KASP markers for identifying the length of the light reaction period of chrysanthemum, method for developing the same, and applications thereof

Through BSA-seq technology combined with KASP marker, the SNP variant sites related to chrysanthemum photoreaction cycle were quickly located, and the KASP marker was developed, which solved the problem of chrysanthemum photoreaction cycle identification, achieved early accurate identification and efficient breeding, and improved breeding efficiency.

CN118186137BActive Publication Date: 2025-08-05NANJING AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410489590.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-23
Publication Date
2025-08-05
Estimated Expiration
2044-04-23

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately identify the length of the chrysanthemum photoreaction cycle, resulting in low breeding efficiency, and high cost of traditional molecular marking, making it difficult to achieve high-throughput classification.

Method used

BSA-seq technology combined with KASP marker, SNP variant sites related to the chrysanthemum photoreaction cycle were used to locate the SNP variant sites related to the chrysanthemum photoreaction cycle through whole gene resequencing, and KASP-Chr9_205233550 and KASP-Chr10_20239079 markers were developed for early identification of the chrysanthemum photoreaction cycle.

Benefits of technology

It realizes the early rapid and accurate identification of the chrysanthemum photoreaction cycle, improves breeding efficiency, reduces costs, avoids errors in artificial subjective judgments and waste of resources, and supports the establishment of the MAS breeding system for the chrysanthemum photoreaction cycle.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118186137B_ABST
    Figure CN118186137B_ABST
Patent Text Reader

Abstract

The present invention discloses a KASP marker combination for identifying the length of the chrysanthemum light reaction period, its development method and application. The present invention quickly locates the variant sites related to the light reaction period through the BSA-seq technology based on whole-genome resequencing, and converts the screened SNP-associated sites into KASP markers; the SNP sites Chr9_205233550 and Chr10_20239079 developed by the present invention can be used alone or in combination. The accuracy of this marker group in identifying the length of the light reaction period of chrysanthemum varieties can reach 82.67%. The KASP marker group can realize the early identification of the chrysanthemum light reaction period without the need for long and tedious field phenotypic surveys, which avoids the errors and waste of manpower and material resources caused by manual subjective judgment and greatly improves the selection efficiency. The identification method of the present invention can quickly and accurately judge the light reaction period in the early stage of chrysanthemum growth, which is beneficial to the selection of parents and the screening of excellent offspring strains, laying the foundation for the establishment of the MAS breeding system for the chrysanthemum light reaction period, and is of great significance to the research on the chrysanthemum light reaction period and its year-round production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a KASP marker for identifying the length of chrysanthemum light reaction period, a development method and application thereof, and belongs to the field of plant molecular marker assisted breeding. Background Art

[0002] The flowering period of ornamental plants is one of the most important traits that contribute to their ornamental value, and the timing of flowering directly affects their market price. Chrysanthemum (Chrysanthemum morifolium Ramat) is a typical short-day plant with a relatively monotonous flowering period, mostly concentrated in autumn, which has limited its commercial development. In production, artificial lighting or shading is required to regulate chrysanthemum flowering, which significantly increases production costs. The photoperiod refers to the number of days it takes for a plant to experience short-day light stimulation and reach the initial flowering stage. Different varieties have significant differences in their sensitivity to the photoperiod. Varieties with excessively long photoperiods increase production and management costs, while varieties with sensitive photoperiods have a shorter growth period, which helps control production costs and can also increase the number of plantings, thereby achieving cost savings and increasing efficiency. Therefore, cultivating varieties with short photoperiods is a key goal of chrysanthemum breeding.

[0003] Chrysanthemum is a highly heterozygous polyploid plant with self-incompatibility. Therefore, traditional hybridization and mutation breeding remain powerful methods for developing modern chrysanthemum varieties. However, traditional breeding relies on the breeder's experience to randomly combine favorable genes from the parents, resulting in low efficiency. With the development of molecular biology techniques, marker-assisted selection (MAS) breeding has become an important breeding method, allowing precise and efficient improvement of individual traits. Currently, most research focuses on the natural flowering period of chrysanthemum (i.e., the number of days from planting to each flowering period), while research on the photoreaction period is relatively limited. Yuan Chucong et al. (2023) found that the photoreaction period of chrysanthemum exhibits a continuously varying normal distribution, suggesting that the photoreaction period may be a quantitative trait controlled by multiple genes. The photoreaction period characteristics of a variety cannot be determined until the plant is stimulated by short-day light and begins to bloom, which is a long process. Therefore, it is urgent to establish a MAS breeding system for the photoreaction period of chrysanthemum to achieve early selection of high-quality varieties with a short growth period.

[0004] Research on MAS in chrysanthemum is currently in its early stages. Su et al. (2019) summarized recent progress in genetic research on chrysanthemum traits such as inflorescence, plant type, flowering period, and stress resistance based on molecular markers. However, previous studies were mainly based on traditional molecular markers such as SRAP, AFLP, RAPD, and SSR, which are limited in number and difficult to perform high-throughput typing, seriously affecting the accuracy and efficiency of localization. Compared with traditional molecular markers, single nucleotide polymorphism (SNP) and small insertion and deletion (InDel) markers have the characteristics of wide distribution, good genetic stability, and diallel genotypes, making them easier to achieve high-throughput and automated detection. However, for species with large genomes such as chrysanthemum (~8.5Gb), SNP and InDel sequencing is expensive, making large-scale population genotyping difficult. KASP typing technology, or competitive allele-specific PCR (KASP), is a new automated method for SNP and InDel detection. KASP markers can accurately identify SNPs and Indels at specific loci in genomic DNA samples from larger numbers of individuals, with short lead times and low costs, and have broad application prospects. BSA-seq is a method that combines next-generation sequencing (NGS) with clustered segregant analysis (BSA) to rapidly locate genes or loci associated with target traits (Wang et al., 2023). In recent years, the combined analysis strategy of BSA-seq and KASP typing has been widely used in fine-grained gene mapping and molecular marker-assisted breeding for agronomic traits such as yield and stress resistance in cash crops such as soybean, melon, sugarcane, and wheat (Wu et al., 2023). However, this approach has not yet been reported in studies of the photoreaction cycle of chrysanthemum. Summary of the Invention

[0005] Objectives of the invention: The first objective of the invention is to provide a KASP marker for identifying the duration of the photoreaction period in chrysanthemum. The second objective of the invention is to provide a method for developing and applying the KASP marker.

[0006] Technical solution: The present invention provides a KASP marker for identifying the length of the chrysanthemum light reaction cycle, wherein the KASP marker includes one or two of the following:

[0007] The SNP mutation site at position 205233550 on chromosome 9 of chrysanthemum, which mutated from T to A, was named KASP-Chr9_205233550-T / A; the SNP mutation site at position 20239079 on chromosome 10 of chrysanthemum, which mutated from A to G, was named KASP-Chr10_20239079-A / G.

[0008] The present invention also provides a method for developing the above-mentioned KASP marker for identifying the length of the chrysanthemum light reaction period based on BSA-seq technology, which comprises: (1) using two cut chrysanthemum varieties with a light reaction period length difference of at least 14 days as parents, hybridizing to obtain an F1 segregating population, and performing light reaction period phenotype identification on the population; according to production standards, supplementary lighting is started when the plants reach 20 to 25 cm in height; the light reaction period is the number of days from the cessation of supplementary lighting to the initial opening of the flowers, and the initial opening period is the period when 40% to 50% of the inflorescences are in a semi-open state;

[0009] (2) Screening multiple extreme strains with short photoreaction periods and long photoreaction periods from the F1 progeny, extracting DNA from the parents and all extreme strains, constructing early-flowering and late-flowering extreme mixed pools of the progeny, and performing whole-genome resequencing on the parents and the two mixed pools;

[0010] (3) The clean reads obtained after sequencing data quality control were aligned to the chrysanthemum reference genome for variant detection and filtered according to the quality of the variant sites and sample genotypes;

[0011] (4) Using the |Δ(SNP / InDel-index)| and Euclidean distance ED algorithms, the variant sites obtained after filtering in step (3) were subjected to BSA-seq analysis to obtain sites significantly associated with the chrysanthemum light response period;

[0012] (5) Using the sliding window method to analyze |Δ(SNP / InDel-index)| and ED 2 Perform fitting, take the average value within the window as the fitted value, sort the windows from large to small according to the window fitting value, use the fitting value at the top 0.5% as the correlation threshold to screen significant windows, and take the intersection of the significant windows obtained by the two algorithms.

[0013] (6) Select the variant sites with |Δ(SNP / InDel-index)|>0.8 in the intersection window obtained in step (5), use the "bedtools getfasta" program to extract the upper and lower 200 bp sequences of each site, and select the sequences that meet the criteria as chrysanthemum light reaction cycle-related sites suitable for developing KASP markers;

[0014] (7) designing corresponding KASP amplification primers based on the variant sites screened in step (6), and performing PCR amplification in the development population;

[0015] (8) The accuracy of the KASP markers developed in step (7) with clear typing and no specific amplification in the negative control samples was calculated. Without considering the heterozygous sites, the KASP markers with an accuracy rate > 80% were verified in the natural population. When the accuracy of the KASP marker in the natural population reached 80%, it was determined that the KASP marker could be used for early identification of the length of the chrysanthemum light reaction cycle.

[0016] The female parent in step (1) is the long-photoperiod chrysanthemum variety 'Nannong Luhuo', and the male parent is the short-photoperiod chrysanthemum variety 'Mini Huang'.

[0017] Wherein, the supplementary lighting days in step (1) are 40 to 50 days.

[0018] Wherein, the number of strains used to construct each extreme mixed pool in step (2) is 10% to 20% of the size of the population in the F1 progeny.

[0019] The chrysanthemum reference genome in step (3) is 'Zhongshan Zigui'.

[0020] Among them, the specific steps of step (3) include: removing the adapters and low-quality sequences from the original sequencing data of the parents and the two extreme mixed pools to obtain valid sequencing data, using BWA software to align to the chrysanthemum reference genome, performing quality control on the results, and then using GATK software to detect variant sites and filter out low-quality variant results for the next step of analysis.

[0021] Among them, the filtering conditions for SNPs and InDels variant sites are "QD<2.0||FS>60.0||MQ<40.0||MQRankSum<-12.5||ReadPosRankSum<-8.0" and "QD<2.0||FS>200.0||SOR>10.0||MQRankSum<-12.5||ReadPosRankSum<-8.0", respectively.

[0022] Among them, in step (4), the markers for BSA-seq analysis were screened according to the following filtering criteria: 1) the parental segregation pattern conformed to the F1 population, i.e., nn×np, lm×ll, hk×hk; 2) there were no genotype deletions in the parental and offspring pools; 3) homozygous identical sites with opposite phenotypes between the parent and offspring were removed; 4) the sequencing depth of the four samples was greater than 10× and less than 500×; 5) the SNP / InDel-index of at least one offspring pool was greater than 0.3; 6) the SNP / InDel-index of at least one offspring pool was less than 0.7.

[0023] The window size used in the sliding window in step (5) is 500 kb, the step size is 50 kb, and when the number of SNPs in the window is greater than or equal to 20, the window is a valid window. When the number of SNPs is insufficient, the results of the window are merged into the next window.

[0024] Among them, the selection criteria for variant sites suitable for developing KASP markers in step (6) are: 1) the number of variant sites in the upstream and downstream 200bp sequences, except for the target SNP or InDel site, does not exceed 5; 2) the number of similar sequences of the fragment in the chrysanthemum genome does not exceed 3, that is, the fewer the number of sequences obtained when the sequence alignment identity percentage is satisfied at the same time, the better.

[0025] The primers in step (7) comprise two competitive front primers and one universal back primer, the 3' terminal base of the front primer is the SNP or InDel site allelic variant base, and the 5' end of the front primer is respectively labeled with FAM and VIC fluorescent sequences.

[0026] The KASP-PCR amplification system in step (7) is as follows: 0.8 μL of 2×KASP Mastermix, 0.024 μL of PrimerMix (front primer F1 concentration 12 μM, front primer F2 concentration 12 μM, universal back primer concentration 30 μM), and 0.776 μL of ddH2O. At least one negative control (NTC) without DNA template is set up.

[0027] The KASP-PCR amplification program in step (7) is as follows: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing and extension at 55-65°C for 60 s, with the annealing and extension temperature decreasing by 1.0°C each cycle, for a total of 10 cycles; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, for a total of 20 cycles.

[0028] The present invention also discloses an application of the above-mentioned KASP marker in identifying the length of the chrysanthemum light reaction period, characterized in that, for the marker KASP-Chr9_205233550-T / A, if the detected genotype is T:T, the light reaction period is short; if the detected genotype is A:A, the light reaction period is long; if the detected genotype is heterozygous A:T, the light reaction period is likely to be long, which can be further confirmed in combination with the field phenotype; for the marker KASP-Chr10_20239079-A / G, if the detected genotype is A:A, the light reaction period is long. short; if the detected genotype is G:G or G:A, the light reaction period is likely to be long, which can be further confirmed in combination with field phenotypes; when the KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G markers are combined to determine the length of the light reaction period of chrysanthemum varieties, if the detected genotype is T:TA:A, the light reaction period is short; if the detected genotype is A:AG:G or A:AG:A or A:TG:G or A:TG:A, the light reaction period is long; if it is other genotypes, it can be further confirmed in combination with field observations.

[0029] The present invention also discloses a method for early identification of the photoreaction period of chrysanthemum, comprising the following steps:

[0030] (1) Extract DNA from the sample to be tested at the seedling stage and use it as an amplification template;

[0031] (2) The above-mentioned KASP markers were PCR amplified and genotyped. When the KASP marker was KASP-Chr9_205233550-T / A, if the genotype was T:T, the light reaction period was short; if it was A:A, the light reaction period was long; if it was A:T, the light reaction period was likely to be long, which needed to be further determined in combination with the field phenotype. When the KASP marker was KASP-Chr10_20239079-A / G, if the genotype was A:A, the light reaction period was short; if it was A:T, the light reaction period was likely to be long. If the tested genotype is G:G or G:A, the photoreaction period is likely to be long, which can be further confirmed in combination with field phenotypes. When the KASP markers are KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G, if the tested genotype is T:TA:A, the photoreaction period is short. If the tested genotype is A:AG:G or A:AG:A or A:TG:G or A:TG:A, the photoreaction period is long. Other genotypes can be further confirmed in combination with field observations.

[0032] Wherein, the amplification primers used to amplify the KASP marker KASP-Chr9_205233550-T / A in step (2) include two competitive front primers with nucleotide sequences as shown in SEQ ID NOs: 1 to 2, and a universal back primer with a nucleotide sequence as shown in SEQ ID NO: 3; the amplification primers used to amplify the KASP marker KASP-Chr10_20239079-A / G include two competitive front primers with nucleotide sequences as shown in SEQ ID NOs: 4 to 5, and a universal back primer with a nucleotide sequence as shown in SEQ ID NO: 6.

[0033] Beneficial Effects: Compared with existing technologies, the present invention has the following significant advantages: Using BSA-seq technology based on whole-genome resequencing, the present invention rapidly locates variant sites associated with the photoreaction cycle and converts the screened SNP-associated sites into KASP markers. Compared to traditional molecular markers based on conventional PCR amplification, KASP markers do not require gel electrophoresis, enabling rapid, high-throughput, and platform-based detection. The SNP sites Chr9_205233550 and Chr10_20239079 developed in the present invention can be used individually or in combination. This marker panel can identify the length of the photoreaction cycle of chrysanthemum varieties with an accuracy rate of 82.67%. This eliminates the need for lengthy field phenotyping surveys, avoiding errors caused by subjective judgment and the waste of manpower and material resources, while significantly improving selection efficiency. The identification method of the present invention can quickly and accurately judge the light reaction period in the early growth stage of chrysanthemum, which is beneficial to the selection of parents and the screening of excellent offspring strains, lays the foundation for the establishment of a MAS breeding system for the light reaction period of chrysanthemum, and is of great significance to the research on the light reaction period of chrysanthemum and its year-round production. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 The images show the same-day opening status of the chrysanthemum varieties 'Nannong Luhuo' and 'Mini Huang', as well as the 20 F1 strains with short photoreaction periods that make up the early-flowering pool EB and the 20 F1 strains with long photoreaction periods that make up the late-flowering pool LB; the scale bar is 1 cm.

[0035] Figure 2 is based on |Δ(SNP / InDel-index)|(a) and Euclidean distance ED 2 (b) BSA-seq mapping results of the chrysanthemum light reaction cycle using two algorithms. Each dot represents a SNP or InDel variant site. The red line represents the |Δ(SNP / InDel-index| and ED for each window calculated using a 500 kb window and 50 kb step size sliding window strategy. 2 Mean.

[0036] Figure 3Genotyping results of KASP markers KASP-Chr9_205233550-T / A (a), KASP-Chr10_20239079-A / G (b) and KASP-Chr10_20506493-G / T (c) for the parental line and two extreme mixed pool lines.

[0037] Figure 4 Figure 4 shows the genotyping results of KASP markers KASP-Chr9_205233550-T / A (a) and KASP-Chr10_20239079-A / G (b) for 40 short-photoreaction period and 35 long-photoreaction period varieties.

[0038] Figure 5 Flowchart for developing KASP markers based on BSA-seq technology to achieve early and efficient identification of the length of the chrysanthemum light reaction cycle. DETAILED DESCRIPTION

[0039] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0040] Example 1 Acquisition of Chrysanthemum Photoreaction Cycle-Associated Sites

[0041] (1) Population construction and photoreaction cycle statistics

[0042] The long-light reaction period variety 'Nannong Luhuo' (LH) was used as the female parent, and the short-light reaction period variety 'Mini Yellow' (MiniY) was used as the male parent for hybridization (the long-light / short-light reaction period variety condition was judged to be at least 14 days different in light reaction period), and an F1 segregating population (n = 208) was obtained. All materials were stored in the "China Chrysanthemum Germplasm Resource Conservation Center" of Nanjing Agricultural University. Those skilled in the art can obtain the above-mentioned germplasm from the "China Chrysanthemum Germplasm Resource Conservation Center". The two parents and 208 F1 strains were asexually propagated by cutting method and planted on August 9, 2022 and July 26, 2023, respectively. Supplementary light was started when the plants reached 20 cm in height, and the supplementary light time was from 22:00 to 2:00 the next day. The number of days from the cessation of light supplementation to the initial opening period (i.e., the light reaction period) of the parents and F1 offspring was counted. The initial opening period was the period when 50% of the inflorescences were half-open. The light suspension time for two years was September 30, 2022 (E1, 50 days of light supplementation) and September 16, 2023 (E2, 36 days of light supplementation), and routine water and fertilizer management was carried out.

[0043] (2) Extreme pool construction and high-throughput sequencing

[0044] After each planting, the light reaction period of the F1 progeny population was sorted, and 20 short light reaction period strains (the 20 strains with the shortest reaction period) and 20 long light reaction period strains (the 20 strains with the longest reaction period) were selected. The results are as follows: Figure 1 As shown in Table 1, 3–4 ray-shaped petals from each of the aforementioned lines and the two parental materials were collected in centrifuge tubes, frozen and ground in liquid nitrogen, and sent to Shenzhen BGI Genomics Service Co., Ltd. for DNA extraction and library construction. (During library construction, DNA from 20 progeny with short photoperiods and 20 progeny with long photoperiods from the development population were mixed at equal concentrations to construct early-flowering pools (EB) and late-flowering pools (LB), respectively.) Whole-genome resequencing was performed using the DNBseq platform. In addition, 40 short-photoperiod varieties and 35 long-photoperiod varieties were selected from the natural population for KASP marker validation. These varieties were simultaneously planted during the second cutting culture (E2) and their photoperiods were counted.

[0045] Table 1 117 test materials and their photoreaction cycle information

[0046]

[0047]

[0048] Note: E and L are the short-photoreaction period variety and long-photoreaction period variety used to verify KASP markers, respectively.

[0049] (3) Sequence alignment and variation detection

[0050] After removing adapters and low-quality sequences from the raw sequencing data, the resulting valid sequencing data are detailed in Table 2. The sequences were aligned to the reference genome of the cultivated chrysanthemum cultivar 'Zhongshan Zigui' (https: / / doi.org / 10.6084 / m9.figshare.21655364.v2) using the mem algorithm in BWA software (Version 0.7.17). This generated an alignment file in sam format. The sam file was then converted to a sorted bam file using tools such as sort, fixmate, and markdup in SAMtools (Version 1.9). Finally, the bam file was quality-controlled for genome alignment and coverage depth. The alignment rates for the four samples, LH, Mini Y, EB, and LB, were 99.69%, 99.50%, 99.66%, and 99.66%, respectively. The 1× coverage percentage was above 87.67%, and the average depth of the pooled sequencing was 35.67×, indicating sufficient sample data and normal sequencing. GATK software (Version: 4.2.6.1) was then used to detect the variation results, and the original SNP and InDel sites obtained were filtered according to the "QD<2.0||FS>60.0||MQ<40.0||MQRankSum<-12.5||ReadPosRankSum<-8.0" and "QD<2.0||FS>200.0||SOR>10.0||MQRankSum<-12.5||ReadPosRankSum<-8.0" filtering criteria to remove low-quality variations.

[0051] Table 2 BSA-seq sequencing data statistics

[0052]

[0053] (4) Marker screening

[0054] To minimize background noise, SNP / Indel sites were filtered according to the following criteria. Sites that met the following criteria were used for subsequent BSA analysis: 1) the parental segregation pattern was consistent with the F1 population, i.e., nn×np, lm×ll, hk×hk; 2) the genotypes of the parental and offspring pools were free of deletions; 3) homozygous identical sites with opposite phenotypes in the parental and offspring pools were removed; 4) the sequencing depth of the four samples was greater than 10× and less than 500×; 5) at least one offspring pool had a SNP / InDel index greater than 0.3; and 6) at least one offspring pool had a SNP / InDel index less than 0.7. After filtering according to these criteria, 3,470,467 SNPs and 417,168 InDels were obtained for subsequent BSA-seq analysis.

[0055] (5)BSA-seq analysis

[0056] Significantly associated loci were identified using the |Δ(SNP / InDel-index)| and Euclidean distance (ED) methods. The ratio of read counts at the mutation site for the SNPs and InDels meeting the criteria in the two pools (early and late flowering pools) to the total number of reads at that site, i.e., the SNP / InDel-index value, was calculated. The absolute value of the difference in SNP frequencies between the pools was calculated using the formula |Δ(SNP / InDel-index)| = |SNP / InDel-index(EB) - SNP / InDel-index(LB)|. The root sum of the squares of the differences in the four base depths of SNPs and InDels between the two pools was estimated using the Euclidean distance (ED) formula.

[0057]

[0058] Among them A mut is the frequency of base A in the mutation pool, A wt is the frequency of base A in the wild-type pool; C mut is the frequency of C base in the mutation pool, C wt is the frequency of C base in the wild-type pool; G mut is the frequency of G base in the mutation pool, G wt is the frequency of G base in the wild-type pool; T mut is the frequency of T base in the mutation pool, T wt is the frequency of T base in the wild-type pool. To reduce background noise, the original ED value is usually squared to obtain ED 2 As the final association value. |Δ(SNP / InDel-index)| and ED 2 The larger the value, the more closely the site is associated with the target trait. The analysis results of the two algorithms were comprehensively compared to obtain the final chrysanthemum light reaction cycle associated sites. Figure 2 As shown, |Δ(SNP / InDel-index)|>0.8 and ED 2 The significant association sites with a value of >1.3 were mainly located on chromosomes Chr10, Chr11 and Chr19.

[0059] In order to further reduce the background noise, the calculated |Δ(SNP / InDel-index| and ED were analyzed according to the sliding window method. 2The results were fitted, and the average value within the window was taken as the fitted value. The window size used for sliding the window was 500kb, and the step size used was 50kb. When the number of SNPs in the window was greater than or equal to 20, the window was considered a valid window. When the number of SNPs was insufficient, the results of the window were merged into the next window. The windows were sorted from large to small according to the window fitting value, and the fitting value at the top 0.5% was used as the threshold to screen the significant window. Then |Δ(SNP / InDel-index)| and ED 2 The thresholds of the two algorithms are 0.2677 and 0.2022, respectively. The two algorithms obtain 209 and 194 salient windows, respectively. The intersection of the salient windows obtained by the two algorithms is taken, and finally 153 intersection windows are obtained.

[0060] Example 2 Development and Application of KASP Markers for Chrysanthemum Photoreaction Cycle

[0061] (1) Screening of associated sites suitable for developing KASP markers

[0062] From the 153 significant windows, 135 SNPs and 23 indels with |Δ(SNP / InDel-index)| > 0.8 were selected. The "bedtools getfasta" program was used to extract the flanking 200 bp of sequence for each locus. Suitable KASP marker development was determined by meeting the following criteria: 1) excluding the target SNP or InDel site, the number of variant sites within the 200 bp upstream and downstream sequences did not exceed five; and 2) the fragment had no more than three similar sequences in the chrysanthemum genome. This means that the fewer sequences obtained, the better, when both identity > 83% and coverage > 80% were achieved during blast analysis. Finally, six SNPs and one InDel site were selected for KASP marker development (Table 3).

[0063] Table 3 Information of 7 SNP / InDel variant sites used to develop KASP markers

[0064]

[0065] (2) Primer design and KASP-PCR amplification

[0066] Seven primer pairs were designed based on the 200-bp flanking sequences before and after the seven variant sites and primer design principles. Each pair consists of two competitive forward primers (FAM-F1 and VIC-F2) and a universal back primer (Com-R). The 3'-terminal base of the forward primers corresponds to the allele variant at the SNP or InDel site, and the 5'-termini of the forward primers are labeled with fluorescent sequences: FAM (5'-GAAGGTGACCAAGTTCATGCT-3') and VIC (5'-GAAGGTCGGAGTCAACGGATT-3'), respectively. Primers were synthesized by Beijing Zhongyujin Biotechnology Co., Ltd. (http: / / www.cgmb.com.cn). Primer sequences are shown in Table 4.

[0067] Table 4 Primer information of 7 KASP markers

[0068]

[0069]

[0070] Note: The underlined cells are FAM fluorescent sequence tags; the double underlined cells are VIC fluorescent sequence tags.

[0071] The naming principle of KASP markers is: KASP+variant site location+typing result. For example, KASP-Chr9_205233550-T / A indicates that the detection site is the SNP variant site Chr9_205233550 located on chromosome 9, and the wild-type and mutant genotypes of this site are T and A, respectively; KASP-Chr25_73557141-G / GA indicates that the detection site is the InDel variant site Chr25_73557141 located on chromosome 25, and the wild-type and mutant genotypes of this site are G and GA, respectively.

[0072] DNA from the two parents and 40 extreme strains was extracted using a plant genomic DNA rapid extraction reagent (Shanghai Pudi Biotechnology Co., Ltd., AG504A) and diluted to 50-100 ng·μL. –1 , used as a template for PCR amplification. KASP-PCR reactions were performed on the Douglas Array Tape genotyping platform. 1.6 μL of dissolved DNA sample was added to the bottom of a 96-well PCR reaction plate and dried. The reaction system (1.6 μL) consisted of: 0.8 μL of 2× KASP Mastermix, 0.024 μL of Primer Mix (front primer FAM-F1 at 12 μM, front primer VIC-F2 at 12 μM, universal back primer at 30 μM), and 0.776 μL of ddH2O. At least one ddH2O-free control (NTC) was included.

[0073] Touchdown method was used for PCR amplification: pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 s, annealing and extension at 55-65°C for 60 s, with the annealing and extension temperature decreasing by 1.0°C each cycle, for a total of 10 cycles; denaturation at 95°C for 20 s, annealing and extension at 55°C for 60 s, for a total of 20 cycles.

[0074] (3) KASP genotyping and accuracy calculation

[0075] After the KASP-PCR reaction, the fluorescence signal was read using an ARAYA fluorescence scanner and converted into base genotypes. SNP or InDel typing of the sample was performed according to the principle of clear typing and no specific amplification of NTC, and the typing results were visualized using R software v4.2.3.

[0076] Furthermore, the accuracy of the three KASP markers with clear typing was calculated in the mixed pool population ( Figure 3 ; Table 5).

[0077] Table 5 Accuracy of photoreaction period identification using three KASP markers in mixed populations

[0078]

[0079] Note: E and L are the number of individuals with short photoreaction period and long photoreaction period, respectively.

[0080] For the marker KASP-Chr9_205233550-T / A, if the detection site is T:T, the light reaction period is short, if it is A:A, the light reaction period is long, and if it is A:T, the light reaction period is likely to be long. This needs to be further determined in combination with field phenotypes. The average accuracy of the mixed pool is 76.52%.

[0081] For the marker KASP-Chr10_20239079-A / G, if the detection site is A:A, the light reaction period is short, if it is G:G, the light reaction period is long, and if it is G:A, the light reaction period is likely to be long. The average accuracy of the mixed pool is 79.17%.

[0082] For the marker KASP-Chr10_20506493-G / T, if the detection site is G:G, the light reaction period is likely to be short, which needs to be further determined in combination with the field phenotype. If it is T:T, the light reaction period is long. If it is T:G, the light reaction period is likely to be short. The average accuracy of the mixed pool is 61.44%.

[0083] In summary, the genotyping clustering of KASP-Chr9_205233550-T / A was the clearest among the three KASP markers ( Figure 3a) Without considering heterozygous sites, 75.00% of individuals with T:T genotype in the mixed pool had short photoreaction periods, and 100.00% of individuals with A:A genotype had long photoreaction periods, that is, the average accuracy of KASP-Chr9_205233550-T / A in the mixed pool was 87.50%. The second most accurate marker was KASP-Chr10_20239079-A / G ( Figure 3 b) Without considering heterozygous sites, 62.50% of individuals carrying the A:A genotype in the mixed pool had a short photoreaction period, and 100.00% of individuals carrying the G:G genotype had a long photoreaction period. That is, the average accuracy of KASP-Chr10_20239079-A / G in the mixed pool was 81.25%. KASP-Chr10_20506493-G / T had the worst genotyping clustering ( Figure 3 c) Ignoring heterozygous loci, 52.17% of individuals with the G:G genotype in the mixed population had a short photoreaction period, while 75.00% of individuals with the T:T genotype had a long photoreaction period. This means that the average accuracy of KASP-Chr10_20506493-G / T in the mixed population was 63.59%. Therefore, the KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G markers can successfully genotype the mixed population.

[0084] Among them, the 200bp sequence above and below the SNP variation site Chr9_205233550 is: GTTTCACCCAAGAATA TAATGACAACATCTGTATTAGAGGCATTGAACCACCACGACATCACTCCCTTTGACATTGGAATCACGTCTCCTTTCTTAATC[T / A]CCACAATCGTTTCTTCTGAACTGTTTG GTGATATCAATCCAACTGTGCAACTGCCTGTACATGCATGCACATATTTGTTAATTGT TATGATCAGTTTACA.

[0085] The 200bp sequence above and below the SNP variant site Chr10_20239079 is: GCGTGAATATTCATC TAGTATATACAAAAAGATAAAATATTTAAAATGGAAAAAGTTGTTAATTTACATCAA TTCTCATCCCTGTGCTTCGATGCTGAC[A / G]ACACGCGAAACACAAAGACAACAAC ATAACGTTTATTTCAACTTGTTCCAAATTTAAAACTTAAAGTATATAAGGAAGTACA ATTTCATTCCTCCAATGT.

[0086] (4) Verification of KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G markers

[0087] To further verify whether the KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G markers are universal in other populations, 40 short-photoperiod varieties and 35 long-photoperiod varieties (the varieties used for verification in Table 1) were selected for verification. DNA from 75 chrysanthemum varieties was extracted using a plant genomic DNA rapid extraction reagent and used as an amplification template, diluted to 100 ng / μL. –1 , KASP-PCR amplification and genotyping were performed according to steps (2) and (3), and the typing results were visualized using R software v4.2.3 ( Figure 4 ).

[0088] Furthermore, based on the phenotypes corresponding to the genotypes of the corresponding markers in step (3), the consistency of genotype and phenotype of KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G markers was analyzed in the validation population (Table 6).

[0089] Table 6 Verification results of KASP-Chr9205233550-T / A and KASP-Chr1020239079-A / G markers

[0090]

[0091]

[0092] Note: a E: short photoreaction period variety; L: long photoreaction period variety; b ?: No signal or weak signal; Uncallable: There is a signal but no clear classification;

[0093] c NA: The genotype was not detected and its consistency with the phenotype cannot be determined.

[0094] For the marker KASP-Chr9_205233550-T / A, 29 varieties with the T:T genotype, 19 of which had short photoperiods, achieved a concordance rate of 65.52%. A total of 39 varieties with the A:T genotype, 24 of which had long photoperiods, achieved a concordance rate of 61.54%. The average concordance rate in the validation population was 63.53%. This indicates that this marker performs better in screening chrysanthemum varieties with long photoperiods (24 / 35 = 68.57%).

[0095] For the marker KASP-Chr10_20239079-A / G, there were 50 varieties with the A:A genotype, 27 of which had short photoperiods, with a concordance rate of 54.00%; 4 varieties with the G:A genotype, 1 of which had long photoperiods, with a concordance rate of 25.00%; and 3 varieties with the G:G genotype, 1 of which had long photoperiods, with a concordance rate of 33.33%. The average concordance rate in the validation population was 37.44%. This shows that this marker performs better in screening chrysanthemum varieties with short photoperiods (27 / 40 = 67.50%).

[0096] In summary, the combined use of KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G markers can better identify the length of the chrysanthemum photoreaction period. In the validation population, as long as the genotype of at least one marker was consistent with the phenotype, the photoreaction period identification was considered correct. Using this standard, the accuracy rate was 90.00% for short-photoreaction period varieties and 74.29% for long-photoreaction period varieties, with an average accuracy of 82.67% across the validation population (Table 6). Therefore, the KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G marker set can be used efficiently and cost-effectively in molecular marker-assisted breeding for photoreaction period determination in chrysanthemum.

[0097] Example 3 Application of the KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G Marker Set in Early High-Throughput Screening of Short-Photoperiod Chrysanthemum Varieties

[0098] The DNA of the sample to be tested was extracted at the seedling stage and used as an amplification template and diluted to 100 ng·μL –1, perform KASP-PCR amplification and genotyping according to steps (2) and (3) in Example 2. The sequences of the two competitive front primers KASP-Chr9_205233550-T / A are SEQ ID NO.1: GAAGGTGACCAAGTTCATGCT AAACAGTTCAGAAGAAACGATTGTGGA (the underlined portion is the FAM fluorescent sequence) and SEQ ID NO. 2: (The double-underlined portion is the VIC fluorescence sequence). The universal rear primer sequence is SEQ ID NO. 3: CCACGACATCACTCCCTTTGACATT. If the genotype is T:T, the photoreaction period is short; if the genotype is A:A, the photoreaction period is long; if the genotype is heterozygous A:T, the photoreaction period is likely long, which can be further confirmed by combining field phenotypes.

[0099] The sequences of the two competitive front primers KASP-Chr10_20239079-A / G are SEQ ID NO.4: GAAGGTG ACCAAGTTCATGCT TTGTTGTCTTTGTGTTTCGCGTGTT (the underlined part is the FAM fluorescent sequence) and SEQ ID NO.5: (The double-underlined portion is the VIC fluorescence sequence). The universal rear primer sequence is SEQ ID NO. 6: CATCAATTCTCATCCCTGTGCTTCGAT. If the genotype tested is A:A, the photoreaction period is short; if the genotype tested is G:G or G:A, the photoreaction period is likely long, which can be further confirmed by combining field phenotypes.

[0100] The KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G marker sets were used to identify the photoreaction period of chrysanthemum varieties. Genotypes of T:TA:A indicate a short photoreaction period; A:AG:G, A:AG:A, A:TG:G, or A:TG:A indicate a long photoreaction period. Other genotypes can be further confirmed by field observation.

Claims

1. An application of a KASP marker in identifying the length of the photoreaction period of chrysanthemum, characterized in that: The KASP markers are one or two of the following: a SNP variant site located at position 205233550 on chromosome 9 of chrysanthemum, the sequence of 200 bp above and below the SNP site is: GTTTCACCCAAGAATATAATGACAACATCTGTATTAGAGGCATTGAACCACCACGACATCACTCCCTTTGACATTGGAATCACGTCTCCTTTCTTAATC[T / A]CCACAATCGTTTCTTCTGAACTGTTTGGTGATATCAATCCAACTGTGCAACTGCCTGTACATGCATGCACATATTTGTTAATTGTTATGATCAGTTTACA, the sequence is KASP-Chr9_205233550-T / A marker; a SNP variant site located at position 20239079 on chromosome 10 of chrysanthemum, the sequence of 200 bp above and below the SNP site is: GTTTCACCCAAGAATATAATGACAACATCTGTATTAGAGGCATTGAACCACCACGACATCACTCCCTTTGACATTGGAATCACGTCTCCTTTCTTAATC[T / A]CCACAATCGTTTCTTCTGAACTGTTTGGTGATATCAATCCAACTGTGCAACTGCCTGTACATGCATGCACATATTTGTTAATTGTTATGATCAGTTTACA, the sequence is KASP-Chr9_205233550-T / A marker; The bp sequence is: GCGTGAATATTCATCTAGTATATACAAAAAGATAAAATATTTAAAATGGAAAAAGTTGTTAATTTACATCAATTCTCATCCCTGTGCTTCGATGCTGAC[A / G]ACACGCGAAACACAAAGACAACAACATAACGTTTATTTCAACTTGTTCCAAATTTAAAACTTAAAGTATATAAGGAAGTACAATTTCATTCCTCCAATGT, the sequence Listed as KASP-Chr10_20239079-A / G markers; for marker KASP-Chr9_205233550-T / A, if the detected genotype is T:T, the light reaction period is short; for marker KASP-Chr10_20239079-A / G, if the detected genotype is A:A, the light reaction period is short; when the KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G markers are combined to determine the length of the light reaction period of chrysanthemum varieties, if the detected genotype is T:TA:A, the light reaction period is short.

2. A method for early identification of the photoreaction period of chrysanthemum, characterized in that: The following steps are involved: (1) Extract DNA from the sample to be tested at the seedling stage and use it as an amplification template; (2) PCR amplification and genotyping of KASP markers, wherein the KASP markers are one or two of the following: a SNP variant site located at position 205233550 on chromosome 9 of chrysanthemum, the 200 bp sequence above and below the SNP site is: GTTTCACCCAAGAATATAATGACAACATCTGTATTAGAGGCATTGAACCACCACGACATCACTCCCTTTGACATTGGAATCACGTCTCCTTTCTTAATC[T / A]CCACAATCGTTTCTTCTGAACTGTTTGGTGATATCAATCCAACTGTGCAACTGCCTGTACATGCATGCACATATTTGTTAATTGTTATGATCAGTTTACA, the sequence is KASP-Chr9_205233550-T / A marker; a SNP variant site located at position 20239079 on chromosome 10 of chrysanthemum, the 200 bp sequence above and below the SNP site is: GTTTCACCCAAGAATATAATGACAACATCTGTATTAGAGGCATTGAACCACCACGACATCACTCCCTTTGACATTGGAATCACGTCTCCTTTCTTAATC[T / A]CCACAATCGTTTCTTCTGAACTGTTTGGTGATATCAATCCAACTGTGCAACTGCCTGTACATGCATGCACATATTTGTTAATTGTTATGATCAGTTTACA, the sequence is KASP-Chr9_205233550-T / A marker; The bp sequence is: GCGTGAATATTCATCTAGTATATACAAAAAGATAAAATATTTAAAATGGAAAAAGTTGTTAATTTACATCAATTCTCATCCCTGTGCTTCGATGCTGAC[A / G]ACACGCGAAACACAAAGACAACAACATAACGTTTATTTCAACTTGTTCCAAATTTAAAACTTAAAGTATATAAGGAAGTACAATTTCATTCCTCCAATGT, the sequence is KASP-Chr10_20239079-A / G marker; when the KASP marker is KASP-Chr9_205233550-T / A, if the detected genotype is T:T, the light reaction period is short; when the KASP marker is KASP-Chr10_20239079-A / G, if the detected genotype is A:A, the light reaction period is short; when the KASP marker is KASP-Chr9_205233550-T / A and KASP-Chr10_20239079-A / G, if the detected genotype is T:TA:A, the light reaction period is short.

3. The method for early identification of chrysanthemum light reaction period according to claim 2, characterized in that: The amplification primers used to amplify the KASP marker KASP-Chr9_205233550-T / A in step (2) include two competitive front primers with nucleotide sequences as shown in SEQ ID NOs: 1 to 2, and a universal back primer with a nucleotide sequence as shown in SEQ ID NO: 3; the amplification primers used to amplify the KASP marker KASP-Chr10_20239079-A / G include two competitive front primers with nucleotide sequences as shown in SEQ ID NOs: 4 to 5, and a universal back primer with a nucleotide sequence as shown in SEQ ID NO: 6.

Citation Information

Patent Citations

  • Chrysanthemum variety rejuvenation method based on small-batch selection

    CN114680011A

  • Method for efficiently predicting florescence of chrysanthemum based on whole genome selection

    CN116564407A