A strain of Bacillus subtilis from Taichung and its application

By using the Taichung Bacillus R12 strain for fermentation, the problems of long aging time and insufficient strain resources for Guangchenpi (dried tangerine peel) have been solved, achieving efficient production of stable and high-quality tangerine peel and increasing the content of flavonoids and aging efficiency.

CN118185793BActive Publication Date: 2026-01-30SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202410142588.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-31
Publication Date
2026-01-30
Estimated Expiration
2044-01-31

AI Technical Summary

Technical Problem

The existing aging process for Guangchenpi (dried tangerine peel) mainly relies on natural aging, which is time-consuming, difficult to control, prone to mold growth, and has limited microbial resources, making it difficult to achieve efficient production of stable and high-quality dried tangerine peel.

Method used

The fermentation process using Paenibacillus sp. R12 strain from Taichung City increased the content of flavonoids in Guangchenpi (aged tangerine peel) and shortened the aging time.

Benefits of technology

It accelerates the aging of dried tangerine peel, increases the content of flavonoids, shortens the aging time, enriches the microbial resources for the aging of dried tangerine peel, and improves the aging efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118185793B_ABST
    Figure CN118185793B_ABST
Patent Text Reader

Abstract

This invention discloses a strain of Paenibacillus sp. from Taichung and its applications. A strain of Paenibacillus sp. R12 was isolated and identified from dried tangerine peel (Chenpi). This strain was deposited at the Guangdong Provincial Microbial Culture Collection Center on November 23, 2023, with accession number GDMCC NO:64060. Using strain R12 in the aging and fermentation of dried tangerine peel increases the content of luteolin, apigenin, and demethylhesperidin, which is beneficial for the accumulation of key medicinal components. Its effect is superior to that of naturally aged tangerine peel for one year. Using this strain in the aging of dried tangerine peel enables the targeted production of stable, high-quality new types of tangerine peel with high flavonoid content. This not only accelerates the aging process and shortens the aging time but also enriches the microbial resources for aging tangerine peel, improves aging efficiency, and provides more methods for shortening the aging time of dried tangerine peel.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of microbial fermentation. More particularly, it relates to a strain of Paenibacillus taichungensis and its application. BACKGROUND

[0002] Pericarpium Citri Reticulatae is made from the dried mature pericarp of Citrus reticulata Blanco and its cultivated varieties, and is a traditional Chinese medicine with both medicinal and edible functions. The longer the aging time of Pericarpium Citri Reticulatae, the more significant the medicinal efficacy. Pericarpium Citri Reticulatae is divided into two types, namely, Pericarpium Citri Reticulatae and Pericarpium Citri Reticulatae Viride, depending on the source. Pericarpium Citri Reticulatae Viride is mainly derived from Citrus reticulata ‘Chachiensis’. During the aging process of Pericarpium Citri Reticulatae, the metabolic activity of microorganisms is high, which significantly increases the content of medicinal ingredients. The results of existing metabolomics analysis show that, in addition to the three flavonoids, hesperidin, nobiletin and tangeretin, which are specified in the pharmacopoeia, there are actually 219 flavonoids in Pericarpium Citri Reticulatae Viride. The flavonoids in Pericarpium Citri Reticulatae Viride can be divided into flavonoid glycosides, flavonoid aglycones and polymethoxylated flavones. Based on KEGG metabolic network pathway analysis, flavonoid glycosides can be obtained by hydrolyzing two glycoside molecules to obtain flavonoid aglycones such as apigenin and luteolin, and flavonoid aglycones can be catalyzed by methyltransferase to form polymethoxylated flavones such as demethylnobiletin. Demethylnobiletin is a polymethoxylated flavone (PMFs), which is one of the most important medicinal ingredients in Pericarpium Citri Reticulatae Viride. A large number of studies have shown that PMFs have a wide range of biological activities, and have very significant activities in antioxidant, anticancer, anti-obesity and anti-inflammatory; luteolin has antitussive and expectorant effects, and has anti-inflammatory, anti-allergic, antitumor, antibacterial, antiviral and other pharmacological activities, and is mainly used in clinical treatment of cough, sputum, cardiovascular disease, etc.; apigenin has neuroprotective, antitumor, antibacterial, anti-inflammatory and antioxidant activities, etc. These flavonoids with different biological activities together constitute the unique medicinal efficacy of Pericarpium Citri Reticulatae Viride.

[0003] Natural aging is the main method for the aging process of Pericarpium Citri Reticulatae Viride, which is stored in well-ventilated aging warehouse for three to five years. However, long aging time is not conducive to improving the yield of Pericarpium Citri Reticulatae, and the natural storage environment is complex and uncontrollable, which is difficult to realize standardization, and is also easy to cause Pericarpium Citri Reticulatae to rot or be worm-eaten. In order to alleviate the current situation of Pericarpium Citri Reticulatae supply and demand tension, standardize the quality of Pericarpium Citri Reticulatae and simplify the aging process, it is of great significance. Because different Pericarpium Citri Reticulatae of different aging years contain rich microbial groups, which are closely related to the accumulation of flavonoids in Pericarpium Citri Reticulatae. The existing research uses microbial fermentation to accelerate the accumulation of effective components of Pericarpium Citri Reticulatae. For example, the existing technology discloses that the fungus Mucor circinelloides can promote the aging of Pericarpium Citri Reticulatae and improve the content of effective substances in Pericarpium Citri Reticulatae. Because different types of microorganisms have different functional characteristics in regulating different types of flavonoids in Pericarpium Citri Reticulatae, this provides the possibility for the directional production of stable and high-quality Pericarpium Citri Reticulatae.

[0004] However, there are few microbial resources that can be applied to microbial fermentation to improve the content of flavonoids in Pericarpium Citri Reticulatae. Therefore, it is necessary to develop more microbial resources to accelerate the aging of Pericarpium Citri Reticulatae and the accumulation of effective components, and to directionally produce stable, high-quality and different functional characteristics of new Pericarpium Citri Reticulatae. SUMMARY

[0005] The technical problem to be solved by the present application is to overcome the shortcomings of the existing Pericarpium Citri Reticulatae fermentation strains, and to provide a Paenibacillus sp. R12 strain and its application.

[0006] The purpose of the present application is to provide a Paenibacillus sp. R12 strain and its application.

[0007] Another purpose of the present application is to provide a preparation for improving the content of flavonoids in Pericarpium Citri Reticulatae

[0008] Still another purpose of the present application is to provide a method for promoting the accumulation of flavonoids, an effective substance in Pericarpium Citri Reticulatae.

[0009] Still another purpose of the present application is to provide a method for shortening the aging time of Pericarpium Citri Reticulatae.

[0010] The above purposes of the present application are achieved by the following technical solutions:

[0011] The application isolates and identifies a Paenibacillus sp. R12 strain from Pericarpium Citri Reticulatae Viride, and the strain is preserved in the Guangdong Microbial Culture Collection Center on November 23, 2023, with a preservation number of GDMCC NO: 64060. The strain is used for Pericarpium Citri Reticulatae Viride fermentation to increase the content of luteolin, apigenin and norcantharidin in Pericarpium Citri Reticulatae Viride, and is beneficial to the accumulation of main effective components, and the effect is better than that of Pericarpium Citri Reticulatae Viride naturally aged for one year. Meanwhile, the application provides a method for shortening the aging time of Pericarpium Citri Reticulatae Viride, and the R12 strain is used for Pericarpium Citri Reticulatae Viride aging to produce a new type of Pericarpium Citri Reticulatae Viride with stable, high-quality and high flavonoid content, which can not only accelerate the aging of Pericarpium Citri Reticulatae Viride and shorten the aging time, but also enrich the strain resources of Pericarpium Citri Reticulatae Viride microbial aging and improve the aging efficiency, thereby providing more methods for shortening the aging time of Pericarpium Citri Reticulatae Viride.

[0012] The application provides application of the Paenibacillus sp. R12 strain or a bacterial liquid thereof in Pericarpium Citri Reticulatae Viride aging, in shortening the aging time of Pericarpium Citri Reticulatae Viride, or in preparing a Pericarpium Citri Reticulatae Viride product with accelerated aging, in promoting accumulation of flavonoid compounds as effective substances in Pericarpium Citri Reticulatae Viride, or in preparing a preparation for promoting accumulation of flavonoid compounds as effective substances in Pericarpium Citri Reticulatae Viride.

[0013] Preferably, the flavonoid compounds in the Pericarpium Citri Reticulatae Viride are one or more of luteolin, apigenin and norcantharidin.

[0014] Preferably, the Pericarpium Citri Reticulatae Viride is Pericarpium Citri Reticulatae Viride.

[0015] The application provides a preparation for increasing the content of flavonoid compounds in Pericarpium Citri Reticulatae Viride, which contains the Paenibacillus sp. R12 strain or a bacterial liquid thereof.

[0016] The application provides a method for promoting accumulation of flavonoid compounds as effective substances in Pericarpium Citri Reticulatae Viride, which adopts the Paenibacillus sp. R12 strain or a bacterial liquid thereof to treat Pericarpium Citri Reticulatae Viride raw materials.

[0017] The application also provides a method for shortening the aging time of Pericarpium Citri Reticulatae Viride, which adopts the Paenibacillus sp. R12 strain or a bacterial liquid thereof to ferment Pericarpium Citri Reticulatae Viride.

[0018] Preferably, the Paenibacillus sp. R12 strain or the bacterial liquid thereof is inoculated into Pericarpium Citri Reticulatae Viride for fermentation treatment at a weight ratio of 2-4%. In particular, the Paenibacillus sp. R12 strain is activated, subcultured to the second generation, and then inoculated after expansion culture. The second generation strain has higher biological activity, can well maintain the original functions of the strain, has a lower mutation rate, and the like.

[0019] More preferably, the fermentation treatment is performed under the following conditions: a fermentation temperature of 25-28 DEG C, a humidity of 70%-80%, and a fermentation time of no less than 90 days.

[0020] Further preferably, the pericarpium citri reticulatae is prepared from new pericarpium citri reticulatae.

[0021] As a specific embodiment, the present application provides a specific method for shortening the aging time of pericarpium citri reticulatae:

[0022] (1) Selection of raw materials: select pericarpium citri reticulatae with good color and no obvious pests and diseases, wash and peel the pericarpium citri reticulatae, and then naturally dry it to a moisture content of less than 13% to obtain new pericarpium citri reticulatae, which is stored at room temperature and humidity of 45% for standby;

[0023] (2) Pretreatment of raw materials: dry the naturally dried new pericarpium citri reticulatae at 60°C for 30 minutes, then crush it into fine powder (adjustable for preparation of different aging products, or not crushed), pass through a 60-mesh sieve, and mix evenly;

[0024] (3) Activation of strains: recover the strains preserved at -80°C using NB culture medium, confirm the purity and activity of the strains, and then subculture them to the 2nd generation;

[0025] (4) Preparation of strains: inoculate the activated strains into NB culture medium, expand culture at 30°C for 2-3 days, remove the culture solution by centrifugation, wash the precipitate with sterile deionized water for 2-3 times, remove the liquid, and obtain fresh strains;

[0026] (5) Inoculation and fermentation: inoculate the strains into the new pericarpium citri reticulatae powder at a weight ratio of 2-4%, mix evenly, then place them in a sterile container for fermentation, the fermentation temperature is 25-28°C, the humidity is 70%-80%, and the fermentation time is not less than 90 days (adjust the fermentation time to prepare pericarpium citri reticulatae of different years);

[0027] (6) Post-fermentation treatment: dry the pericarpium citri reticulatae powder at 35°C for 24 hours after fermentation to obtain the finished product.

[0028] The present application has the following beneficial effects:

[0029] The present application provides a Paenibacillus sp. R12 strain isolated and identified from pericarpium citri reticulatae, which has been preserved in the Guangdong Microbial Culture Collection Center on November 23, 2023, with the preservation number GDMCC NO: 64060. The use of the strain for pericarpium citri reticulatae aging fermentation can increase the content of luteolin, apigenin and norartocarpetin in pericarpium citri reticulatae, which is beneficial to the accumulation of main effective components, and the effect is better than that of pericarpium citri reticulatae naturally aged for one year; at the same time, the present application provides a method for shortening the aging time of pericarpium citri reticulatae, and the use of the R12 strain for pericarpium citri reticulatae aging can produce new pericarpium citri reticulatae with stable, high-quality and high flavonoid content in a targeted manner, which not only accelerates the aging of pericarpium citri reticulatae and shortens the aging time, but also enriches the strain resources for pericarpium citri reticulatae microbial aging and improves the aging efficiency, providing more methods for shortening the aging time of pericarpium citri reticulatae.BRIEF DESCRIPTION OF DRAWINGS BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 Figure 1 is a colony morphology chart of the Paenibacillus taichungensis R12 strain.

[0031] Figure 2 Figure 2 is a phylogenetic tree of the Paenibacillus taichungensis R12 strain. DETAILED DESCRIPTION

[0032] The present application is further illustrated by the following description in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present application in any form. Unless otherwise specified, the reagents, methods and equipment used in the present application are conventional reagents, methods and equipment in the technical field.

[0033] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0034] The raw tea branches used in the following examples are all products from the same batch picked from the same orchard in Xinhui District, Jiangmen City, Guangdong Province.

[0035] Example 1 Screening and identification of the strain

[0036] 1. Isolation and purification of the strain: The sample was derived from commercially available aged Pericarpium Citri Reticulatae for three years. The Pericarpium Citri Reticulatae sample was crushed, and the powder was mixed with sterile water at a mass ratio of 1:9 to prepare a sample suspension. Then the sample suspension was gradient diluted, and 200 μL of the diluted sample suspension was spread on a nutrient agar plate (NB solid medium: proteose peptone 10.0 g, beef powder 3.0 g, sodium chloride 5.0 g, agar 15.0 g, deionized water 1 L; final pH value 7.3±0.1 (25℃); 121℃ high pressure sterilization for 15 minutes), and cultured at 30℃ for 3 days. After culture, the morphologically different strains were picked and purified on the NB solid medium plate using an inoculation loop, and cultured in a 30℃ incubator for 24-48 hours. Single colonies were picked and streaked on the NB solid medium plate again, and cultured. The process was repeated until no other bacteria were present on the plate, and the purification was completed. After purification and culture, the isolated strain was named R12 strain and preserved in a glycerol tube.

[0037] 2. Morphological characteristics identification of the strain: The R12 strain isolated above was cultured on the NB solid medium, and the colony color and morphological characteristics were observed and recorded, as shown in Table 1. Figure 1 As shown in Table 1, the strain was light yellow, round, small in diameter, and opaque.

[0038] 3. 16S rRNA molecular biology identification: After the purified strain was activated on NB solid medium for 24 h, 1 mL of bacterial solution was prepared to prepare a DNA template for PCR detection. Primers 27F: AGAGTTTGATCCTGGCTCAG and primer 1492R: GGTTACCTTGTTACGACTT were used for PCR amplification, and the amplification product was analyzed by Sanger sequencing and submitted to the NCBI database for BLAST homology analysis.

[0039] The full-length 16S rDNA sequence SEQ ID NO. 1 of the test strain obtained by PCR is about 1500 bp, and BLAST comparison analysis is performed in the database. The sequence alignment result phylogenetic tree is shown in Figure 2 R12 strain has a very high homology with Paenibacillus taichungensis. In combination with morphological characteristic identification, the R12 strain is identified as Paenibacillus taichungensis, belongs to the Paenibacillus sp. genus, named as R12 strain, and preserved in the Guangdong Microbial Culture Collection Center on November 23, 2023, with a preservation number of GDMCC No: 64060 and a preservation address of 100, Martyrs' Road, Guangzhou.

[0040] Example 2 Fermentation of Pericarpium Citri Reticulatae by Paenibacillus taichungensis R12 Strain

[0041] 1. Material selection: Take tea orange with good color and no obvious pests and diseases, wash and peel the tea orange, and naturally dry to a moisture content of less than 13% to obtain tea orange peel, which is stored at room temperature and humidity of 45% for standby;

[0042] 2. Raw material pretreatment: Dry the tea orange peel at 60°C for 30 minutes, then crush it into fine powder (adjust the preparation of different aging products, do not crush), pass through a 60-mesh sieve, and mix evenly for standby;

[0043] 3. Strain activation: Take 18 g of nutrient broth (NB) medium, add 1 L of distilled water or deionized water, stir and heat to boiling until completely dissolved, distribute into triangular bottles, sterilize at 121°C for 15 min, cool to room temperature, and standby. The Paenibacillus taichungensis R12 strain preserved at -80°C is inoculated into the above medium for recovery culture, and after confirming the purity and activity of the strain, it is further subcultured to 2 generations;

[0044] 4. Strain preparation: inoculate the activated Paenibacillus taichungensis R12 strain into NB medium, expand culture at 30°C for 2-3 days, remove the culture solution by centrifugation, wash the precipitate with sterile deionized water for 2-3 times, and finally remove the liquid and retain the precipitate to obtain fresh collected fresh strain;

[0045] 5. Inoculation and fermentation: mix the fresh strain with the Shatian orange new peel powder at a weight ratio of 2-4% and then place in a sterile container for fermentation, the fermentation temperature is 25-28°C, the humidity is 70%-80%, the fermentation time is 90 days (different aged pericarps can be prepared by adjusting the fermentation time), and the fermentation process is regularly stirred and ventilated;

[0046] 6. Post-fermentation treatment: dry the Shatian orange peel powder at 35°C for 24 hours after the fermentation to obtain the finished product.

[0047] Comparative Example 1: natural aging treatment

[0048] 1. Material selection: take Shatian oranges with good color and no obvious pests and diseases, wash and peel the Shatian oranges, and then naturally dry the Shatian oranges until the water content is less than 13% to obtain Shatian orange new peel, which is stored at room temperature and humidity of 45% for standby;

[0049] 2. Raw material pretreatment: dry the naturally dried Shatian orange new peel at 60°C for 30 minutes, then crush into fine powder, pass through a 60-mesh sieve, and mix uniformly for standby;

[0050] 3. Inoculation and fermentation: inoculate the same amount of Shatian orange new peel powder without inoculating the strain, place in a sterile container for fermentation, the fermentation temperature is 25-28°C, the humidity is 70%-80%, the fermentation time is 90 days, and the fermentation process is regularly stirred and ventilated;

[0051] 4. Post-fermentation treatment: dry the Shatian orange peel powder at 35°C for 24 hours after the fermentation to obtain the finished product.

[0052] Comparative Example 2: natural aging treatment

[0053] The method is the same as that in Comparative Example 1, and the only difference is that the same variety of broad pericarp as in Example 1 is used and has been naturally aged for 1 year for fermentation.

[0054] Comparative Example 3: natural aging treatment

[0055] The method is the same as that in Comparative Example 1, and the only difference is that the same variety of broad pericarp as in Example 1 is used and has been naturally aged for 3 years for fermentation.

[0056] Test Example 1: determination of flavonoid content in aged pericarp by ultra-high performance liquid chromatography

[0057] The flavonoids luteolin, apigenin and norwuchukuerin in the dried pericarps of Example 1 and Comparative Examples 1-3 after fermentation and aging were determined by ultra-high performance liquid chromatography (UPLC). The UPLC was performed on a Poroshell 120 SB-C18 column (4.6 x 150 mm i.d., 2.7 μm) with mobile phase A of acetonitrile and mobile phase B of 0.1% formic acid in water for gradient elution. The flow rate was 0.8 mL / min, the column temperature was 40°C, and the sample injection volume was 2 μL. The detection wavelength for luteolin and apigenin was 283 nm, and the detection wavelength for norwuchukuerin was 330 nm. The determination method and parameters were in accordance with the 2020 edition of the Chinese Pharmacopoeia.

[0058] The content change of the effective substances in the dried pericarps of Example 1 and Comparative Examples 1-3 after aging is shown in Table 1. The results show that the content of the effective ingredients luteolin, apigenin and norwuchukuerin in the dried pericarp is increased after fermentation and aging with the strain, which is beneficial to the accumulation of the effective substances. The content of luteolin, apigenin and norwuchukuerin in the dried pericarp aged for 3 years is higher than that in the dried pericarp aged for 1 year and the dried pericarp of tea zhigan, and the content of the flavonoids in the dried pericarp after aging with the R12 strain is higher than that in the dried pericarp aged for 1 year and the dried pericarp of tea zhigan, which indicates that the R12 strain accelerates the aging and shortens the aging time.

[0059] Table 1. Content of flavonoids in dried pericarps after aging

[0060] Sample Luteolin μg / g Apigenin μg / g Nordamnacanthal μg / g Example 1 320.69 52.45 446.39 Comparative Example 1 260.61 51.19 420.67 Comparative Example 2 271.82 43.77 434.96 Comparative Example 3 365.42 94.41 576.25

[0061] In summary, the Paenibacillus sp. R12 strain is isolated and identified from the dried pericarp of Citrus grandis, and the content of luteolin, apigenin and norwuchukuerin in the dried pericarp is increased after fermentation and aging with the strain, which is beneficial to the accumulation of the main effective ingredients and the effect is better than that of the dried pericarp aged for 1 year. The strain provided by the present application can not only accelerate the aging of the dried pericarp and shorten the aging time, but also can be used for the directional production of new dried pericarp with stable quality, high flavonoid content and high quality, enriches the strain resources for microbial aging of dried pericarp, improves the aging efficiency, and provides more methods for shortening the aging time of the dried pericarp of Citrus grandis.

[0062] The above examples are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above examples, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, which are all included in the protection scope of the present application.

Claims

1. A Paenibacillus sp. R12 strain, which is characterized in that, The strain has been preserved in Guangdong Microbial Culture Collection Center on November 23, 2023, and the preservation number is GDMCC NO: 64060.

2. The application of the Paenibacillus taichungensis R12 strain or its bacterial liquid in the aging of pericarpium citri reticulatae.

3. The application of the Paenibacillus taichungensis R12 strain or its bacterial liquid in shortening the aging time of pericarpium citri reticulatae or in preparing products for accelerating the aging of pericarpium citri reticulatae.

4. The application of the Paenibacillus taichungensis R12 strain or its bacterial liquid in promoting the accumulation of flavonoid compounds in pericarpium citri reticulatae.

5. The application of the Paenibacillus taichungensis R12 strain or its bacterial liquid in preparing preparations for increasing the content of flavonoid compounds in pericarpium citri reticulatae.

6. Use according to claim 4 or 5, characterized in that, The flavonoid compounds in the pericarpium citri reticulatae are one or more of luteolin, apigenin, and norwumenoside.

7. A preparation for increasing the content of flavonoids in pericarpium citri reticulatae, characterized in that, The Paenibacillus taichungensis R12 strain or its bacterial liquid according to claim 1.

8. A method for promoting accumulation of flavonoids, effective substances in pericarpium citri reticulatae, characterized in that, The Paenibacillus taichungensis R12 strain or its bacterial liquid according to claim 1 is used to treat pericarpium citri reticulatae raw materials.

9. A method for shortening the aging time of dried orange peel, characterized in that, The Paenibacillus taichungensis R12 strain or its bacterial liquid according to claim 1 is used to ferment pericarpium citri reticulatae.

10. The method of claim 9, wherein, The Paenibacillus taichungensis R12 strain or its bacterial liquid is inoculated into pericarpium citri reticulatae at a weight ratio of 2-4% for fermentation treatment. The Paenibacillus taichungensis R12 strain or its bacterial liquid is inoculated into pericarpium citri reticulatae at a weight ratio of 2-4% for fermentation treatment.

Citation Information

Patent Citations

  • Pericarpium citri reticulatae and aging acceleration process thereof

    CN107625829A

  • Method for accelerating aging of dried tangerine peel

    CN111973673A

  • Bacillus velezensis and method for accelerating aging of orange peel by utilizing strain fermentation

    CN115895929A

  • Paenibacillus in table and application thereof

    CN116376743A