A porcine reproductive and respiratory syndrome mRNA vaccine

Abstract

The present invention provides a porcine reproductive and respiratory syndrome mRNA vaccine, which belongs to the field of biotechnology. The mRNA vaccine provided by the present invention uses PRRSV GP5 protein as an antigen protein, and also contains GP2 protein and M protein as antigen proteins. Among them, GP5-mRNA can induce a higher level of neutralizing antibodies at a high dose, and has a significant activation effect on cellular immunity, and can obtain an immune effect comparable to that of a commercial attenuated vaccine, and although GP2-GP5-M-mRNA only shows a lower level of immune response, it provides a more comprehensive theoretical guidance for the development of mRNA vaccines expressing fusion proteins. It lays a good foundation for the research of PRRS mRNA vaccines.

Description

Technical Field

[0001] The present invention belongs to the technical field of vaccine preparation, and particularly relates to a porcine reproductive and respiratory syndrome mRNA vaccine. Background Art

[0002] Porcine reproductive and respiratory syndrome (PRRS) is a pandemic disease of pigs, and its main symptoms are reproductive and respiratory diseases in pigs at different growth stages, such as abortion in sows, stillbirth or premature death of piglets, fever, bleeding, and respiratory syndrome. Because the diseased pigs significantly show blue-purple ears, it is also known as "porcine blue ear disease". Due to its high infectivity and harmfulness, PRRS has been listed as a Class B infectious disease by the World Organization for Animal Health (WOAH) and as a Class II infectious disease in China. PRRS has become one of the main diseases affecting the development of the world's pig industry.

[0003] Currently, the prevention and control of porcine reproductive and respiratory syndrome mainly rely on traditional inactivated vaccines and attenuated live vaccines. However, the situation over the years has shown that it is ultimately difficult for attenuated live vaccines and inactivated vaccines to achieve complete prevention and control of PRRS.

[0004] mRNA vaccines are a new type of vaccine with high safety, strong immunogenicity, and short R & D cycle. Currently, some mRNA vaccines that have been preliminarily developed can induce neutralizing antibodies faster and more effectively, have fewer side effects, and can induce stronger cellular immunity and cross-reactivity against heterologous strains. Summary of the Invention

[0005] The object of the present invention is to provide an mRNA vaccine that can completely prevent and control porcine reproductive and respiratory syndrome PRRS, and the provided mRNA vaccine can trigger strong humoral immunity and strong cellular immunity.

[0006] The present invention first provides an mRNA vaccine, and in the mRNA vaccine, the PRRSV GP5 protein with the amino acid sequence of SEQ ID NO: 1 is used as the antigen protein of the mRNA vaccine;

[0007] For the GP5 protein, the nucleotide sequence of one of its encoding genes is SEQ ID NO: 2;

[0008] As a specific record of an embodiment, for the mRNA vaccine, one specific nucleic acid sequence is SEQ ID NO: 3;

[0009] Furthermore, for the mRNA vaccine described above, its antigen protein further comprises GP2 protein and M protein.

[0010] The amino acid sequence of the GP2 protein is SEQ ID NO:4, and the sequence of its encoding gene is SEQ ID NO:5.

[0011] The amino acid sequence of the M protein is SEQ ID NO:6, and the sequence of its encoding gene is SEQ ID NO:7.

[0012] For the mRNA vaccine comprising GP5 protein, GP2 protein and M protein, a specific nucleic acid sequence thereof is SEQ ID NO:8.

[0013] Preferably, the mRNA vaccine is encapsulated using LNP.

[0014] The present invention provides a sequence design and preparation method for a porcine reproductive and respiratory syndrome mRNA vaccine. The sequence design and preparation method for the mRNA vaccine provided by the present invention can prepare an available mRNA vaccine with strong humoral immunity and strong cellular immunity, has strong safety with no obvious side effects, and obvious antibodies and cytokines can be detected 30 days after two immunizations, indicating a long protection time. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Sequence diagrams of 5`-UTR and 3`-UTR for coupling with mRNA;

[0016] Figure 2 : Schematic diagram of the complete structure of GP5-mRNA;

[0017] Figure 3 : Structure prediction and spatial structure difference analysis diagrams of fusion protein candidate proteins;

[0018] Figure 4 : Schematic diagram of the complete structure of GP2-GP5-M-mRNA;

[0019] Figure 5 : Photographs of nucleic acid electrophoresis of samples taken after in vitro transcription of GP5-mRNA and GP2-GP5-M-mRNA;

[0020] Figure 6 : Measurement result diagrams of particle size and Zeta potential detected after encapsulating two mRNAs with lipid nanoparticles;

[0021] Figure 7 : Diagram of measuring the antibody titer of GP5 protein by indirect ELISA using mouse serum collected 28 days after immunization;

[0022] Figure 8 : Serum of mice collected 28 days after immunization, neutralization test results graph for PRRSV (TCID 50 = 10 -8.33 );

[0023] Figure 9 : Spleen cells of mice collected 28 days after immunization, flow cytometry of intracellular cytokine staining, graph for detecting the secretion of IL-4, IFN-γ and TNF-α. Specific embodiments

[0024] At both ends of the antigen protein coding sequence of the selected mRNA of the present invention, cap, 5'-UTR, 3'-UTR and Poly(A) are respectively connected. One specific sequence of 5'-UTR and 3'-UTR is as Figure 1 shown, but other commonly used sequences of cap, 5'-UTR, 3'-UTR and Poly(A) in the art can also be selected.

[0025] The present invention optimizes the gene sequence of the structural protein of porcine reproductive and respiratory syndrome virus according to murine codon bias, and then uses the optimized sequence as the CDS region of mRNA, and connects it to a plasmid vector together with other elements (cap, 5'-UTR, 3'-UTR and Poly(A)).

[0026] On the basis of determining the CDS region of the mRNA of a single protein, the present invention also optimizes the gene sequences of multiple structural proteins of porcine reproductive and respiratory syndrome virus according to murine codon bias. And uses a gene hinge sequence (such as GGCGCCGGCAGC) to connect each structural gene together, and uses AlphaFold 2 or other structure prediction software to predict the structure of the optimized gene sequences of the single protein and the fusion protein, and compares the differences in the spatial structures of each structural protein in the fusion protein and its single state, and excludes the structural proteins with a huge change in spatial structure after fusion, so as to avoid the reduction of the function of the structural protein expressed by mRNA due to the structural change.

[0027] After connecting the selected structural proteins with a gene hinge, they are synthesized and constructed into a plasmid vector together with elements such as cap and UTRs at both ends, and the correctly constructed mRNA is encapsulated with liposome nanoparticles (LNP).

[0028] To better understand the present invention, the content of the present invention will be further clarified below in conjunction with embodiments, but the content of the present invention is not limited to the following embodiments. The materials, reagents, etc. used in the embodiments and test examples of the present invention can be obtained from commercial channels without special instructions; the methods used in the embodiments and test examples of the present invention are all conventional methods without special instructions.

[0029] Example 1: Preparation of single and fusion porcine reproductive and respiratory syndrome virus mRNA vaccines

[0030] In this example, the PRRSV GP5 protein was selected as the CDS region of the mRNA vaccine, and its amino acid sequence is as follows:

[0031] MLGKCLTACCCSRLLFLWCIVPFYLTVPANASNNSSSHIQLIYNLTLCELNGTDWLAQKFDWAVETFVIFPVLTHIVSYGALTTSHFLDTVGLTIVSTAGYYHGRYILSSIYAVCALAALICFVIRLAKNCMSWRYSCTRYTNFLLDTKGRLYRWRSPVIVEKRGKVEVEGHLIDLKRVVLDGSAATPLTRVSAELWGRLDYKDDDDK (SEQ ID NO:1).

[0032] The nucleotide sequence of its encoding gene is as follows (SEQ ID NO:2):

[0033] ATGCTGGGCAAGTGCCTGACAGCCTGCTGCTGCAGCAGGCTGTTGTTCTTGTGGTGCATCGTCCCTTTCTACCTGACCGTGCCTGCCAACGCCTCCAACAATAGCAGCTCCCACATCCAGCTGATCTACAACCTGACCCTGTGCGAGCTGAACGGCACCGACTGGCTGGCCCAGAAGTTCGACTGGGCCGTGGAAACCTTCGTGATCTTCCCAGTGCTGACACACATTGTCAGCTACGGTGCCCTGACCACCAGCCACTTCCTGGACACAGTGGGGCTGACAATCGTCAGCACCGCTGGCTATTACCATGGCAGGTATATCCTGAGCAGCATCTACGCCGTGTGTGCTCTGGCCGCCCTGATCTGCTTCGTGATCAGGCTGGCCAAGAACTGCATGTCATGGCGTTACAGCTGCACCAGGTATACCAACTTTCTGCTCGACACCAAGGGCAGGTTGTACAGGTGGAGGAGCCCTGTTATTGTGGAGAAGAGGGGTAAGGTCGAGGTGGAGGGCCACCTGATCGACCTGAAGAGGGTGGTGCTGGACGGCAGCGCCGCCACCCCTCTGACCAGAGTGAGCGCCGAGCTCTGGGGCAGGCTGGACTACAAGGACGATGACGACAAG。

[0034] Then, the nucleic acid fragment ([ Figure 2 ]) constructed by combining the complete ORF sequence of GP5 with the selected 5'-UTR, 3'-UTR, sig (signal peptide sequence), and Poly(A) sequence Figure 2 ) was inserted into the expression plasmid, and its specific nucleotide sequence is as follows (SEQ ID NO: 3):

[0035]

[0036] The constructed nucleic acid fragment was inserted into an expression plasmid to construct a recombinant expression plasmid. First, the vector plasmid carrying the 5'-UTR, 3'-UTR, and polyadenylation signal after modification was digested with a single enzyme to linearize it. The AgeⅠ enzyme was used for digestion at 37 °C for 2 h. The GP5 gene carrying the homologous fragment of the vector plasmid was subjected to homologous recombination with the linearized vector under the catalysis of a homologous recombination enzyme. Positive clones were screened through an LB plate containing kanamycin, and then plasmid minipreps and sequencing were performed. Finally, the expression plasmid GP5-mRNA carrying the mRNA expression system was obtained.

[0037] On the basis of using the ORF of GP5 with the amino acid sequence of SEQ ID NO:1 as the CDS region of the mRNA vaccine, the ORF of GP5 was docked with four other structural proteins of PRRSV, and the influence of each structural protein on the overall spatial stability was judged according to the RMSD value. In this way, two structural proteins, GP3 and GP4, were preliminarily excluded as components of the tandem sequence mRNA vaccine. Subsequently, in the fusion analysis of GP2, GP5, and M proteins, it was found that all three structural proteins showed high spatial stability in fusion expression ( Figure 3 ).

[0038] The complete nucleotide sequences of GP2, GP5, and M proteins were linked with a GS linker. The sequences of GP2, GP5, and M proteins are as follows.

[0039] GP2 - Amino acid sequence (SEQ ID NO:4):

[0040] MKWGLCKASLTKLANFLWMLSRSFWCPLLISSYFWPFCLASQSPVGWWSFASDWFAPRYSVRALPFTLSNYRRSYEAFLSQCKVDIPTWGVKHPLGVLWHHKVSTLIDEMVSRRMYRVMEKAGQAAWKQVVSEATLSRISGLDVVAHFQHLAAIEAETCKYLASRLPMLHNLRLTGSNVTIVYNSTLDQVFAIFPTPGSRPRLHDFQQWLIAVHSSIFSSVAASCTLFVVLWLRVPIIRSVFGFRWLGATILLNSW;

[0041] GP2 - Nucleotide sequence (SEQ ID NO:5):

[0042] ATGAAGTGGGGCCTGTGCAAGGCCTCACTGACCAAGTTGGCCAACTTCCTGTGGATGCTGAGCAGGAGCTTCTGGTGCCCGCTCCTGATCAGCTCCTACTTCTGGCCTTTCTGCCTGGCCAGCCAGAGCCCAGTCGGCTGGTGGTCCTTCGCCAGCGACTGGTTCGCCCCCAGGTACAGCGTGAGGGCGCTGCCCTTTACACTGAGCAACTACAGGAGGAGCTACGAGGCCTTCCTGTCTCAGTGTAAGGTGGACATCCCTACCTGGGGCGTGAAGCACCCCCTGGGGGTGCTGTGGCACCACAAGGTGTCCACCCTGATCGACGAGATGGTCAGCAGGAGGATGTACAGGGTGATGGAGAAGGCCGGCCAGGCCGCCTGGAAGCAGGTGGTGTCTGAGGCCACCCTCAGCAGGATCTCCGGCCTCGACGTGGTGGCCCACTTCCAGCACCTGGCCGCCATCGAGGCCGAAACCTGCAAGTACCTGGCCTCCAGGCTGCCCATGCTCCACAACCTCAGGCTGACCGGCAGCAACGTGACCATCGTGTACAACAGCACGCTGGACCAGGTCTTCGCCATCTTCCCTACCCCTGGCAGCAGGCCCAGGCTCCACGACTTCCAGCA GTGGCTGATCGCCGTGCACAGCTCCATCTTCAGCAGCGTGGCAGCCAGCTGCACCCTGTTTGTGGTGCTCTGGCTGCGGGTGCCCATCATCAGAAGCGTGTTCGGCTTCAGATGGCTGGGCGCCACCATCCTGCTGAACAGCTGG;

[0043] M - amino acid sequence (SEQ ID NO:6):

[0044] MGSSLDDFCNDSTAPQKVLLAFSITYTPVMIYALKVSRGRLLGLLHLLIFLNCAFTFGYMTFVHFKSTNRVALTMGAVVALLWGVYSAIETWKFITSRCRLCLLGRKYILAPAHHVESAAGFHPIAANDNHAFVVRRPGSTTVNGTLVPGLKSLVLGGRKAVKQGVVNLVKYAK;

[0045] M - nucleotide sequence (SEQ ID NO:7):

[0046] ATGGGCAGCAGCCTGGACGACTTCTGTAACGACAGCACAGCACCTCAGAAGGTGCTGCTGGCCTTCTCCATCACCTACACCCCTGTGATGATCTACGCTCTGAAGGTGAGCAGGGGCAGGCTGCTGGGCCTGCTGCACCTGCTCATCTTCCTGAACTGTGCCTTCACCTTTGGGTACATGACCTTCGTGCACTTCAAGAGCACGAACAGGGTGGCTCTGACCATGGGTGCCGTGGTGGCTCTCCTGTGGGGCGTGTACAGCGCCATCGAAACCTGGAAGTTCATTACTTCCAGGTGCAGGCTGTGCCTGCTGGGCAGGAAGTACATCCTGGCTCCTGCCCACCACGTGGAGAGCGCTGCCGGCTTCCACCCTATCGCCGCGAATGACAACCATGCATTCGTGGTGAGGAGGCCTGGCAGCACCACCGTGAACGGCACCCTGGTGCCCGGGCTGAAGTCCCTGGTGCTGGGCGGCAGAAAGGCCGTGAAGCAGGGAGTGGTCAACTTGGTCAAGTACGCGAAG。

[0047] The complete fusion protein gene as the CDS region was co - constructed with the selected 5'-UTR, 3'-UTR, sig (signal peptide sequence), and Poly(A) sequence into an mRNA fragment with the nucleotide sequence SEQ ID NO:8 for transcriptional expression of the mRNA vaccine.

[0048]

[0049] Insert the fragment with the sequence of SEQ ID NO:8 ( Figure 4 ) into the expression plasmid to prepare the expression plasmid GP2 - GP5 - M - mRNA.

[0050] Use 3 μL of restriction endonuclease to linearize 10 μg of the constructed GP5 - mRNA and GP2 - GP5 - M - mRNA expression plasmids by single - enzyme digestion, and incubate at 37 °C for 2 h. Purify the linearized plasmids using the alkaline phenol - chloroform - isoamyl alcohol method.

[0051] Prepare the in vitro transcription system according to the mMESSAGE Kit instructions, and place it at 37 °C for transcription for 3 hours. Immediately add DNase after the reaction ends, and incubate at 37 °C for 15 minutes to remove the DNA template. Add enzyme - free and sterile water to the reaction system to dilute the total volume to 10 times the original, and measure the concentration. Purify the mRNA using the acidic phenol - chloroform - isoamyl alcohol method, and then examine the in vitro transcription results by nucleic acid electrophoresis ( Figure 5 ). Label the in vitro transcription products as GP5 - mRNA and GP2 - GP5 - M - mRNA respectively, aliquot them at 10 μg / tube, and store them at - 80 °C.

[0052] LNP encapsulation is crucial for the in - vivo delivery and exercise of the immune function of mRNA vaccines, and the results of LNP encapsulation also greatly affect the subsequent functions of mRNA vaccines. mRNA - LNP needs to meet requirements in terms of stability, homogeneity, charge, etc. Therefore, it is necessary to detect its particle size, Zeta potential, Polydispersity Index (PDI), encapsulation efficiency, and encapsulation concentration. As Figure 6 shown, the LNP encapsulation results of both GP5 - mRNA and GP2 - GP5 - M - mRNA meet the requirements (Table 1).

[0053] Table 1: Data table of the effects of LNP encapsulation

[0054]

[0055] Example 2: In - vivo delivery and immune function of mRNA vaccines

[0056] 1. The mouse test design scheme is shown in Table 2.

[0057] Table 2: Experimental scheme table for six mRNA vaccine experimental groups

[0058]

[0059] All experimental animals in this example were 4-week-old male BalB / C mice, and their body weights were controlled between 16-17 g during the primary immunization. All dose groups corresponded to this weight range.

[0060] Since there were not enough precedents to draw on, a relatively large range of doses for the mRNA vaccine was selected in this example, namely 5 μg / mouse to 15 μg / mouse. The positive control for the experiment was a live attenuated vaccine (TJM-F92 strain, a highly pathogenic porcine reproductive and respiratory syndrome virus strain). The packaging specification of the vaccine was 10 porcine doses per vial. In this example, one-tenth of the total dry weight of the vaccine powder was aseptically weighed and dissolved in 1 mL of PBS to be used as the immunization dosage for 10 mice. The negative control was sterile 1×PBS. The total injection volume for each mouse was 100 μL, so the mRNA vaccine needed to be diluted by different multiples.

[0061] For the primary immunization, the injection was performed on the lateral muscle of the right leg of the mouse, and for the secondary immunization, it was on the lateral muscle of the left leg. For subsequent peripheral blood collection, the submandibular vein bleeding method was used.

[0062] 2. Verification in mouse experiments

[0063] 1) Detection of specific antibody titer by indirect ELISA

[0064] The ELISA results showed that the specific antibody titers of the six mRNA vaccine dose groups and the positive control group were significantly higher than those of the negative control group. At the same time, the GP5-specific antibody titer induced by the GP5-mRNA 15 μg group was significantly higher than that of the positive control group, and the ability of the other groups to induce GP5-specific antibodies was also not lower than that of the positive control group.

[0065] Table 3: ELISA detection data of GP5-specific antibody titers

[0066]

[0067] 2) Neutralization experiment

[0068] The neutralization test can judge the ability of the mRNA vaccine to induce virus-neutralizing antibodies by observing the infection of sensitive cells after co-incubation of the serum of immunized mice with the virus. The Reed-Muench method was used to calculate the serum dilution multiples of the six mRNA vaccine groups and the positive control group that could protect 50% of the cell wells from developing lesions. This dilution multiple was the neutralizing antibody titer of this serum. The results showed that the six mRNA vaccine groups could exhibit obvious neutralizing ability. Among them, the GP5-mRNA-15 μg vaccine had the strongest ability to induce neutralizing antibodies, and its neutralizing efficacy was more stable than that of the commercial live attenuated vaccine.

[0069] 3) Detection of cytokine content in spleen T lymphocytes by ICS

[0070] In this experiment, mouse spleen lymphocytes were collected 28 days after immunization, and immunocyte surface markers were labeled and intracellular cytokines were stained to detect CD4 + T lymphocytes and CD8 + The proportion of cells expressing IFN-γ, TNF-α, and IL-4 in T lymphocytes was determined to judge the activation of mouse T lymphocytes after mRNA vaccination, and thus infer the activation effect of the mRNA vaccine on mouse cellular immunity.

[0071] Table 4: ICS detection data of cytokine expression in spleen T lymphocytes of immunized mice

[0072]

[0073] The results showed that in CD4 + T cells, the difference in TNF-α among different treatment groups was significant. The proportion of cells secreting TNF-α in the mRNA vaccine group and the positive control group was significantly higher than that in the negative control group, and at the same time, the GP5-mRNA 15 μg group was significantly higher than the positive control group; in CD8 + T cells, the GP5 mRNA 15 μg group showed good performance in the secretion of all three cytokines, IFN-γ, TNF-α, and IL-4, and also had a relatively significant advantage compared with the positive control group.

[0074] Another GP2-GP5-M-mRNA vaccine provided by the present invention showed lower immune efficacy than GP5-mRNA containing only a single protein CDS region. The reasons are as follows: (1) At the same vaccine dose, the GP2-GP5-M-mRNA vaccine may have relatively fewer effective T cell epitopes and B cell epitopes; (2) Although the fusion protein promoted the stability of its own structure, they may fold and cover important lymphocyte epitopes; (3) The presence of GP2 may prevent the formation of virus-like particles (VLPs), thereby reducing the ability of the fusion protein to induce an immune response. However, the GP2-GP5-M-mRNA vaccine developed by the present invention still showed effective immune efficacy.

[0075] In summary, the present invention has developed an effective and safe GP5-mRNA vaccine that can induce high levels of neutralizing antibodies and demonstrate significant activation of cellular immunity.

[0076] This study laid a solid foundation for the research of PRRS mRNA vaccines.

Claims

1. An mRNA vaccine, characterized in that: The nucleic acid sequence of the mRNA vaccine is SEQ ID NO:

3.

2. An mRNA vaccine, characterized in that: The nucleic acid sequence of the mRNA vaccine is SEQ ID NO:

8.

3. The mRNA vaccine according to claim 1 or 2, characterized in that The mRNA vaccine is encapsulated using LNP.

Images