A nucleic acid digital detection integrated chip based on vertical perforated membrane emulsification and application thereof

Abstract

This invention discloses an integrated digital nucleic acid detection chip based on vertically perforated membrane emulsification and its application. The chip's main structure consists of three layers: upper, middle, and lower. The upper layer is the main part, including a nucleic acid extraction and purification zone, a vertically perforated membrane emulsification droplet generation zone, and a digital isothermal amplification and detection zone. The chip uses a vertically perforated membrane to prepare uniformly sized microdroplets, reducing the requirements for chip manufacturing processes and improving the uniformity of microdroplet size. This reduces the complexity of subsequent image recognition and artificial intelligence algorithm development, improving the scientific rigor and accuracy of the detection results. In this chip, nucleic acid quantification uses absolute quantification, eliminating the need for plotting working curves and avoiding errors caused by standards. Furthermore, by integrating nucleic acid extraction, purification, amplification, and digital detection onto a single chip, it achieves integrated nucleic acid detection with a "sample in - result out" process.

Description

Technical Field

[0001] This invention relates to the field of nucleic acid digital detection technology, and more specifically, to an integrated chip for nucleic acid digital detection based on vertically perforated membrane emulsification and its application. Background Technology

[0002] Nucleic acid testing is an important molecular diagnostic technology widely used in microbial identification, disease diagnosis, food safety testing, and environmental monitoring. It plays a crucial role in the prevention and control of infectious diseases, avoiding food safety issues, and protecting the ecological environment. Currently, many methods have been developed for detecting trace amounts of nucleic acids from complex media. Among them, polymerase chain reaction (PCR) is the first and most widely used technique for amplifying and detecting low-abundance nucleic acids, and is considered the gold standard for nucleic acid testing. However, PCR testing often requires large and expensive thermal cyclers and specialized operators, which limits its application in resource-constrained environments and regions.

[0003] To overcome the aforementioned problems, integrated nucleic acid detection chips have emerged. These chips integrate the entire nucleic acid detection process onto a single chip. Compared to traditional methods, integrated chips offer advantages such as portability and ease of operation by non-professionals, making them more suitable for rapid on-site nucleic acid testing and real-time results. This facilitates wider adoption in resource-limited areas and improves healthcare in underdeveloped regions. Furthermore, digital quantitative PCR for nucleic acids, due to its absolute quantification without the need for standards and high sensitivity, is widely used in integrated nucleic acid detection chips. However, to achieve truly real-time nucleic acid testing, existing digital nucleic acid detection chips still have some areas for improvement: 1. In integrated digital quantitative PCR chips, the prepared microdroplets are not uniform in size. Most integrated digital nucleic acid detection chips require the design of complex and delicate microchannels, which increases the difficulty and cost of chip manufacturing. A strategy of segmenting aqueous solutions into microdroplets through membrane emulsification can avoid the use of chips with high requirements for channel design, reducing the difficulty and cost of chip manufacturing. However, existing strategies for preparing microdroplets using membrane emulsification for nucleic acid digital detection often suffer from problems such as uneven microdroplet uniformity and significant size variations. This not only increases the difficulty of subsequent digital detection and image recognition but also reduces the scientific rigor and accuracy of experimental results. 2. Low chip integration. Most nucleic acid detection chips only achieve partial integration, integrating only all or a few steps of the nucleic acid detection process into the chip. For example, only integrating reagent mixing, microdroplet preparation, and heating amplification steps for nucleic acid digital quantitative detection, or integrating nucleic acid amplification with the detection step, cannot achieve a complete "sample in - result out" process. Therefore, to address the above problems, there is an urgent need to develop nucleic acid digital detection chips that can prepare uniformly sized microdroplets and have a high degree of integration. Summary of the Invention

[0004] The purpose of this invention is to overcome the problems of uneven microdroplet size, difficulty in achieving absolute quantitative detection, and low integration in the preparation of nucleic acid digital detection chips in the prior art, and to provide an integrated nucleic acid digital detection chip based on vertical perforated membrane emulsification.

[0005] A second objective of this invention is to provide the application of the aforementioned integrated nucleic acid digital detection chip.

[0006] The above-mentioned objective of this invention is achieved through the following technical solution:

[0007] This invention first provides an integrated digital nucleic acid detection chip based on vertically perforated membrane emulsification. The chip's main structure consists of three layers: upper, middle, and lower. The upper layer includes a nucleic acid extraction and purification zone, a vertically perforated membrane emulsion droplet generation zone, and a digital isothermal amplification detection zone, all three zones being sequentially connected by a through channel. The nucleic acid extraction and purification zone includes interdigitated electrodes and a nucleic acid purification membrane. The vertically perforated membrane emulsion droplet generation zone has a vertically perforated membrane in the middle, dividing the zone into upper and lower layers. The upper layer contains lyophilized isothermal amplification reagents, and the lower layer has an oil phase inlet for introducing a continuous oil phase to disperse and stably generate uniformly sized microdroplets. The middle layer is the substrate. The lower layer is a heating electrode located below the digital isothermal amplification detection zone and connected to a power supply via wires to provide a constant temperature for nucleic acid amplification.

[0008] This invention utilizes a vertically perforated membrane in the droplet generation region, with a continuous oil phase introduced through the lower oil phase inlet, to emulsify a mixed solution of a nucleic acid amplification system, thereby preparing and dispersing uniformly sized microdroplets. The vertically perforated membrane has a certain thickness and uniform pore size and spacing, maximizing the uniformity of the prepared droplet size. This reduces the complexity of subsequent image recognition and artificial intelligence algorithm development, improving the scientific rigor and accuracy of the detection results. Furthermore, this vertically perforated membrane is applied to an integrated nucleic acid detection chip, constructing a chip that integrates nucleic acid extraction, purification, isothermal amplification, and digital quantitative detection, achieving "sample in - result out" nucleic acid detection.

[0009] The target of this invention is microorganisms with cellular structures. The detection principle is as follows: the target substance is irreversibly electroporated in the nucleic acid extraction and purification zone to lyse it and release its internal nucleic acid. The released nucleic acid is separated from other impurities by a nucleic acid purification membrane to obtain a purified nucleic acid solution. The purified nucleic acid solution is mixed with lyophilized isothermal amplification reagent in the vertically perforated membrane emulsion droplet generation zone. The nucleic acid amplification system mixture is further passed through a vertically perforated membrane with a large number of micropores of the same size and spacing. The shear force of the pores and the continuous oil phase introduced break and disperse the reaction system solution to generate uniform monodisperse microdroplets. Each microdroplet can be regarded as a small nucleic acid amplification reaction chamber. The generated uniform microdroplets are then subjected to isothermal amplification of nucleic acid in the isothermal amplification zone under the heating of the heating electrode. Microdroplets containing the target nucleic acid generate a large amount of double-stranded DNA and produce a fluorescent signal, while those without the target nucleic acid do not. Finally, the chip is placed in a digital detection device for fluorescence image acquisition and processing. Artificial intelligence is used to identify, screen, read and calculate the microdroplets, intelligently analyze and output the detection results, thereby realizing the detection of microorganisms.

[0010] Furthermore, the nucleic acid extraction and purification zone is provided with an inlet port at the top, and the digital isothermal amplification and detection zone is also provided with an oil phase outlet.

[0011] Furthermore, the upper layer of the chip is made of a transparent material.

[0012] Furthermore, the upper layer of the chip is a PDMS chip.

[0013] Furthermore, the middle layer of the chip is a glass substrate.

[0014] Furthermore, the electrode material of the interdigitated electrode is a conductive material such as graphene or gold.

[0015] Preferably, the interdigitated portions of the interdigitated electrodes are arranged in a periodic staggered pattern, with 5 to 50 pairs of interdigitated fingers.

[0016] Furthermore, the nucleic acid purification membrane is a membrane that allows only nucleic acids to pass through, has low adsorption of nucleic acids, and can retain membrane fragments or impurities such as proteins.

[0017] Furthermore, the vertically perforated membrane has a columnar structure with a membrane height greater than or equal to 1 mm.

[0018] Furthermore, the vertically perforated membrane has multiple micropores that are perpendicular to the horizontal plane of the vertically perforated membrane, are of the same size, and are evenly distributed.

[0019] Furthermore, the micropore diameter is 10–30 μm, and the micropore spacing of the vertically perforated membrane is greater than 100 μm.

[0020] Furthermore, the isothermal amplification reagent is a lyophilized particle of a reagent mixture required for loop-mediated nucleic acid isothermal amplification, rolling circle amplification, or other isothermal amplification systems.

[0021] Furthermore, the electrode material of the heating electrode is a material with electrothermal conversion performance and good thermal stability, such as graphene or carbon nanotubes, and the surface area of ​​the heating electrode is larger than and covers the digital isothermal amplification detection area.

[0022] This invention also provides a nucleic acid extraction and digital detection device, the device comprising any of the aforementioned integrated nucleic acid digital detection chip and a matching digital detection component, the digital detection component comprising a light source, a convex lens, a filter, and a detector; the light source is arranged in a ring within the device, at the same horizontal plane as the digital isothermal amplification detection area, and is used to excite uniform microdroplets in the mixed system to emit fluorescence signals; the convex lens is positioned directly above the digital isothermal amplification detection area, and is used to magnify the image of the uniform microdroplets in the isothermal amplification detection area to provide clearer fluorescence image results; the filter is positioned directly above the convex lens, and is used to filter light emitted by the sample solution in wavelengths other than the fluorescence wavelength; the detector is positioned directly above the filter, and is used to acquire and process the image after the nucleic acid amplification reaction.

[0023] Preferably, the light source is an LED lamp.

[0024] Preferably, the digital detection component should be placed in a dark environment.

[0025] Preferably, the digital detection component is placed in a small dark box.

[0026] This invention also provides a detection method for any of the above-described nucleic acid digital detection integrated chips, comprising the following steps:

[0027] S1. Disperse the sample solution to be tested in lysis buffer to obtain the test solution;

[0028] S2. The test solution obtained in S1 is injected into the nucleic acid extraction and purification zone through the injection port. The DC power supply is turned on to apply voltage to the interdigitated electrodes to lyse the cells and obtain the test nucleic acid solution. The test nucleic acid solution passes through the nucleic acid purification membrane and enters the upper layer of the vertical perforated membrane emulsion droplet generation zone to obtain a mixed solution of the nucleic acid amplification system.

[0029] S3. Simultaneously, an oil phase mixed solution is introduced into the oil phase inlet of the lower layer of the vertically perforated membrane emulsion droplet generation zone;

[0030] S4. After the nucleic acid amplification system mixture obtained in S2 is completely emulsified into uniform microdroplets through the vertically perforated membrane and transferred to the isothermal amplification detection area, a certain voltage is applied to the heating electrode to heat and carry out the digital isothermal amplification reaction.

[0031] S5. After the amplification reaction is complete, place the chip in a digital detection device for detection.

[0032] Preferably, the sample to be tested in step S1 is a simple sample type, such as saliva, urine, dairy products, lake water, etc.

[0033] Preferably, the lysis buffer described in step S1 is a solution that helps to open cells. Lysis buffers are typically used to assist in the extraction of DNA or protein from cells for analysis. There are many types of cell lysis buffers, among which Tris-HCl buffer and EDTA are common. Tris-HCl maintains the optimal pH value of the cell lysis buffer and is mainly used as the main component of the lysis buffer; EDTA helps to reduce the activity level of proteases or DNases.

[0034] More preferably, the lysis buffer is an aqueous solution containing 5–15 mM Tris-HCl and 0.5–2 mmol / L EDTA.

[0035] Preferably, the operating voltage of the DC power supply in step S2 is 5 to 30V.

[0036] Preferably, in step S2, the test solution is injected into the nucleic acid extraction and purification area through the injection port using a syringe or injection pump at a certain rate.

[0037] More preferably, the rate is 0.4 to 6.0 mL / min.

[0038] Preferably, the introduction of the oil phase mixture in step S3 is performed by injecting it at a certain rate using a syringe or injection pump.

[0039] More preferably, the rate is between 0.04 and 0.60 mL / min.

[0040] This invention provides the application of any of the above-described integrated chips in the simultaneous detection of multiple pathogenic microorganisms with cell membrane structures.

[0041] The present invention also provides the application of any of the above-described integrated chips in the preparation of disease diagnosis and food safety testing products.

[0042] Compared with the prior art, the present invention has the following beneficial effects:

[0043] (1) This invention utilizes a vertically perforated membrane in the emulsification droplet generation region and an oil phase introduced into the lower layer to prepare dispersed microdroplets of uniform size for integrated digital quantitative detection of nucleic acids. This chip uses a vertically perforated membrane to emulsify and prepare microdroplets, which reduces the requirements for chip manufacturing processes while improving the uniformity of microdroplet size. This reduces the complexity of subsequent image recognition and artificial intelligence algorithm development, and improves the scientific validity and accuracy of the detection results. In this chip, nucleic acid quantitative detection uses absolute quantification, eliminating the need to plot working curves for quantitative detection of the target analyte, thus avoiding errors in experimental results caused by standards.

[0044] (2) This invention integrates nucleic acid extraction, purification, amplification, and digital detection onto a single chip, achieving integrated nucleic acid detection from "sample in" to "result out." This not only helps reduce the risk of infection for testing personnel but also simplifies the operation steps of nucleic acid testing, lowers the threshold and skill requirements for operators, and facilitates rapid on-site nucleic acid testing and self-testing, which is of great significance for improving the level of regional medical care. In addition, the chip can have multiple parallel channels, enabling the simultaneous detection of multiple indicators and improving detection efficiency. Attached Figure Description

[0045] Figure 1 This is a schematic diagram of an integrated chip structure for nucleic acid digital detection based on vertically perforated membrane emulsification.

[0046] Figure 2 A schematic diagram of a digital testing device for an integrated chip.

[0047] Figure 3 This is a schematic diagram of the droplet generation region of the vertically perforated membrane in an integrated chip.

[0048] Figure 4 This is a schematic diagram of the vertically perforated membrane in the emulsion droplet generation region.

[0049] Figure caption: 1-Nucleic acid extraction and purification area, 2-Vertical perforated membrane emulsion droplet generation area, 3-Isothermal amplification digital detection area, 4-Interdigital electrode (black area is the conductive material of the interdigital electrode), 5-Sample inlet, 6-Nucleic acid purification membrane, 7-Vertical perforated membrane, 8-Lyophilized isothermal amplification reagent, 9-Oil phase inlet, 10-Oil phase outlet, 11-Substrate, 12-Heating electrode, 13-Light source, 14-Convex lens, 15-Filter, 16-Detector. Detailed Implementation

[0050] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0051] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0052] Example 1

[0053] A novel integrated chip structure for nucleic acid digital detection based on vertically perforated membrane emulsification, as shown below. Figure 1 As shown, the chip's main structure consists of three layers: an upper PDMS chip, a middle glass substrate, and a lower heating electrode. The upper layer comprises a nucleic acid extraction and purification zone 1, a vertically perforated membrane emulsion droplet generation zone 2, and a digital isothermal amplification and detection zone 3, all connected sequentially. The nucleic acid extraction and purification zone 1 is equipped with interdigitated electrodes 4, and is separated from the vertically perforated membrane emulsion droplet generation zone 2 by a nucleic acid purification membrane 6. A vertically perforated membrane 7 divides the vertically perforated membrane emulsion droplet generation zone 2 into upper and lower layers. The upper layer contains lyophilized isothermal amplification reagent 8, while the lower layer connects to the nucleic acid purification membrane digital isothermal amplification and detection zone 3 and has an oil phase inlet 9 to introduce a continuous oil phase for dispersing and stabilizing the generation of uniformly sized microdroplets. The middle layer is the substrate 11. The lower layer is the heating electrode 12, located below the digital isothermal amplification and detection zone 3 and connected to a power supply via wires to provide a constant temperature for nucleic acid amplification. In addition, the top of the nucleic acid extraction and purification zone 1 is provided with an inlet 5, the bottom of the isothermal amplification digital detection zone 3 is provided with an oil phase outlet 10 for discharging excess oil phase reagents, the bottom of the isothermal amplification digital detection zone 3 is a substrate 11, and the bottom of the substrate 11 is a heating electrode 12; the surface area of ​​the heating electrode 12 is larger than and covers the digital isothermal amplification detection zone 3.

[0054] like Figure 2 As shown, the present invention provides a nucleic acid extraction and digital detection device including the aforementioned integrated chip and a matching digital detection component. The digital detection component includes a light source 13, a convex lens 14, a filter 15, and a detector 16. The light source 13 is arranged in a ring around the integrated nucleic acid digital detection chip and is on the same horizontal plane as the digital isothermal amplification detection area 3, used to excite uniform microdroplets in the mixed system to emit fluorescence signals. The convex lens 14 is placed directly above the digital isothermal amplification detection area 3, used to magnify the image of uniform microdroplets in the isothermal amplification detection area to provide clearer fluorescence image results. The filter 15 is placed directly above the convex lens 14, used to filter light in wavelengths other than the fluorescence wavelength emitted by the sample solution. The detector 16 is placed directly above the filter 15, used to acquire and process the image after the nucleic acid amplification reaction. The light source is an LED lamp.

[0055] A schematic diagram of the droplet generation process in the vertically perforated membrane emulsion droplet generation region of an integrated chip is shown below. Figure 3 As shown, the structure of the vertically perforated membrane is as follows: Figure 4 As shown.

[0056] The integrated nucleic acid digital detection chip based on vertically perforated membrane emulsification can contain multiple parallel detection channels.

[0057] The interdigitated electrodes have interlaced interdigitated portions, with 5 to 50 pairs of interdigitated fingers.

[0058] The operating voltage of the DC power supply is 5–30V.

[0059] The height of the vertically perforated membrane is not less than 1 mm (preferably 1 mm).

[0060] The vertically perforated membrane has a pore size of 12–30 μm (preferably 20 μm).

[0061] The spacing between the micropores of the vertically perforated membrane is greater than 100 μm (preferably 100 μm).

[0062] The lyophilized isothermal amplification reagent generally contains primers, DNA polymerase, fluorescent dye, and amplification buffer.

[0063] The DNA polymerase is a strand displacement DNA polymerase; the amplification buffer contains conventional dNTPs, Tris-HCl, (NH4)2SO4, KCl, MgSO4, Tween 20, etc.; the fluorescent dye includes, but is not limited to, LAMP fluorescent dyes and EvaGreen.

[0064] The oil phase reagent is a mixed solution of surfactant and oil, including but not limited to a mixture of EM 90 and mineral oil, or Tween 80 and sunflower seed oil.

[0065] The heating electrode materials include, but are not limited to, graphene and carbon nanotubes.

[0066] The accompanying digital detection device should be placed in a dark environment.

[0067] The LED light should be compatible with the excitation wavelength of the fluorescent dye in the nucleic acid amplification system.

[0068] Example 2

[0069] Using the nucleic acid extraction and digital detection device composed of the integrated chip for digital detection based on vertically perforated membrane emulsification and its supporting digital detection device as described in Example 1, digital LAMP detection of common oral pathogens such as Helicobacter pylori, Candida albicans, and Staphylococcus aureus is performed, including the following steps:

[0070] S1. The collected biological sample (saliva) solution is centrifuged and washed three times, and the precipitate is resuspended in lysis buffer. The buffer is an aqueous solution containing 10 mM Tris-HCl and 1 mmol / L EDTA, with a pH of 8.0.

[0071] S2. The oil phase reagent is injected into the lower layer of the vertical perforated membrane emulsion droplet generation zone 2 at a certain flow rate using a syringe pump, so that the oil phase reagent is immersed in the vertical perforated membrane 7. Excess oil phase reagent is discharged from the oil phase outlet 10. The flow rate of the syringe pump is adjusted according to the required microdroplet diameter. When the microdroplet diameter is 20μm, the flow rate is set to 0.05mL / min. The components of the oil phase mixed reagent include: 85% mineral oil and 15% EM 90.

[0072] S3. Load the washed test solution into the syringe pump, turn on the power switch, and slowly push the syringe pump. After the test solution flows through the nucleic acid extraction and purification zone 1, the microbial cell membrane is lysed, and the internal nucleic acid is released. After purification by the nucleic acid purification membrane, it enters the vertical perforated membrane emulsion droplet generation zone 2. The DC power supply operates at 20V, and the flow rate of the syringe pump is set according to the time it takes for the bacteria to flow through the interdigitated electrodes, with the flow rate set to 0.5mL / min.

[0073] S4. When the solution containing free nucleic acid flows into the upper layer of the vertically perforated membrane emulsion droplet generation zone 2, it dissolves the lyophilized LAMP amplification reagent mixture. Then, it passes through the vertically perforated membrane 7 with a certain pore size and uniform size, forming monodisperse microdroplets with basically uniform diameter in the lower layer of the vertically perforated membrane emulsion droplet generation zone 2. The formed monodisperse liquid is carried into the isothermal amplification digital detection zone 3 by the oil phase reagent with a certain flow rate.

[0074] The lyophilized LAMP amplification reagent mixture includes: commercially available WarmStart LAMP 2X premix, commercially available LAMP fluorescent dye (50X), and 6 primers (FIP, BIP, LF, LB, F3, B3).

[0075] The deoxynucleotide sequences of the six primers (targets: Helicobacter pylori HP, Candida albicans CA, and Staphylococcus aureus SA) and their final concentrations in the LAMP amplification reaction are shown below:

[0076] HP-ureC-1-F3: 5'-CACAAACTTATCCCCAATCG-3', final concentration 0.2μM;

[0077] HP-ureC-1-B3: 5'-GATGCTGACAGGCTAGTG-3', final concentration 0.2 μM;

[0078] HP-ureC-1-FIP: 5'-GTCGCCACAAACATGAGCAATTTACGCAATGCTTCA ATTCCAAAT-3', final concentration 1.6μM;

[0079] HP-ureC-1-BIP: 5'-GCTTGAGAAGAAAGGGCGTTTAGGGAATATCGTGCA TGG-3', final concentration 1.6 μM;

[0080] HP-ureC-1-LF: 5'-GCCCTTAAAGAATATTTAAAATCCC-3', final concentration 0.8 μM;

[0081] HP-ureC-1-LB: 5'-CCTAACACCCCTAAAAGCT-3', final concentration 0.8 μM;

[0082] CA-25s-F3-1: 5'-AGCGGAGGAAAAGAAACCAA-3', final concentration 0.2 μM;

[0083] CA-25s-B3-1: 5'-GGTCATCTCATCGCACGG-3', final concentration 0.2 μM;

[0084] CA-25s-FIP-1: 5'-GGACGCCAAAGACGCCAGATTTCAGGGATTGCCTCA GTAGC-3', final concentration 1.6 μM;

[0085] CA-25s-BIP-1: 5'-AAGAAGGTATCTTTGGGCCCGGTTCTCACCCTCTGTG ACGT-3', final concentration 1.6 μM;

[0086] CA-25s-LF-1: 5'-GCTTTTGCCGCTTCACTCG-3', final concentration 0.8 μM;

[0087] CA-25s-LB-1: 5'-CTTGTCTATGTTCCTTGGAACAGG-3', final concentration 0.8 μM;

[0088] SA-F3-1: 5'-TGGTGATACAGTAAATGACATTG-3', final concentration 0.2μM;

[0089] SA-B3-1: 5'-AGTTGTACCGATGAATGGATT-3', final concentration 0.2 μM;

[0090] SA-FIP-1: 5'-CTTGACCAGGTTTGATCATGTTTTTCAAAAGCAAACGGCA CTAC-3', final concentration 1.6 μM;

[0091] SA-BIP-1: 5'-ACTTGTTGTTGATAAGAAGCAACCACACCAGTTTCTGGT AATGC-3', final concentration 1.6 μM;

[0092] SA-LF-1: 5'-TGCAGCAATTTTGTCAGCA-3', final concentration 0.8 μM;

[0093] SA-LB-1: 5'-GCAAACCATGCAGATGCTAA-3', final concentration 0.8 μM.

[0094] S5. When the solution containing free nucleic acid is completely emulsified by the membrane to form uniformly sized monodisperse droplets that enter the isothermal amplification digital detection area 3, connect the heating electrode to a DC power supply, raise the temperature of the heating electrode to 65°C, and maintain constant heating for 9 minutes to perform LAMP isothermal amplification.

[0095] S6. After amplification is complete, place the integrated chip in the matching digital detection device and turn on the LED light. Use the detector to collect images in the isothermal amplification digital detection area 3.

[0096] The LED light has a wavelength of 480nm, and the filter can filter light with wavelengths below 500nm.

[0097] S7. The acquired images are identified by an artificial intelligence system to determine whether the image boundaries are circular or slightly elliptical. Images with a diameter in the range of 20±1.0μm are selected as valid results for interpretation. In the RGB channel, green fluorescent pixels with more than 128 are assigned as 1, and those with less than 128 are assigned as 0. The results are statistically analyzed and calculated using the Poisson distribution principle to complete the final digital detection.

[0098] Example 3

[0099] This embodiment provides an integrated chip for digital detection of nucleic acids based on vertically perforated membrane emulsification and its supporting digital detection device, which should be basically the same as that in Embodiment 1. The lyophilized isothermal amplification reagent 8 in the vertically perforated membrane emulsification droplet generation area 3 is an RCA reagent mixture.

[0100] The integrated chip is used for the detection of Staphylococcus aureus, Salmonella, and other bacteria in the hygiene and safety testing of dairy products, and includes the following steps:

[0101] S1. The collected biological sample (fresh milk) solution was centrifuged and washed three times, and the precipitate was resuspended in lysis buffer. The buffer was an aqueous solution containing 10 mM Tris-HCl and 1 mmol / L EDTA, with a pH of 8.0.

[0102] S2. The oil phase reagent is injected into the lower layer of the vertical perforated membrane emulsion droplet generation zone 2 at a certain flow rate using an injection pump, so that the oil phase reagent is immersed in the vertical perforated membrane 7. Excess oil phase reagent is discharged from the oil phase outlet 10. The flow rate of the injection pump is adjusted according to the required microdroplet diameter. When the microdroplet diameter is 20μm, the flow rate is set to 0.05mL / min.

[0103] The components of the right-phase mixed reagent include 98% sunflower seed oil and 2% Tween 80.

[0104] S3. Load the washed test solution into the syringe pump, turn on the power switch, and slowly push the syringe pump. After the test solution flows through the nucleic acid extraction and purification zone 1, the microbial cell membrane is lysed, and the internal nucleic acid is released. After being purified by the nucleic acid purification membrane, it enters the vertically perforated membrane emulsion droplet generation zone 2. The DC power supply operates at 20V, and the flow rate of the syringe pump is set according to the time it takes for the bacteria to flow through the interdigitated electrodes, and the flow rate is set to 0.5mL / min.

[0105] S4. When the solution containing free nucleic acid flows into the upper layer of the vertically perforated membrane emulsion droplet generation zone 2, it dissolves the lyophilized RCA amplification reagent mixture. Then, it passes through the vertically perforated membrane 7 with a certain pore size and uniform size, forming monodisperse microdroplets with basically uniform diameter in the lower layer of the vertically perforated membrane emulsion droplet generation zone 2. The formed monodisperse liquid is carried into the isothermal amplification digital detection zone 3 by the oil phase reagent with a certain flow rate.

[0106] The lyophilized RCA amplification reagent mixture includes: Phi29 DNA polymerase, T4 DNA ligase, padlock probe, deoxynucleotides (dNTPs), EvaGreen fluorescent dye, potassium chloride (KCl), bovine serum albumin (BSA), etc.

[0107] The deoxynucleotide sequences of the padlock probes (targeting Staphylococcus aureus, Salmonella, and Listeria) and their final concentrations in the RCA amplification reaction are shown below:

[0108] SA-16s-pp:5'-AGCAAGCTTCTCGTCCGTTCGCTCTGCACCACCAATAGT CTTCAGTTCACATCAAATGCCAATAACGCTAACATCAGAGA-3', with a final concentration of 100nM;

[0109] SE-pp:5'-CGTCAATTGCTGCGGTTAAGAGCGCATGAATCCGTAGTAACT TGACTTCAGCACGCGTGAGGTCGGTACACTCTGCTTCTTCTGCGGGTAA-3', the final concentration is 100nM;

[0110] LM-Hly-pp:5'-GCGTCTTAGGACTTGCAGGCGGGATTAGGTTACTGCGA TTAGCACAAGCACCAAGAGCAACTACACGAATTCCTGTTTCTTTTCGATTG-3', final concentration is 100nM.

[0111] S5. When the solution containing free nucleic acid is completely emulsified by the vertically perforated membrane to form uniformly sized monodisperse droplets that enter the isothermal amplification digital detection area 3, connect the heating electrode to a DC power supply, raise the temperature of the heating electrode to 37°C, and maintain constant heating for 30 minutes to perform RCA isothermal amplification.

[0112] S6. After amplification is complete, place the integrated chip in the matching digital detection device and turn on the LED light. Use the detector to collect images in the isothermal amplification digital detection area 3.

[0113] The LED light has a wavelength of 500nm, and the filter can filter light with wavelengths below 520nm.

[0114] S7. The acquired images are identified by an artificial intelligence system to determine whether the image boundaries are circular or slightly elliptical. Images with a diameter in the range of 20±1.0μm are selected as valid results for interpretation. In the RGB channel, green fluorescent pixels with more than 128 are assigned as 1, and those with less than 128 are assigned as 0. The results are statistically analyzed and calculated using the Poisson distribution principle to complete the final digital detection.

[0115] The above are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention specification, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. A nucleic acid digital detection integrated chip based on vertically perforated membrane emulsification, characterized in that, The chip's main structure consists of three layers: upper, middle, and lower. The upper layer of the chip has a nucleic acid extraction and purification area (1), a vertically perforated membrane emulsion droplet generation area (2), and a digital isothermal amplification detection area (3) connected sequentially. The nucleic acid extraction and purification area (1) is equipped with interdigitated electrodes (4), and the nucleic acid extraction and purification area (1) and the vertically perforated membrane emulsion droplet generation area (2) are separated by a nucleic acid purification membrane (6). The vertically perforated membrane emulsion droplet generation area (2) has a vertically perforated membrane (7) in the middle, dividing the vertically perforated membrane emulsion droplet generation area (2) into upper and lower layers. The upper layer contains lyophilized isothermal amplification reagent (8), and the lower layer is connected to the nucleus. The acid purification membrane digital isothermal amplification detection area (3) is connected and has an oil phase inlet (9) to introduce a continuous oil phase for dispersing and stabilizing the generation of uniformly sized microdroplets; the middle layer of the chip is the substrate (11); the lower layer of the chip is the heating electrode (12), which is located below the digital isothermal amplification detection area (3) and is connected to the power supply through a wire to provide a constant temperature for nucleic acid amplification; the nucleic acid purification membrane (6) is a membrane that only allows nucleic acids to pass through, has low adsorption of nucleic acids, and can retain membrane fragments or protein impurities; the vertically perforated membrane (7) has multiple micropores of the same size, evenly distributed, and perpendicular to the horizontal plane of the vertically perforated membrane.

2. The integrated nucleic acid digital detection chip according to claim 1, characterized in that, The nucleic acid extraction and purification zone (1) is provided with an inlet port (5) at the top, and the digital isothermal amplification and detection zone (3) is provided with an oil phase outlet (10).

3. The integrated nucleic acid digital detection chip according to claim 1, characterized in that, The vertically perforated membrane (7) has a columnar structure and a membrane height greater than or equal to 1 mm.

4. The integrated nucleic acid digital detection chip according to claim 3, characterized in that, The micropores have a diameter of 10–30 μm and a spacing of more than 100 μm.

5. The integrated nucleic acid digital detection chip according to claim 1, characterized in that, The lyophilized isothermal amplification reagent (8) is a lyophilized particle of a reagent mixture required for loop-mediated isothermal amplification and rolling circle amplification of nucleic acids.

6. The integrated nucleic acid digital detection chip according to claim 1, characterized in that, The electrode material of the heating electrode (12) is graphene or carbon nanotube, and the surface area of ​​the heating electrode is larger than and covers the digital isothermal amplification detection region (3).

7. A nucleic acid extraction and digital detection device, characterized in that, The device includes a nucleic acid digital detection integrated chip as described in any one of claims 1 to 6, and a matching digital detection component. The digital detection component includes a light source (13), a convex lens (14), a filter (15), and a detector (16). The light source (13) is arranged in a ring around the nucleic acid digital detection integrated chip and is on the same horizontal plane as the digital isothermal amplification detection area (3). It is used to excite uniform microdroplets in the mixed system to emit fluorescence signals. The convex lens (14) is placed directly above the digital isothermal amplification detection area (3). It is used to magnify the image of uniform microdroplets in the isothermal amplification detection area to provide clearer fluorescence image results. The filter (15) is placed directly above the convex lens (14). It is used to filter light in wavelengths other than the fluorescence wavelength emitted by the sample solution. The detector (16) is placed directly above the filter (15). It is used to acquire and process the image after the nucleic acid amplification reaction.

8. A detection method based on the integrated digital nucleic acid detection chip according to any one of claims 1 to 6, characterized in that, Includes the following steps: S1. Disperse the sample solution to be tested in lysis buffer to obtain the test solution; S2. The test solution obtained in S1 is injected into the nucleic acid extraction and purification zone (1) through the injection port (5). The DC power supply is turned on to apply voltage to the interdigitated electrode (4) to lyse the cells and obtain the test nucleic acid solution. The test nucleic acid solution passes through the nucleic acid purification membrane (6) and enters the upper layer of the vertical perforated membrane emulsion droplet generation zone (2) to obtain the nucleic acid amplification system mixed solution. S3. Simultaneously, an oil phase mixed solution is introduced into the oil phase inlet (9) of the lower layer of the vertical perforated membrane emulsion droplet generation zone (2); S4. After the mixed solution of the nucleic acid amplification system obtained in S2 is completely emulsified into uniform microdroplets through the vertical perforated membrane (7) and transferred to the isothermal amplification detection area (3), a certain voltage is applied to the heating electrode (12) to heat and carry out the digital isothermal amplification reaction; S5. After the amplification reaction is complete, place the chip in a digital detection device for testing.

Images