviral vector co-expressing 4-1BBL

[0295] In addition, to construct a plasmid co-expressing 92-28Z and 41BBL, using the pRRL-EF-1α-92-28Z plasmid constructed above as a template, fragment 6 was amplified by PCR using the upstream primer 5'-gcaggggaaagaatagtagaca-3' (SEQ ID NO:6) and the downstream primer 5'-TCAGAAGGTCAAAATTCAAAGTCTGTTTCACGCGAGGGGGCAGGGCCTGCA TGTGAA-3' (SEQ ID NO:17). To obtain the F2A-41BBL fragment, plasmid HG15693-G (purchased from Beijing Yiqiao Shenzhou Biotechnology Co., Ltd., the 562nd base of this 41BBL gene contains a mutation from G to A) was used as a template. Fragment 7 was amplified by PCR using upstream primer 5'-gagacgttgagtccaaccctgggcccatggaatacgcctctgacgc-3' (SEQ ID NO:18) and downstream primer 5'-TCGGAGGAGGCGGGTGGCAGGTCCACGGTC-3' (SEQ ID NO:19). Fragment 7 was then amplified by PCR using upstream primer 5'-ctgccacccgcctcctccgaggctcggaa-3' (SEQ ID NO:20) and downstream primer 5'-TGATTGTCGACTTATTCCGACCTCGGTGAAGGGA-3' (SEQ ID NO:20). Fragment 8 was amplified by PCR using NO:21. Fragments 7 and 8 were then spliced ​​in equal molar amounts and amplified by PCR using primer pair (SEQ ID NO:18 and SEQ ID NO:21) to obtain fragment 9. Finally, fragments 6 and 9 were spliced ​​in equal molar amounts and amplified using primer pair (SEQ ID NO:6 and SEQ ID NO:21) to obtain 92-28Z-F2A-41BBL (SEQ ID NO:22). This fragment was digested with Mlu I and SalI, and then inserted into the similarly digested vector pRRLSIN-cPPT.EF-1α-EGFP.WPRE using the same method described above. Sequencing confirmed its correct insertion, yielding the plasmid pRRL-EF-1α-92-28Z-F2A-41BBL.

[0296] 2.1.3 Construction of a 92-CAR lentiviral vector with regulated co-expression of IFN

[0297] To construct a plasmid that can co-express 92-28Z and IFN beta (and achieve controllable expression by inserting an NFAT element before IFN beta), fragment 10 was first synthesized using primers (SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35) via primer bridging. Then, using the pWPT-EGFP plasmid as a template, fragment 11 was amplified using the upstream primer (SEQ ID NO:36) and the downstream primer (SEQ ID NO:37). The fragments were mixed in equal molar amounts of 10 and 11, and amplified by bridged PCR using primer pairs (SEQ ID NO:35 and SEQ ID NO:38). The fragments were then digested with ClaI and SalI and inserted into the same digested vector pRRLSIN-cPPT-PGK-EGFP.WPRE using the same method described above. Sequencing confirmed the correctness of the insertion, resulting in the vector pRRLSIN-NFAT3-EGFP-PA2 containing three NFAT repeat sequences. Using pRRLSIN-NFAT3-EGFP-PA2 as a template, fragments 12 and 13 were amplified using primer pairs (SEQ ID NO:39 and SEQ ID NO:40) and (SEQ ID NO:41 and SEQ ID NO:42), respectively. Fragment 14 was then amplified by bridging PCR using primer pairs (SEQ ID NO:39 and SEQ ID NO:42). This fragment was subsequently digested with Mlu I and SalI and ligated into the similarly digested pRRLSIN-NFAT3-EGFP-PA2. Sequencing confirmed the formation of the vector pRRLSIN-NFAT6-EGFP-PA2, containing six NFAT repeat sequences. Fragment 15 was amplified using the vector pGMT-IFN-β (purchased from Beijing Sinocare Biotechnology Co., Ltd.) as a template using primer pairs (SEQ ID NO:43 and SEQ ID NO:44). Using this fragment as a template, PCR amplification was performed using primer pairs (SEQ ID NO:43 and SEQ ID NO:38). The amplified product was digested with Mlu I and Cla I and ligated into the similarly digested vector pRRLSIN-NFAT6-EGFP-PA2. Sequencing confirmed its correctness, and the pRRLSIN-NFAT6-huIFNβ-PA2 plasmid was obtained.Using the constructed pRRLSIN-NFAT6-huIFNβ-PA2 plasmid as a template, an EGFP fragment 16 with an NdeI restriction site was amplified using primer pairs (SEQ ID NO:45 and SEQ ID NO:46). Using the constructed pRRLSIN-NFAT6-EGFP-PA2 plasmid as a template, an NFAT6 fragment 17 with an NdeI restriction site was amplified using primer pairs (SEQ ID NO:47 and SEQ ID NO:48) (6 units of the fragment need to be amplified while removing the SalI restriction site). Fragments 16 and 17 were mixed in equal molar amounts and amplified using primer pairs (SEQ ID NO:45 and SEQ ID NO:48). This fragment was then double-digested with EcoRI and KpnI and ligated into the similarly digested vector pRRLSIN-cPPT.EF-1α-EGFP.WPRE. Sequencing confirmed its correctness, yielding the plasmid pRRLSIN-EF1α-EGFP-NFAT6-huIFNβ-PA2. Finally, plasmid pRRL-EF-1α-92-28Z was double-digested with MluI and SalI to obtain the 92-28Z fragment. This fragment was ligated into the similarly double-digested vector pRRLSIN-EF1α-EGFP-NFAT6-huIFNβ-PA2, resulting in the correctly sequenced plasmid pRRLSIN-EF1α-92-28Z-NFAT6-huIFNβ-PA2.

[0298] The five plasmids pRRL-EF-1α-92-BBZ, pRRL-EF-1α-92-28Z, pRRL-EF-1α-92-28BBZ, pRRL-EF-1α-92-28Z-F2A-41BBL, and pRRL-EF-1α-92-28Z-NFAT6-huIFNβ-PA2 are collectively referred to as pRRL-EF-1α-92-CAR (Figure 1). The amino acid sequences corresponding to 92-BBZ, 92-28Z, 92-28BBZ, and 92-28Z-F2A-41BBL are SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, and SEQ ID NO:52, respectively. The amino acid sequence expressed by 92-28Z-NFAT6-IFN-β contains two segments: a CAR constructed as 92-28Z as shown in SEQ ID NO:50, and an IFN as shown in SEQ ID NO:53. Its vector construction is as follows... Figure 1B As shown.

[0299] 2.2 Virus Preparation

[0300] 1) with 4.5×10 6293T cells were seeded at a density of 10 cm in a culture dish and cultured overnight at 37°C with 5% CO2 to prepare for virus packaging. The culture medium was DMEM containing 10% fetal bovine serum.

[0301] 2) Dissolve the lentiviral shuttle vector pRRL-92-28Z-NFAT6-IFN-β 5.2 μg and the packaging plasmids pRsv-REV 6.2 μg, pRRE-PMDLg 6.2 μg, and VSVg 2.4 μg in 800 μL of serum-free DMEM culture medium and mix well;

[0302] 3) Dissolve 60 μg PEI (1 μg / μl) in 800 μl of serum-free DMEM culture medium, mix gently (or vortex at 1000 rpm for 5 seconds), and incubate at room temperature for 5 min;

[0303] 4) Formation of transfection complex: Add plasmid mixture to PEI mixture, vortex mix or gently mix immediately after addition, and incubate at room temperature for 20 min;

[0304] 5) Add 1.6 ml of the transfection complex to a 10 cm culture dish containing 11 ml of DMEM medium. After 4-5 hours, replace with fresh medium.

[0305] 6) After 72 hours, collect the viral supernatant.

[0306] 2.3 Virus Concentration

[0307] 1) Preparation of 5X PEG8000 NaCl: Weigh 8.766g of NaCl and 50g of PEG8000 and dissolve them in 200ml of Milli-Q pure water. Sterilize by moist heat at 121℃ for 30min and then store at 4℃ after cooling to room temperature.

[0308] 2) Filter the collected virus supernatant using a 0.45μm filter, add 7.5ml of 1 / 4 of the 5X PEG-8000NaCl stock solution, and mix by inverting the filter.

[0309] 3) Mix once every 20-30 minutes, for a total of 3-5 times;

[0310] 4) Place at 4℃ overnight;

[0311] 5) Centrifuge at 4℃, 4000g for 60 minutes;

[0312] 6) After removing the supernatant, add an appropriate amount of AIM V medium (containing 2% AB serum) to dissolve and resuspend the virus precipitate;

[0313] 7) The concentrated lentivirus suspension is aliquoted into 50 μl portions and stored in finished product tubes at -80°C. Monotropic retroviruses are unstable and should be used as soon as possible after packaging. Freezing at -80°C is not recommended.

[0314] 2.4 Lentiviral titer determination

[0315] With 1×10 5 293T cells were seeded into 12-well culture plates;

[0316] The concentrated lentivirus was added to the cell suspension at concentrations of 1 μL, 0.2 μL, and 0.04 μL, respectively, and polybrene was added to a final concentration of 6 μg / mL.

[0317] After incubating overnight at 37°C with 5% CO2, replace with fresh culture medium.

[0318] 72 hours after infection, 293T cells were digested with trypsin, and after adding an equal volume of culture medium to terminate the process, the cells were pipetted and mixed evenly, and the cell suspension was transferred into a 1.5 mL centrifuge tube.

[0319] Centrifuge at 400g for 5 minutes, discard the supernatant, and wash once with PBS + 2% FBS solution;

[0320] 6) Take an appropriate amount of cells, add Biotin-labeled goat anti-human Fab antibody at a dilution ratio of 1:50, and incubate on ice for 30 min;

[0321] 7) After washing once with 1 mL PBS + 2% FBS solution, add PE-labeled streptavidin at a 1:50 dilution ratio and incubate on ice for 30 min;

[0322] 8) After washing twice with PBS + 2% FBS solution, resuspend the cells in an appropriate volume of PBS + 2% FCS solution and transfer them to flow cytometry tubes.

[0323] 9) After flow cytometry analysis, it is advisable to take cell samples with a positive rate of 5-20%, and calculate the titer (TU / mL) = cell number (10... 5 ) × Positive rate / Viral volume (mL).

[0324] 2.5 Preparation of Lentiviral Transduction of T Lymphocytes-CAR-T Lymphocytes

[0325] 1) T lymphocyte activation: Human PBMCs were obtained from the Shanghai Blood Center. The culture medium was AIM V + 2% AB serum + IL-2 (500 U / mL). The PBMC density was adjusted to 1×10⁻⁶. 6 / mL, add magnetic beads coated with anti-human CD3 and CD28 antibodies at a 1:1 ratio and activate for 48h;

[0326] 2) Retronectin coating of 48-well plates: Add 160 μl of retronectn solution (5 μg / mL) to each well and incubate overnight at 4°C;

[0327] 3) Discard the Retronectin solution in the 48-well plate and wash twice with 1 ml PBS;

[0328] 4) Seed cells in 48-well plates coated with retrolectin, with 3 × 10⁶ cells per well. 5 Add lentivirus at MOI=10 and replenish culture medium to 300μL;

[0329] 5) Centrifuge at 32℃ and 1800 rpm for 40 min, then transfer to a cell culture incubator and continue culturing for 24 h;

[0330] 6) Replace with fresh culture medium and adjust the cell density to 5 × 10⁶ cells / year. 5 / mL, passaged every 2-3 days.

[0331] 2.6T lymphocyte chimeric antigen receptor expression

[0332] 1) Seven days after infection, take 4×10 5 T cells were centrifuged at 400g for 5 minutes at 4°C, the supernatant was discarded, and the cells were washed once with PBS + 2% FCS.

[0333] 2) Resuspend the cells in 50 μL PBS + 2% FCS, add 1 μL of Biotin-labeled goat anti-human Fab antibody, and incubate on ice for 30 min;

[0334] 3) After washing twice with PBS + 2% FCS, resuspend the cells in 50 μL PBS + 2% FCS, add 1 μL PE-labeled Streptavidin, and incubate on ice for 30 min.

[0335] 4) After washing twice with PBS + 2% FCS, the cells were resuspended in 400 μL of PBS + 2% FCS, transferred to flow cytometry tubes, and the infection efficiency was detected by flow cytometry.

[0336] 2.7 In vitro toxicity test

[0337] target cells

[0338] The target cells for 92-CAR are SK-HEP-1 (GPC3-) and Huh-7 (GPC3+);

[0339] Adjust the target cell concentration to 1×10 6 / mL, take 100μL and inoculate it into a 96well plate;

[0340] Effector cells: CAR-T cells and control T cells were added to 96-well plates at effector-to-target ratios of 0.3:1, 1:1, and 3:1;

[0341] Each group has 5 duplicate holes, and the average value of the 5 duplicate holes is taken.

[0342] The experimental groups and control groups are as follows:

[0343] Each experimental group: each target cell + CTLs expressing different chimeric antigen receptors;

[0344] Control group 1: Target cells release maximum LDH;

[0345] Control group 2: Target cells spontaneously release LDH;

[0346] Control group 3: Effector cells spontaneously release LDH;

[0347] Detection method: After co-culturing effector cells and target cells for 18 hours, the CytoTox 96 non-radioactive cytotoxicity assay kit (Promega) was used. This method is a colorimetric detection method and can replace... 51 Cr release method. CytoTox The degree of cell lysis is reflected by detecting the level of lactate dehydrogenase (LDH). LDH is a stable cytoplasmic enzyme that is released during cell lysis, and its release mechanism is similar to... 51 The release mechanism of Cr in radioactive analysis is basically the same. The released LDH in the culture supernatant can be detected by a 30-minute coupled enzyme reaction, in which LDH converts a tetrazolium salt (INT) into red formazan. The amount of red product generated is directly proportional to the number of lysed cells. Refer to the CytoTox 96 Non-Radioactive Cytotoxicity Assay Kit instructions for details.

[0348] The formula for calculating cytotoxicity is:

[0349]

[0350] 3. Results

[0351] Example 1: Expression of 92-CAR on human T lymphocytes

[0352] Human T lymphocytes were stimulated with magnetic beads coated with anti-CD3 and CD28 antibodies for 48 hours and then infected with high-titer lentivirus at MOI=10 by centrifugation. The positivity rate of lentivirus-infected T lymphocytes was detected by flow cytometry on day 7 post-infection. T cells expressing 92-28Z (SEQ ID NO:15, encoding nucleotide sequence as shown in SEQ ID NO:57) (… Figure 2The infection efficiency of GPC3-CD28Z was 35.1%, and the infection efficiency of T cells expressing 92-28Z-NFAT6-IFN-β was [missing information]. Figure 2 The infection efficiency of GPC3-CD28Z-IFN was 19.2%, while that of the control vector MOCK was 49%. Figure 2 .

[0353] Example 2: In vitro antitumor activity of 92-CAR T cells

[0354] After detecting the infection positivity rate, 92-CAR T cells were used at effector-to-target ratios of 0.3:1, 1:1, and 3:1 to test the efficacy of T lymphocytes expressing 92-28Z-NFAT6-IFN-β, 92-28Z, and the empty vector MOCK against the hepatocellular carcinoma line SK-HEP-1 (GPC3). - ) and Huh-7 (GPC3) + ) and PLC / PRF / 5 (GPC3 + The in vitro killing effect of CAR-T cells was assessed by co-culturing for 18 hours and then detecting the LDH content in the supernatant. The results showed that CAR-T cells expressing 92-28Z specifically killed GPC3-positive Huh-7 and PLC / PRF / 5 cells, but did not kill GPC3-negative SK-HEP-1 cells; the killing ability of CAR-T cells co-expressing huIFN-β was higher than that of 92-28Z CAR-T cells with the same effective target ratio (see Table 2).

[0355] Table 2. Detection of 92-CAR T cell cytotoxicity against target cells

[0356]

[0357] The inventors further compared 92-28Z-NFAT6-IFN-β with other CAR-T cells constructed using the same exoantigen-binding unit 92 (SEQ ID NO:5), including GPC3-BBZ, GPC3-28BBZ, and GPC3-41BBL (co-expressing 4-1BBL on the basis of CD28Z). First, FACS was used to detect the expression of various CARs (see...). Figure 3 The expression rates of various CARs are generally around 40%.

[0358] Then, the effects of these CAR-T cells and empty vector MOCK T lymphocytes on the liver cancer cell line SK-HEP-1 (GPC3) were measured at effector-to-target ratios of 0.3:1, 1:1, and 3:1, respectively. - ) and Huh-7 (GPC3) + ) and PLC / PRF / 5 (GPC3 +The in vitro killing effect of CAR-T cells was assessed by co-culturing for 18 hours and then detecting the LDH content in the supernatant. The results showed that cells expressing 92CAR-T cells specifically killed GPC3-positive Huh-7 and PLC / PRF / 5 cells, but not GPC3-negative SK-HEP-1 cells. At an effector-target ratio of 1:1, CAR-T cells co-expressing IFN-β showed higher killing ability against both GPC3-positive liver cancer cells than all other CAR-T cells (Table 3).

[0359] Table 3. Detection of cytotoxicity of various GPC3 CAR-T cells against target cells

[0360]

[0361] The above studies indicate that adding exogenously expressed IFN-beta to CD28-Z CAR T cells can enhance their anti-tumor activity. Furthermore, CAR-T cells expressing CD28Z, when co-expressed with IFN-beta, exhibit better tumor-killing ability in certain effector-to-target ratios compared to immune cells expressing CD28Z-41BBL.

[0362] Example 3: In vitro cytokine release assay using GPC3 CAR-T cells containing and without IFN.

[0363] Cytokines released from untransfected T cells, 92-28Z T cells, and 92-28Z-IFN T cells were measured. T cells of these three types in good growth condition were collected 1-2 weeks after lentiviral infection and seeded at 5 × 10⁶ cells / cells. 4 200 μL (number of positive cells) was added to a 24-well plate, and then 5 × 10⁶ cells were seeded using the same method. 4 / 200μL / 24-well huh7 cells were co-incubated with CAR T cells for 24 hours, and the supernatant was collected. The concentrations of IFN-β, IFN-γ, and IL-2 were measured. The results are as follows: Figures 4A-4C As shown.

[0364] according to Figure 4A Only when GPC3-28Z-IFN T cells were co-incubated with Huh7 cells did IFNβ expression occur, indicating that IFNβ could be successfully induced and secreted extracellularly in GPC3-28Z-IFN T cells after activation by the target antigen. According to... Figure 4B and 4C The results of in vitro cytokine detection showed that GPC3-28Z-IFN T cells could be activated more effectively in various GPC3-positive cells, such as Huh7, PLC, PRF, 5, and Hep-3B cells.

[0365] Example 4: In vitro cytokine release assay using CLD18A2 CAR-T cells containing and without IFN.

[0366] Construction of chimeric antigen receptor 85-28Z and 85-2-28Z plasmids:

[0367] Using PRRLSIN-cPPT.EF-1α as a vector, lentiviral plasmids expressing antibodies 85 and 85-2, respectively, were constructed. The 85-28Z sequence consists of the CD8α signal peptide, 85scFV, CD8 hinge, CD28 transmembrane region and intracellular signal transduction domain, and the intracellular segment CD3ξ of CD3. The 85-28Z sequence consists of the CD8α signal peptide, hu8E5-2IscFV, CD8 hinge region, CD28 transmembrane region and intracellular signal transduction domain, and the intracellular segment CD3ξ of CD3.

[0368] Construction of chimeric antigen receptor 85-28Z-IFN and 85-2-28Z-IFN plasmids:

[0369] Based on 85-28Z and 85-2-28Z, an 85-28Z-IFNb CAR expressing IFNb cytokines was constructed (encoding nucleotide sequence as shown in SEQ ID NO:58). Based on the 85-2-28Z CAR, an 85-2-28Z-IFNb CAR expressing IFNb cytokines was constructed (encoding nucleotide sequence as shown in SEQ ID NO:59).

[0370] To verify that the constructed 85-28Z T cells and 85-28Z-IFN T cells could also be effectively activated by target cell stimulation, we examined the secretion of 85-28Z T and 85-28Z-IFN T cytokines after co-incubation with target cells.

[0371] Cytokines released from CAR T cells transfected with empty vector (Mock), 85-28Z T cells, and 85-28Z-IFN T cells were detected separately. Three types of T cells in good growth condition were collected 1-2 weeks after lentiviral infection and seeded at 5×10⁴ / 200μL (number of positive cells) in 24-well plates. Target cells were seeded at a 1:1 effector-to-target ratio of 5×10⁴ / 200μL / 24-well plates. Target cells included 293T-A1, 293T-A2, AGS, AGS-A2, BGC-823, and BGC-823-A2 cells. The supernatant was collected after 24 hours of co-culture. IFN-γ cytokines released from the supernatant during co-culture of CAR T lymphocytes and target cells were detected using a sandwich ELISA method.

[0372] Experimental results are as follows Figure 5 As shown, the presence of IFN leads to increased secretion of IFN-γ cytokines when 85-28Z CAR T cells are co-incubated with target cells.

[0373] Example 5: Killing activity of GPC3 CAR-T (92-28Z) cells containing and without IFN

[0374] SK-HEP-1 is a GPC3-negative human hepatocellular carcinoma cell line, PLC / PRF / 5 is a GPC3-positive human hepatocellular carcinoma cell line, HepG2 is a GPC3-positive human hepatocellular carcinoma cell line, and Hep3B is a GPC3-positive human hepatocellular carcinoma cell line. All of these were purchased from the American Type Culture Collection (ATCC). Huh-7 (also known as Huh7) is a GPC3-positive human hepatocellular carcinoma cell line and was purchased from the RIKEN Cell Bank in Japan.

[0375] Detection method: The CytoTox 96 non-radioactive cytotoxicity assay kit (Promega) was used to detect the in vitro cytotoxic killing effect of CAR T lymphocytes on Huh 7, Hep 3B, PLC / PRF / 5, Hep G2 and SK-HEP-1 liver cancer cells (for specific methods, please refer to the CytoTox 96 non-radioactive cytotoxicity assay kit instructions).

[0376] Untransfected T cells, 92-28Z T cells, and 92-28Z-IFN T cells were co-cultured with tumor cells at effector-to-target ratios of 1:3, 1:1, and 3:1, respectively, for 18 hours. The experimental groups and control groups were set up as follows:

[0377] Experimental group setup: each target cell + T lymphocytes expressing different chimeric antigen receptors;

[0378] Control group 1: Spontaneous LDH release from effector cells;

[0379] Control group 2: Spontaneous LDH release from target cells;

[0380] Control group 3: Maximum LDH release from target cells

[0381] Control group 4: Volume-corrected control;

[0382] Control group 5: Culture medium background control.

[0383] Calculation of experimental results: Subtract the mean of the absorbance of the experimental groups, the spontaneous LDH release group of target cells, and the spontaneous LDH release group of effector cells from the mean of the absorbance of the culture medium background; subtract the mean of the absorbance of the volume-corrected control from the absorbance of the target cell maximum LDH release control; substitute the corrected values ​​obtained in the above steps into the formula below to calculate the cytotoxicity (%) produced by each effector-to-target ratio.

[0384] Calculation formula: %Cytotoxicity = (Experimental group - Effector cell spontaneous group - Target cell spontaneous group / Target cell maximum - Target cell spontaneous) * 100

[0385] The results are as follows Figures 6A-6E As shown above, the data indicate that CAR-GPC3 T cells expressing IFN can not only specifically kill GPC3-positive cells, but the killing activity of CAR-T cells expressing IFN (GPC3-28Z-IFN) can also be enhanced.

[0386] Example 6: Killing activity of CLD18A2 CAR-T cells containing and without IFN

[0387] 293T-A1 and 293T-A2 cells are human renal epithelial cell lines stably expressing CLD18A1 and CLD18A2, constructed in vitro. AGS and BGC-823 are human gastric cancer cell lines, and based on these, AGS-A2 and BGC-823-A2 cell lines stably expressing CLD18A2 were constructed.

[0388] Detection method: The CytoTox 96 non-radioactive cytotoxicity assay kit (Promega) was used to detect the in vitro cytotoxic effects of CAR T lymphocytes on 293T-A1, 293T-A2, AGS, AGS-A2, BGC-823, and BGC-823-A2 cells (for specific methods, please refer to the CytoTox 96 non-radioactive cytotoxicity assay kit instructions).

[0389] To compare the cytotoxic effects of 85-2-28Z and 85-2-28Z-IFN T cells on target cells, we

[0390] At effector-target ratios of 1:3, 1:1, and 3:1, empty vector T cells (Mock), 85-28Z T cells, and 85-28Z-IFN T cells were compared with CLD18A2-positive 293T-A2, AGS-A2, and BGS-823A2 cells for 18 hours, respectively. CLD18A2-negative 293T-A1, AGS, and BGC-823 cells served as controls.

[0391] Experimental group: Each target cell + CAR T cells expressing different chimeric antigen receptors;

[0392] ① Spontaneous LDH release from effector cells: Correcting the spontaneous release of LDH from effector cells;

[0393] ② Spontaneous LDH release from target cells: Correcting the spontaneous release of LDH from target cells;

[0394] ③ Maximum LDH release from target cells: This calculation requires the control to determine 100% LDH release;

[0395] ④ Volume Correction Control: Correct for volume changes caused by the addition of lysis buffer (10×);

[0396] ⑤ Culture medium background control: Corrects for background absorption caused by LDH activity produced by serum in the culture medium and phenol red.

[0397] Calculation formula: Cytotoxicity % = [(Experimental group – Effector cell control – Target cell control) / (Maximum lysation of target cells – Target cell control)] × 100. Before calculation, effector cell control, target cell control, experimental group minus culture medium control; maximum lysation of target cells minus volume control.

[0398] In vitro toxicity experiments were conducted using CAR T lymphocytes expressing Mock, 85-2-28Z, and 85-2-28Z-IFN, respectively, and co-cultured with tumor cells at effector-to-target ratios of 1:3, 1:1, and 3:1 for 18 hours. The cytotoxic activity of the two CAR cell lines against CLD18A2-positive target cells was as follows: Figure 7 As shown.

[0399] Example 7: In vivo survival time determination of GPC3 CAR-T cells

[0400] Following the experimental procedures in steps 1) to 3) of Example 3, CAR-T cells (GPC3-28ZT cells or GPC3-28Z-IFN T cells) were infused via the tail vein for 7 days. The survival of the CAR-T cells (GPC3-28Z T cells or GPC3-28Z-IFN T cells) in vivo was then assessed. The results are shown in Table 4. The number of T cells (CD3+) and CAR-T cells per μl of peripheral blood in the GPC3-28Z-IFN T cell group was significantly higher than that in the GPC3-28ZT cell group and the Mock group.

[0401] Table 4. Number of surviving T cells in peripheral blood

[0402] CD3+ (cups / μL) CAR-T cells / μL Mock 193.1453 0 GPC3-28Z 375.802 232.2 GPC3-28Z-IFN 1034.315 439.5

[0403] Example 8: In vivo survival time determination of CLD18A2 CAR-T cells

[0404] Establishment of a PDX model for gastric cancer:

[0405] Gastric cancer PDX tumors of approximately 2×2×2 mm in size were subcutaneously injected into the right axilla of NOD / SCID mice. The day of tumor cell inoculation was designated as D0.

[0406] Adoptive transfer of T cells:

[0407] With a tumor volume of 100 mm 3 At that time, cyclophosphamide was administered intraperitoneally at a dose of 100 mg / kg, followed by an intravenous infusion of 1.0 × 10⁻⁶ mg / kg via the tail vein 24 hours later. 7 CAR-T cells (85-2-28Z T cells or 85-2-28Z-IFN T cells) were used, with a Mock T cell group as a control.

[0408] Peripheral blood was collected from the saphenous vein of mice on days 5, 7, and 10 after CAR-T cell infusion to detect the survival of CAR-T cells (empty vector T cells (Mock), 85-2-28Z T cells, or 85-2-28Z-IFN T cells) in vivo.

[0409] The results are as follows Figures 8A-8C As shown, the number of surviving T cells in the 85-2-28Z-IFN T cell therapy group was significantly higher than that in the 85-2-28Z T cell therapy group.

[0410] Example 9: In vivo killing activity of GPC3 CAR-T (92-28Z) cells containing and without IFN

[0411] An experiment was conducted to determine the antitumor effects of untransfected T cells (Mock), GPC3-28Z T cells, and GPC3-28Z-IFN T cells on Huh7 subcutaneous xenografts.

[0412] 1) Experimental grouping: 21 NOD-SCID mice aged 6-8 weeks were randomly divided into 3 groups of 7 mice each: untransfected T cell group, GPC3-28Z T cell group and GPC3-28Z-IFN T cell group.

[0413] 2) Inoculation of subcutaneous xenografts: Huh7 cells in the logarithmic growth phase and in good growth condition were collected and their density was adjusted to 1×10⁻⁶ cells using physiological saline. 7 To establish a mouse model, NOD-SCID mice were inoculated with an injection volume of approximately 200 μL (2 × 10⁶ mL) to induce the mouse model. 6 / each), the day of tumor cell inoculation is recorded as day 0.

[0414] 3) Adoptive T cell transfer: in tumors with a volume of 200-300 mm 3At that time, cyclophosphamide was administered intraperitoneally at a dose of 200 mg / kg, followed by an intravenous infusion of 1.4 × 10 mg / kg via the tail vein 24 hours later. 7 CAR-T cells (GPC3-28Z T cells or GPC3-28Z-IFN T cells) were used, with an untransfected T cell group serving as a control. The growth of subcutaneous xenografts was observed and measured. Figure 9A (The tumor size in the control group mice reached 2000 mm). 3 At that time, the experimenter was about to be euthanized, and the tumor was separated and photographed. Figure 9B ).

[0415] The results are as follows Figure 9A and 9B As shown, GPC3-28Z-IFN T cells can significantly inhibit tumor cell growth. On day 13 after CAR-T cell infusion, the tumor inhibition rate of GPC3-28Z CAR-T cells was 66.5%, and that of GPC3-28Z-IFN CAR-T cells was 82.3%, indicating that GPC3-28Z-IFN T cells further enhanced the ability of CAR-T cells to inhibit tumor growth.

[0416] Example 10: In vivo killing activity of CLD18A2 CAR-T cells containing and without IFN

[0417] An experiment was conducted to determine the antitumor therapeutic effect of untransfected T cells (Mock), 85-28Z T cells, and 85-2-28Z-IFN T cells on BGC-823-A2 cell subcutaneous xenografts.

[0418] 1) Seeding of BGC-823-A2 subcutaneous xenografts: BGC-823-A2 cells in logarithmic growth phase and in good growth condition were collected and their density was adjusted to 2.5 × 10⁻⁶ cells using physiological saline. 7 / mL, inject cell suspension volume 200μL (5×10⁶) 6 (each mouse) was inoculated subcutaneously in the right axilla. The day of tumor cell inoculation was recorded as day 0.

[0419] 2) Experimental grouping: On day 11 after tumor inoculation, the volume of BGC-823-A2 xenografts was measured. NOD-SCID mice were randomly divided into 4 groups of 6 mice each. These were the untransfected T cell group, the 85-28Z T cell group, the 85-2-28Z cell group, and the 85-2-28Z-IFN T cell group.

[0420] 3) Adoptive T cell transfer: in tumors with a volume of 100-150 mm 3 On day 11, cyclophosphamide was administered intraperitoneally at a dose of 100 mg / kg, followed by a tail vein infusion of 1×10⁻⁶ mg / kg 24 hours later. 7CAR T cells (Mock cells, 85-28Z T cells, 85-2-28Z T cells, or 85-2-28Z-IFN cells) were used, with an untransfected T cell group (Mock group) as a control, to observe and measure the growth of subcutaneous xenografts.

[0421] Animal experiment results such as Figure 10A and Figure 10B As shown, the results indicate that 85-2-28Z-IFN CAR T cells are more effective than 85-2-28Z CAR T cells in treating BGC-823-A2 xenografts.

[0422] Example 11: Antitumor assay of CLD18A2 CAR-T cells containing and without IFN in subcutaneous xenografts of gastric cancer PDX model

[0423] To observe the antitumor therapy of untransfected T cells (UTD), 85-2-28Z T cells and 85-2-28Z-IFN T cells on subcutaneous xenografts of a gastric cancer PDX model.

[0424] 1) Establishment of a gastric cancer PDX model: Gastric cancer PDX tumors of approximately 2×2×2 mm in size were inoculated subcutaneously in the right axilla of 6-8 week old female NOD / SCID mice. The day of tumor cell inoculation was designated as D0.

[0425] 2) Experimental grouping: On day 15 after tumor inoculation, NOD-SCID mice were randomly divided into 3 groups of 7 mice each: untransfected T cell group, 85-2-28Z T cell group and 85-2-28Z-IFN T cell group.

[0426] 3) Adoptive T cell transfer: When the tumor volume was 30 mm3, 100 mg / kg of cyclophosphamide was injected intraperitoneally. 24 hours later, 1.0 × 10⁷ CAR-T cells (85-2-28Z T cells or 85-2-28Z-IFN T cells) were infused via the tail vein. An untransfected T cell group served as a control. The growth of subcutaneous PDX xenografts of gastric cancer was observed and measured.

[0427] The results are as follows Figure 11 As shown, in the 85-2-28Z-IFN treatment group, one of the seven mice had complete tumor regression.

[0428] Example 12: Effects of GPC3 CAR-T (92-28Z) cells containing and without IFN on tumor infiltration in vivo.

[0429] Referring to the animal model established in Example 9, after infusion of two types of CAR-T cells, GPC3-28Z and GPC3-28Z-IFN, for 14 days, tumor tissue was collected, and CD3+ cells were detected by histochemical analysis. The results are as follows: Figure 12A and 12B As shown: 4-7 fields of view were taken from each sample to count the number of CD3-positive T cells. The results showed that there were no obvious infiltrating CD3+ cells in the tumor tissue of the control group, while the number of CD3+ T cells in the INFβ-CAR-T treatment group was higher than that in the 28ZCART group.

[0430] Example 13: Effects of CLD18A2 CAR-T cells containing and without IFN on tumor infiltration in vivo.

[0431] Referring to the animal model established in Example 10, tumor tissue was collected 17 days after infusion of Mock, 85-28Z, 85-2-28Z and 85-2-28Z-IFN cells, and histochemical detection of CD3+ cells was performed.

[0432] The results are as follows Figure 13 As shown, almost no T cell infiltration was observed around the tumor tissue with Mock T cells, 85-28Z and 85-2-28Z CAR T cells could be seen at the edge of the tumor tissue, while 85-2-28Z-IFN T cells could be observed to infiltrate to some extent inside the tumor tissue.

[0433] Example 14: Construction of EGFR CARs with and without IFN

[0434] The structures of EGFR-CAR (806-28Z, SEQ ID NO:56) and EGFR-CAR-IFN (encoded by the nucleic acid shown in SEQ ID NO:60) are as follows: Figure 14 As shown in the image.

[0435] Retroviruses packaged using a retroviral packaging system were used to infect mouse T lymphocytes, specifically EGFR-CAR and EGFR-CAR-IFN, with positive infection rates of 65.1% and 35.2%, respectively. Figure 15 ).

[0436] Example 15: Determination of the ability of EGFR CAR (806-28Z) T cells containing and without IFN to secrete mIFNβ in vitro.

[0437] To investigate the function of EGFR-CAR-IFN in inducing mIFNβ secretion, CAR-T cells and target cells CT26-VIII were co-cultured at ratios of 1:1 and 3:1 for 24 h. The supernatant was collected, and mIFNβ expression was detected by ELISA. Simultaneously, CT26 cells without the target cell were used as a negative control, and concanavalin A (ConA) was used as a positive control. The results showed that mCAR-806-mIFNβ was successfully activated and induced to express mIFNβ after stimulation by the target cells, while no mIFNβ expression was detected in the control group. Figure 16 ).

[0438] Example 16: Cytokine release from EGFR CAR (806-28Z)-T cells containing and without IFN.

[0439] To verify that the constructed EGFRCAR and EGFR-CAR-IFN could also be effectively activated upon target cell stimulation, we examined the secretion of muCAR-T cytokines after co-incubation with target cells. Untransfected UT cells, EGFR-CAR, and EGFR-CAR-IFN were co-incubated with target-positive CT26-VIII cells at a 1:1 ratio for 24 hours. The culture supernatant was used to detect the secretion of cytokines mIL-2, mIFN-γ, and mTNF-α. Target-negative CT26 cells served as a control. The results showed that both EGFR-CAR and EGFR-CAR-IFN resulted in high concentrations of mIL-2, mIFN-γ, and mTNF-α secreted after co-incubation with target cells. Figure 17A , 17B The results (17C) indicate that both EGFR-CAR and EGFR-CAR-IFN muCAR-T cells can be effectively activated under the stimulation of target antigens.

[0440] Example 17: In vitro toxicity test of EGFR CAR (806-28Z)-T cells containing and without IFN.

[0441] To compare the in vitro killing activity of EGFR-CAR and EGFR-CAR-IFN against target cells, we co-incubated EGFR-CAR and EGFR-CAR-IFN with EGFR-positive CT26VIII cells for 18 hours at ratios of 1:3, 1:1, or 3:1, respectively. Untransfected mouse UT cells were used as isotype controls, and CT26 cells were used as EGFR-negative controls.

[0442] The results showed that EGFR-CAR and EGFR-CAR-IFN had a significantly stronger killing effect on target-positive CT26VIII cells compared with UT cells (***P<0.001), and the killing percentage was dose-dependent. Untransfected UT cells had no killing effect on CT26 and CT26VIII cells, while EGFR-CAR and EGFR-CAR-IFN CAR-T cells had no killing effect on target-negative CT26 cells. Figure 18 ).

[0443] Example 18: In vivo toxicity test of EGFR CAR (806-28Z)-T cells containing and without IFN.

[0444] Using a mouse colon cancer CT26 cell line stably transfected with the human EGFRvIII-806 locus, subcutaneous xenografts were inoculated into Babl / c mice, followed by EGFR-CAR T-cell therapy. Results were as follows... Figure 19 As shown, the tumor size of the EGFR-CAR-T cell group was basically the same as that of the control group, and no inhibitory effect was observed. However, after the EGFR-CAR-IFN cell group was reinfused, the tumor growth inhibition phenomenon began to appear on the 7th day, with a tumor inhibition rate of 5.9%. The inhibition rate reached its peak on the 10th day, at 18.5%, and the tumor inhibition rate could still reach 12.4% on the 17th day, which was significantly better than that of the EGFR-CAR-T cell group.

[0445] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

[0446] Table 5. Sequences used in this paper

[0447]

[0448]

[0449]

[0450]

[0451]

[0452]

[0453]

[0454]

[0455]

[0456]

[0457]

[0458]

[0459]

[0460]

[0461]

[0462]

[0463]

[0464]

[0465]

[0466]

[0467]

[0468]

Claims

1. An antibody that binds to CLD18A2, characterized in that, The antibody has the amino acid sequence shown in positions 1-247 of SEQ ID NO: 54 or 55.

2. A chimeric antigen receptor comprising the antibody of claim 1, characterized in that, The receptor comprises, in sequence, the antibody, transmembrane region, and intracellular signaling region as described in claim 1.

3. The chimeric antigen receptor as described in claim 2, characterized in that, The intracellular signaling region includes: T cell stimulation signaling molecules or a combination of T cell stimulation signaling molecules and T cell activation co-stimulatory molecules.

4. The chimeric antigen receptor as described in claim 3, characterized in that, The intracellular signaling region is selected from: TCRζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b and CD66d; or the T cell activation co-stimulatory molecule is selected from: the intracellular signaling regions of CD28, OX40, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), 4-1BBL, MyD88 and 4-1BB, or combinations thereof.

5. The chimeric antigen receptor as described in claim 2, characterized in that, The transmembrane region is selected from: the transmembrane region of CD8 or CD28 or a protein having at least 85, 90, 95, 96, 97, 98, 99 or 100% identity with the native transmembrane region of CD8 or CD28.

6. The chimeric antigen receptor as described in claim 2, characterized in that, The intracellular signaling region is selected from one or more of CD3ζ, CD28, and CD137.

7. The nucleic acid encoding the antibody of claim 1 or the chimeric antigen receptor of any one of claims 2-6.

8. A carrier, characterized in that, The vector comprises the nucleic acid as described in claim 7.

9. The carrier as described in claim 8, wherein the carrier is an expression carrier.

10. A virus comprising the nucleic acid of claim 7 or the vector of claim 8 or 9.

11. Engineered cells, characterized in that, The engineered cells comprise the antibody of claim 1, the chimeric antigen receptor of any one of claims 2-6, the nucleic acid of claim 7, and / or the vector of claim 8 or 9; or the cells are prepared using the virus transduction method of claim 10.

12. The engineered cell as described in claim 11, characterized in that, The engineered cells are immune response cells.

13. The engineered cell as described in claim 12, characterized in that, The engineered cells are T cells and natural killer cells.

14. The engineered cell as described in claim 13, characterized in that, The T cells are any one of cytotoxic T lymphocytes, natural killer T cells, DNT cells, and regulatory T cells.

15. The engineered cell as described in claim 11, characterized in that, The engineered cells also carry coding sequences for exogenous cytokines; or express another receptor that binds to antigens; or express chemokine receptors; or express siRNA that can reduce PD-1 expression or proteins that block PD-L1.

16. The engineered cell as claimed in claim 11, characterized in that, The engineered cells also constitutively or inducibly express exogenous interferon β.

17. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the antibody of claim 1, the chimeric antigen receptor of any one of claims 2-6, the nucleic acid of claim 7, the vector of claim 8 or 9, the virus of claim 10, and / or the engineered cell of any one of claims 11-16, and a pharmaceutically acceptable vector.

18. The use of the antibody of claim 1, the chimeric antigen receptor of any one of claims 2-6, the nucleic acid of claim 7, the vector of claim 8 or 9, the virus of claim 10, the engineered cell of any one of claims 11-16, and / or the pharmaceutical composition of claim 17 in the preparation of a medicament for treating a disease.

19. The use of the antibody of claim 1, the chimeric antigen receptor of any one of claims 2-6, the nucleic acid of claim 7, the vector of claim 8 or 9, the virus of claim 10, the engineered cell of any one of claims 11-16, and / or the pharmaceutical composition of claim 17 in the preparation of a medicament for treating a disease, said medicament being used to treat or prevent tumors, pathogen infections, enhance immune tolerance, autologous transplantation, or allogeneic transplantation.

20. The use of the antibody of claim 1, the chimeric antigen receptor of any one of claims 2-6, the nucleic acid of claim 7, the vector of claim 8 or 9, the virus of claim 10, the engineered cell of any one of claims 11-16, and / or the pharmaceutical composition of claim 17 in the preparation of a medicament for treating a disease, wherein the medicament is used to induce cancer cell death.

21. The use of the antibody of claim 1, the chimeric antigen receptor of any one of claims 2-6, the nucleic acid of claim 7, the vector of claim 8 or 9, the virus of claim 10, the engineered cell of any one of claims 11-16, and / or the pharmaceutical composition of claim 17 in the preparation of a medicament for treating a disease, wherein the medicament is used to induce the death of CLD18A2 positive cells.

22. The use of the antibody of claim 1, the chimeric antigen receptor of any one of claims 2-6, the nucleic acid of claim 7, the vector of claim 8 or 9, the virus of claim 10, the engineered cell of any one of claims 11-16, and / or the pharmaceutical composition of claim 17 in the preparation of a medicament for treating a disease, the medicament being used to treat or prevent tumors, said tumors being selected from: pancreatic cancer, liver cancer, lung cancer, gastric cancer, head and neck squamous cell carcinoma, prostate cancer, colon cancer, breast cancer, lymphoma, gallbladder cancer, kidney cancer, leukemia, myeloma, ovarian cancer, cervical cancer, or glioma.

23. The use of the antibody of claim 1, the chimeric antigen receptor of any one of claims 2-6, the nucleic acid of claim 7, the vector of claim 8 or 9, the virus of claim 10, the engineered cell of any one of claims 11-16, and / or the pharmaceutical composition of claim 17 in the preparation of a medicament for treating a disease, wherein the disease is liver cancer or gastric cancer.

24. The application as described in claim 23, wherein the drug is used to treat or prevent tumors, pathogen infections, enhance immune tolerance, autologous transplantation, or allogeneic transplantation.

25. The application as described in claim 23, wherein the drug is used to induce cancer cell death.

26. The application as described in claim 23, wherein the drug is used to induce CLD18A2 positive cell death.

Images