Broad-spectrum novel coronavirus-resistant double-target polypeptide and application thereof

By designing a dual-target polypeptide that can target the novel coronavirus RBD and HR1 at the same time, the problem of difficult to effectively inhibit viral infection in the prior art is solved, broad-spectrum resistance to SARS-CoV-2 and its mutant strains is achieved, and the risk of drug resistance is reduced.

CN120098150AActive Publication Date: 2025-06-06ZJU HANGZHOU GLOBAL SCI & TECH INNOVATION CENT +1

Patent Information

Application Number
CN202510593361.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-09
Publication Date
2025-06-06
Estimated Expiration
2045-05-09

AI Technical Summary

Technical Problem

There is a lack of polypeptide drugs that can target both RBD and HR1 targets of the novel coronavirus at the same time, making it difficult to effectively inhibit the virus infection process and reduce the risk of virus resistance.

Method used

A dual-target polypeptide is designed, including RBD-targeting polypeptide R1 and HR1-targeting polypeptide HR2. It is connected through a flexible linker to form polypeptides such as R1L25HR2, which can act on the virus RBD and HR1 at the same time, and jointly inhibit viral infection.

Benefits of technology

This dual-target polypeptide significantly improves the inhibitory effect of SARS-CoV-2 and its mutant strains, has broad-spectrum anti-novel coronavirus activity, and reduces the risk of virus resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120098150A_ABST
    Figure CN120098150A_ABST
Patent Text Reader

Abstract

The invention discloses a broad-spectrum novel coronavirus-resistant double-target polypeptide and application thereof, and relates to the field of biological medicines. The polypeptide drug provided by the invention can more effectively and synergistically inhibit the infection process of the virus by simultaneously acting on two key targets of RBD and HR1 of the virus. On one hand, through targeting RBD, combination of viruses and host cells can be blocked, so that the phenomenon that the viruses are adsorbed on the surfaces of the host cells is blocked, and the adsorption process of the viruses is restrained; on the other hand, by targeting HR1, formation of virus 6-HB can be interfered, and the fusion process of a virus envelope and a host envelope is further inhibited. The polypeptide capable of simultaneously targeting the double targets RBD and HR1 of the novel coronavirus, particularly R1L25HR2, provided by the invention, can effectively inhibit SARS-CoV-2 and a mutant strain thereof, and has broad-spectrum activity for resisting the novel coronavirus.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and in particular to a dual-target polypeptide with a broad spectrum against the novel coronavirus and applications thereof. Background Art

[0002] The virus particles are spherical, and the spike structures arranged on the surface are composed of four structural proteins: Spike protein (S), Nucleocapsid protein (N), Membrane protein (M) and Envelope protein (E). Among them, the trimeric S glycoprotein directly determines the host range and infection efficiency through conformational dynamic equilibrium and molecular interaction mechanisms.

[0003] The coronavirus S protein plays an important role in the process of virus invasion of target cells. The S protein includes two functional subunits, S1 and S2. The receptor binding domain (RBD) of the S1 subunit is responsible for recognizing and binding to the receptor on the host cell, angiotensin-converting enzyme-2 (ACE2), triggering protease cleavage activation; subsequently, the S2 subunit undergoes a series of conformational changes, prompting the heptapeptide repeat sequence HR1 to form a trimeric coiled coil structure, exposing its hydrophobic pocket area, and then binding to HR2 to form a six-helix bundle (6-HB), ultimately driving the fusion of the virus with the host cell membrane. Therefore, the RBD and HR1 regions are ideal targets for the development of virus entry inhibitors.

[0004] However, during the evolution of coronaviruses, the spike protein RBD and N-terminal domain (NTD) also frequently mutate. These mutations not only enhance the virus's immune escape ability, allowing the virus to evade the attack of the host's immune system, but may also lead to changes in the virus's transmissibility and pathogenicity. Despite this, some hidden sites within the spike protein trimer are relatively conservative, that is, they remain unchanged in different mutant strains. These highly conserved sites provide potential targets for the development of antiviral drugs.

[0005] Therefore, the development of broad-spectrum antiviral drugs that can effectively deal with the virus and its mutants has become the key to the current prevention and treatment of infectious disease outbreaks. In the prior art, for example, the polypeptide disclosed in the patent application with publication number CN115925826A has a strong inhibitory effect on the original strain of the new coronavirus and multiple mutant strains; for example, the polypeptide disclosed in the patent application with publication number CN114437184A has a strong inhibitory effect on the original strain of the new coronavirus and multiple mutant strains.

[0006] However, peptide drugs that can simultaneously target both viral RBD and HR1 (heptapeptide repeat sequence 1) have not been reported. Summary of the invention

[0007] Based on the deficiencies in the prior art, the purpose of the present invention is to propose a dual-target polypeptide that can inhibit the new coronavirus. This polypeptide drug can more effectively and synergistically inhibit the virus infection process by acting on the two key targets of the virus, RBD and HR1, at the same time. On the one hand, by targeting RBD, the binding of the virus to the host cell can be blocked, thereby hindering the adsorption of the virus on the surface of the host cell and curbing its adsorption process; on the other hand, by targeting HR1, the formation of the virus 6-HB can be interfered with, further inhibiting the fusion process of the virus envelope and the host envelope. This dual-target design strategy not only improves the antiviral effect of the drug, but also helps to reduce the risk of the virus developing drug resistance.

[0008] In order to achieve the above-mentioned purpose, the specific technical scheme of the present invention is as follows: The present invention provides a broad-spectrum dual-target polypeptide against the new coronavirus, wherein the dual-target polypeptide comprises a polypeptide R1 targeting the new coronavirus RBD and a polypeptide HR2 targeting the new coronavirus HR1; the polypeptide R1 targeting the SARS-CoV-2 RBD consists of 12 amino acids, and the specific amino acid sequence is N-DVDVLIKYQFSF-C; the polypeptide HR2 targeting the SARS-CoV-2 HR1 consists of 46 amino acids, and the specific amino acid sequence is N-DVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQ-C, wherein N- represents the N-terminal direction, and C- represents the C-terminal direction.

[0009] Preferably, the polypeptide R1 and the polypeptide HR2 are connected via a linker; the linker is a flexible linker (GGGGS) n , n=3-10, and n is an integer.

[0010] Further preferably, in the embodiments of the present invention, n=3, 5 or 7 are selected as examples, and the three dual-target polypeptides are named R1L15HR2, R1L25HR2, and R1L35HR2, respectively. The inhibitory activities of R1L15HR2, R1L25HR2, and R1L35HR2 against SARS-CoV-2 are 158, 43, and 174 nM, respectively.

[0011] Most preferably, R1L25HR2 inhibits the IC of SARS-CoV-2 50 The activity of HR2 peptide was 78 nM, which was about 21 times that of HR2 peptide.

[0012] The present invention also provides a nucleic acid molecule encoding the dual-target polypeptide.

[0013] Preferably, the gene sequences of R1L15HR2, R1L25HR2 and R1L35HR2 are shown as SEQ ID NOs. 5-7, respectively.

[0014] The present invention also provides a recombinant vector comprising the nucleic acid molecule.

[0015] The present invention also provides a host cell comprising the recombinant vector.

[0016] The present invention also provides a method for preparing the polypeptide, which includes designing and synthesizing the coding gene of the dual-target polypeptide, constructing a recombinant expression vector of the dual-target polypeptide, transforming it into Escherichia coli for expanded culture and induced expression, and separating and purifying it.

[0017] The present invention also provides the use of the dual-target polypeptide, the nucleic acid molecule, the recombinant vector or the host cell in the preparation of a drug for preventing or treating a disease caused by coronavirus infection.

[0018] In the above application, the disease caused by the coronavirus infection is a respiratory system infection. The respiratory system infection can be a respiratory tract infection and / or a lung infection.

[0019] In the above application, the coronavirus is the original strain of the new coronavirus and / or a mutant strain of the new coronavirus; the mutant strain of the new coronavirus is D614G, Beta, Delta and / or Omicron series mutant strains.

[0020] In a specific embodiment of the present invention, the Omicron series variants include BA.1, XBB, BQ.1, BQ.1.1, BF7, BA4 / 5, BA.2, EG.5.1, BA.2.86, JN.1 and KP.2, but are not limited thereto.

[0021] The present invention also provides a pharmaceutical composition, which contains the dual-target polypeptide, the nucleic acid molecule, the recombinant vector or the host cell, and a pharmaceutically acceptable carrier.

[0022] Preferably, the pharmaceutical composition is in the form of a nasal spray formulation, an oral formulation, or a parenteral formulation; Further preferably, the oral preparation is selected from tablets, capsules, granules, suspensions and pills; Further preferably, the parenteral preparation is an injectable or bolus preparation; Preferably, the pharmaceutical composition is a vaccine composition.

[0023] Beneficial effects of the present invention: The polypeptide provided by the present invention can simultaneously target the dual targets of RBD and HR1 of the new coronavirus, especially R1L25HR2, which can effectively inhibit SARS-CoV-2 and its mutant strains and has a broad-spectrum activity against the new coronavirus. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Design of three bifunctional peptides, R1L15HR2, R1L25HR2, and R1L35HR2 (A) and their identification by SDS-PAGE (B) and immunoblotting (C); Figure 2 is the inhibitory activity of different peptides against SARS-CoV-2 pseudovirus; wherein A is the inhibitory activity of R1L15HR2, R1L25HR2, and R1L35HR2 against SARS-CoV-2 pseudovirus; B is the inhibitory activity of R1L25HR2, R1, HR2 peptides and a mixture of R1+HR2 against SARS-CoV-2; Figure 3 for the binding of R1L25HR2 to SARS-CoV-2 RBD and HR1; Figure 4 R1L25HR2 inhibits viral infection by acting on the virus rather than the target cells; Figure 5 R1L25HR2 inhibits the entry of SARS-CoV-2 into target cells; Figure 6 R1L25HR2 inhibits the process of SARS-CoV-2 adsorption to target cells; Figure 7 R1L25HR2 inhibits SARS-CoV-2 D614G S protein-mediated cell-cell fusion activity; Figure 8 is the inhibitory activity of R1L25HR2 against different mutant strains of SARS-CoV-2; AN represents the inhibitory activity of different mutant strains; Fig. 9 The effects of R1L25HR2 on target cell activity; A is the effect of R1L25HR2 on Caco-2 cell activity; B is the effect of R1L25HR2 on Calu-6 cell activity. DETAILED DESCRIPTION

[0025] Example 1

[0026] 1. Design of dual-target peptides The broad-spectrum anti-novel coronavirus dual-target peptide is composed of peptides targeting SARS-CoV-2 RBD and HR1. The specific amino acid sequence is as follows Figure 1As shown in A in FIG. 1 , the following polypeptide structures are sequentially composed from the N-terminus to the C-terminus: polypeptide R1 targeting RBD, a glycine- and serine-rich linker (GGGGS) n, and polypeptide HR2 targeting HR1. The linker may contain n tandem repeats of GGGGS, and n may be in the range of 3-10.

[0027] The present invention selected dual-target peptides R1L15HR2, R1L25HR2, and R1L35HR2 for subsequent experiments.

[0028] 2. Construction of recombinant vectors pET28a-R1L15HR2, pET28a-R1L25HR2 and pET28a-R1L35HR2 Design the following primers (underlined Nco I and XOt I restriction site): Nco I R1-L35 F:gaaggagatata CCATGG GCGATGTGGATGTGCTGATTAAATATCAGTTTAGCTTTGGCGGTGGCGGCAGTG, 6 HIS XOt I HR2m R:ggtggtggtg CTCGAG CTGTTCATATTTGCCCAG; Using the laboratory synthesized coding HR2 The plasmid pET28a-HR2 containing the gene (sequence shown in SEQ ID NO.4) was used as a template. R1 The sequence of the gene is shown in SEQ ID NO.3. The R1L15HR2, R1L25HR2 and R1L35HR2 gene fragments (sequences shown in SEQ ID NO.5-7) were amplified by PCR technology, and the above gene fragments were connected to Nco I / XOt The pET28a linear vector was obtained by double digestion with I to obtain the recombinant vectors pET28a-R1L15HR2, pET28a-R1L25HR2 and pET28a-R1L35HR2.

[0029] 3. Expression and purification of R1L15HR2, R1L25HR2 and R1L35HR2 The plasmids encoding R1L15HR2, R1L25HR2 and R1L35HR2 genes were transformed into Escherichia coli BL21 (DE3), and single clones were selected in LB medium and placed at 37 o C, and the OD 600Add 0.5 mM isopropyl-β-D-thiogalactoside (IPTG) and incubate at 37 o C for 5 h. The cells were collected by centrifugation at 1,2000 × g for 3 min, suspended in lysis buffer (10 mM imidazole containing 0.1% Triton), disrupted by ultrasound, and collected by centrifugation at 1,2000 × g for 10 min. The supernatant was mixed with Ni-NTA at 4 o C binding for 30 min, and then the impurities were washed with 20 mM, 30 mM, 50 mM and 100 mM imidazole, and finally the target protein was eluted with 250 mM imidazole. Finally, the purified protein was identified by SDS-PAGE and immunoblotting. The results are shown in Figure 1 B and Figure 1 As shown in C, the three polypeptides all migrated to positions close to the expected molecular weight of the band.

[0030] Example 2

[0031] 1. Preparation of SARS-CoV-2 pseudovirus 6.5 × 10 6 293T cells were plated in a 10 cm cell culture plate to a cell density of about 80% before transfection. Fresh culture medium was replaced 1 h before transfection, and transfection reagent (Transfection Reagentlipo2000, TR001) and plasmid pNL4-3.Luc.RE expressing Luciferase reporter gene and plasmid pcDNA3.1-SARS-CoV-2-S expressing SARS-CoV-2 S protein and its mutants (SARS-CoV-2 D614G, Beta, Delta, BA.1, XBB, BQ.1, BQ.1.1, BF7, BA4 / 5, BA.2, EG.5.1, BA.2.86, JN.1 and KP.2) were diluted with serum-free DMEM. The diluted transfection reagent was added dropwise to the diluted plasmid in a 1:1 system, gently mixed, and placed at room temperature for 20 min. The transfection working solution was added dropwise to the culture medium and placed at 37 o C 5% CO 2 Culture in an incubator. After 12 h of transfection, discard the culture medium and replace with fresh cell culture medium. After 48-72 h of transfection, collect the cell supernatant, centrifuge at 3000 × g for 10 min, aliquot, and store at -80 o CSave for later use.

[0032] 2. Pseudovirus inhibition test Caco-2 cells were plated at 10 4Cells were plated in a 96-well cell culture plate and cultured overnight to allow the cells to adhere to the wall and grow. R1L15HR2, R1L25HR2, R1L35HR2, HR2 and R1 polypeptides were diluted to the required concentrations for the experiment (R1L15HR2, R1L25HR2, R1L35HR2 starting concentrations of 3 μM, HR2 and R1 starting concentrations of 10 μM), and a 4-fold gradient dilution was performed. Positive (SARS-CoV-2 pseudovirus + Caco-2 cells) and negative (Caco-2 cells) control wells were set at the same time. SARS-CoV-2 pseudovirus was diluted from -80 o After dissolving and mixing, add the diluted peptide drug to the above and incubate at 37 o C incubator for 30 min. The mixture of peptide drug and SARS-CoV-2 pseudovirus was transferred to Caco-2 cells and incubated at 37 o C overnight. Discard the peptide drug and pseudovirus, add an equal volume of fresh cell culture medium, and continue to culture for two days. Detect the luciferase activity (in relative light unit, RLU) according to the method of the luciferase reporter gene detection kit, and calculate the IC of the peptide based on the result 50 The value was used to further evaluate the inhibitory effect of peptide drugs on viruses.

[0033] The results are as follows Figure 2 As shown in Figure A, the inhibitory activities of R1L15HR2, R1L25HR2 and R1L35HR2 against SARS-CoV-2 were 158, 43 and 174 nM, respectively. The inventors then compared the inhibitory activities of R1L25HR2, R1, HR2 polypeptides and R1+HR2 mixture against SARS-CoV-2. The results showed that the R1 polypeptide alone had no significant inhibitory activity, while the IC of R1L25HR2 against SARS-CoV-2 was 2.34, 2.72 and 2.91, respectively. 50 78 nM, which is about 21 times that of HR2 peptide ( Figure 2 The above results show that peptides R1 and HR2 are connected by a flexible linker (GGGGS). 5 Connection can significantly enhance its anti-SARS-CoV-2 activity.

[0034] 3. Biolayer interferometry (BLI) to detect affinity First, the R1L25HR2 peptide was biotinylated according to the instructions of EZ-Link NHS-PEG12-biotin at a molar ratio of 1:3 (peptide: biotin), and then the unreacted biotin was removed by ultrafiltration through a 3 kDa tube. The biotinylated R1L25HR2 peptide was diluted to 5 μg / ml using BLI buffer solution (PBS with 0.02% Tween20), and the peptides and proteins to be tested were detected at a 2-fold dilution. The data were curve fitted using ForteBio software, and k on , k off and K D And other related parameters are shown in Table 1.

[0035] Table 1

[0036] like Figure 3 As shown in Table 1, the affinity of R1L25HR2 to RBD and HR1 peptides is 5.02 nM and 0.85 nM, respectively. The results of this study showed that after the N-terminus of the HR2 peptide was fused with the R1 peptide, it could target the SARS-CoV-2 RBD and HR1 targets, respectively, thereby improving its inhibitory activity against SARS-CoV-2.

[0037] 4. Washout experiment Caco-2 cells were plated at 10 4 The cells were plated in a 96-well cell culture plate and cultured overnight to allow the cells to adhere to the wall and grow. The experiment was divided into three groups. In the first group, the R1L25HR2 peptide was combined with SARS-CoV-2 at 37 o C in a carbon dioxide incubator for 30 min, and then the peptide and virus mixture was added to Caco-2 cells at 37 o In the second group of experiments, R1L25HR2 peptide was incubated with Caco-2 cells at 37 o After incubation in a carbon dioxide incubator for 30 min at 37 °C, the R1L25HR2 polypeptide was washed off with serum-free DMEM, and then SARS-CoV-2 was added to Caco-2 cells. o In the third group of experiments, DMEM and SARS-CoV-2 were cultured at 37 o C in a carbon dioxide incubator for 30 min, and then the DMEM and virus mixture were added to Caco-2 cells at 37 oC overnight. On the second day, discard the culture supernatant and add an equal volume of fresh cell culture medium and continue culturing for two days. Detect the luciferase activity (in relative light unit, RLU) according to the method of the luciferase reporter gene detection kit, and calculate the inhibition effect of each group of experiments based on the results.

[0038] The results are as follows Figure 4 It showed that R1L25HR2 was first incubated with target cells, then R1L25HR2 was washed away and added to the cells to infect SARS-CoV-2. At this time, R1L25HR2 had no obvious inhibitory effect on SARS-CoV-2. However, after R1L25HR2 was incubated with SARS-CoV-2 and then infected with cells, it could significantly inhibit SARS-CoV-2 from infecting cells. This result showed that R1L25HR2 exerted its antiviral effect by acting on the virus.

[0039] 5. Time-of-addition experiment Caco-2 cells were plated at 10 4 The cells were plated in a 96-well cell culture plate and cultured overnight to allow the cells to adhere to the wall and grow. 1 μM R1L25HR2 peptide was added to Caco-2 cells and incubated at 37 o The cells were placed in a carbon dioxide incubator at 37 °C for 30 min, and then SARS-CoV-2 was used to infect Caco-2 cells. R1L25HR2 peptide was added 0, 1, 2, 4, 6, and 8 h after SARS-CoV-2 infection. o C in a carbon dioxide incubator overnight. The next day, discard the peptide drug and pseudovirus, add an equal volume of fresh cell culture medium, and continue to culture for two days. Detect the luciferase enzyme activity (relative light unit, RLU) according to the method of the luciferase reporter gene detection kit, and calculate the inhibitory effect of the peptide based on the result.

[0040] The drug addition time measurement experiment was used to clarify the specific process of R1L25HR2 acting on virus-infected target cells. Figure 5 The results showed that when the R1L25HR2 peptide was added 2 hours after SARS-CoV-2 infected the target cells, its inhibitory activity was reduced to 80%. When the R1L25HR2 peptide was added 6 hours after the virus infection, its inhibitory activity was only 40%. This result proves that R1L25HR2 acts in the early stage of the virus entering the target cells.

[0041] 6. Virus adsorption inhibition test Caco-2 cells were plated at 10 41 μM R1L25HR2 peptide was mixed with SARS-CoV-2 pseudovirus at 37 °C. o C for 30 min, and set up positive (SARS-CoV-2 pseudovirus + Caco-2 cells) and negative (Caco-2 cells) control wells. Rinse the cells with pre-cooled PBS, add the above samples to the cells, and incubate at 4 o C for 4 h. Discard the peptides and viruses, wash the cells twice with pre-cooled PBS, add 100 μl of complete culture medium, and incubate at 37 o C for 72 h. The luciferase activity (in relative light unit, RLU) was detected using a luciferase reporter gene assay kit to analyze the inhibitory effect of peptide drugs on virus adsorption to target cells.

[0042] The mixture of R1L25HR2 peptide and SARS-CoV-2 pseudovirus was o C was incubated with Caco-2 cells to allow SARS-CoV-2 pseudoviruses to bind to the cell surface, unbound SARS-CoV-2 pseudoviruses were washed away, and the cells were then transferred to 37 o C was further cultured. Figure 6 As shown, the fluorescence intensity of cells treated with R1L25HR2 polypeptide was significantly lower than that of cells not treated with polypeptide, indicating that R1L25HR2 can effectively block the process of virus adsorption to target cells.

[0043] 7. Cell-cell fusion inhibition assay Caco-2 target cells were cultured at 10 4 pcs / well in a 96-well plate, 37 o C overnight, and the effector cells expressing EGFP and SARS-CoV-2 D614G S protein (293T / EGFP / D614G effector cells) were cultured at 2×10 4 / well and different concentration gradients of the peptide inhibitor to be tested were incubated at 37 o After incubation at 37 o After culturing in a carbon dioxide incubator for 4-5 hours at 4 °C, check the cell fusion status under a fluorescence microscope. If the fusion is obvious, fix the cells with 4% paraformaldehyde. Finally, calculate the fusion inhibition activity of the detected polypeptide based on the fusion status of each well.

[0044] The fusion inhibitory activity of R1L25HR2 was evaluated using S protein-mediated cell-cell fusion assay. Figure 7The results showed that the R1 peptide had no obvious S protein-mediated cell-cell fusion inhibitory activity at 50 μM, while the R1L25HR2 and HR2 peptides were able to completely inhibit S protein-mediated cell-cell fusion at 3 μM and 10 μM, respectively.

[0045] 7. Mutant pseudovirus inhibition test The experimental steps were the same as those for the pseudovirus inhibition test. The R1L25HR2, HR2 and R1 polypeptides were used, and the mutant strains were the strains used in the preparation of the SARS-CoV-2 pseudovirus.

[0046] The inhibitory activity of the dual-target peptide R1L25HR2 was evaluated in a pseudovirus infection system with different mutant strains of SARS-CoV-2, such as Figure 8 A to Figure 8 The results of N in the assay showed that the R1 polypeptide had no significant inhibitory activity against the detected SARS-CoV-2 mutants, while R1L25HR2 and HR2 had inhibitory activity against SARS-CoV-2 mutants, among which R1L25HR2 had better inhibitory activity, with an IC of 0.05 for SARS-CoV-2 D614G, Beta, Delta and Omicron series mutants. 50 The IC values ​​of HR2 for inhibiting SARS-CoV-2 D614G, Beta, Delta and Omicron series mutants are between 5.3-253nM. 50 The range is between 0.3-5.2 μM. The above results show that R1L25HR2 has broad-spectrum activity against the new coronavirus.

[0047] 8. R1L25HR2 safety test The R1L25HR2, HR2 and R1 peptides were diluted 4-fold in a 96-well plate, 100 μl per well, and added to the target cells Caco-2 and Calu-6 cells at 37 o After culturing in a carbon dioxide incubator for 48 h, 5 μl of CCK-8 was added to each well and cultured for another 2 h. The OD 450 Cell viability was calculated based on the absorbance.

[0048] like Fig. 9 A to Fig. 9 As shown in Figure B, cells treated with different concentrations of R1L25HR2, R1, and HR2 showed no obvious cytotoxicity. When R1L25HR2 and HR2 were incubated with cells at a high concentration of 100 μM, the viability of both Calu-6 and Caco-2 cells was above 90%, which was higher than the IC50 of SARS-CoV-2. 50It is about 20 times higher, indicating that it has good safety in inhibiting SARS-CoV-2 at the cellular level.

Claims

1. A dual-target polypeptide with broad spectrum against novel coronavirus, characterized in that: The dual-target peptide includes a peptide R1 targeting the RBD of the novel coronavirus and a peptide HR2 targeting the HR1 of the novel coronavirus; The amino acid sequence of the polypeptide R1 is DVDVLIKYQFSF, and the amino acid sequence of the polypeptide HR2 is DVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQ.

2. The dual-target polypeptide with broad spectrum against novel coronavirus as claimed in claim 1, characterized in that: The polypeptide R1 and the polypeptide HR2 are connected via a linker; The linker is a flexible linker (GGGGS) n , n=3-10, and n is an integer.

3. The dual-target polypeptide with broad spectrum against novel coronavirus as claimed in claim 2, characterized in that: n=3, 5 or 7.

4. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the dual-target polypeptide according to any one of claims 1 to 3.

5. A recombinant vector, characterized in that: The recombinant vector comprises the nucleic acid molecule according to claim 4.

6. A host cell, characterized in that The host cell comprises the recombinant vector according to claim 5.

7. Use of the dual-target polypeptide according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, the recombinant vector according to claim 5, or the host cell according to claim 6 in the preparation of a drug for preventing or treating a disease caused by coronavirus infection.

8. The use according to claim 7, characterized in that The disease caused by the coronavirus infection is a respiratory system infection.

9. The use according to claim 7, characterized in that The coronavirus is the original strain of the new coronavirus and / or a variant strain of the new coronavirus; The novel coronavirus variant is at least one of D614G, Beta, Delta and Omicron.

10. A pharmaceutical composition, characterized in that The pharmaceutical composition contains the dual-target polypeptide according to any one of claims 1 to 3, the nucleic acid molecule according to claim 4, the recombinant vector according to claim 5 or the host cell according to claim 6, and a pharmaceutically acceptable carrier.

Citation Information

Patent Citations

  • Polypeptide for resisting novel coronavirus and application thereof

    CN114437184A

  • Polypeptide for resisting novel coronavirus and application thereof

    CN115925826A

  • Application of affinity peptide in preparation of anti-coronavirus drug

    CN112876540A

  • Coronal virus genetic engineering protein and use thereof

    CN1990502A

  • Fusion lipopeptide for inhibiting coronavirus

    WO2024213127A1

Cited By

  • Application of active ingredient for promoting formation of liquid-liquid phase separation agglutinate from Ikappa B kinase epsilon mediated by disorder region in Ikappa B kinase epsilon in preparation of anti-new coronavirus drug

    CN121401420A