Wheat leaf rust resistance molecular markers and their applications
By detecting the 71st nucleotide C or T of SEQ ID No. 4 on wheat chromosome 5B and combining it with KASP technology, the problem of the wheat leaf rust resistance gene being easily ineffective was solved, and efficient molecular marker-assisted breeding and resistance detection were achieved, thereby improving breeding efficiency and resistance screening capabilities.
Patent Information
- Application Number
- CN202410470457.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-18
- Publication Date
- 2025-09-16
- Estimated Expiration
- 2044-04-18
AI Technical Summary
In the existing technology, wheat leaf rust resistance genes are easily affected by the mutation of wheat leaf rust fungi, resulting in the failure of resistance. In addition, molecular marker-assisted breeding methods are limited, making it difficult to efficiently detect and utilize new resistance genes.
Provided is a molecular marker for detecting wheat leaf rust resistance. KASP competitive allele-specific PCR technology utilizes a detection method for nucleotide C or T at position 71 of SEQ ID No. 4 on wheat chromosome 5B, combined with a KASP primer set for genomic DNA amplification and fluorescence signal analysis, to achieve efficient detection of wheat leaf rust resistance.
It has achieved efficient detection of wheat leaf rust resistance and molecular marker-assisted breeding, which can screen out highly resistant wheat, improve breeding efficiency, reduce production costs and reduce environmental pollution.
Smart Images

Figure BDA0004798748000000071 
Figure BDA0004798748000000081 
Figure BDA0004798748000000091
Abstract
Description
Technical Field
[0001] The present invention relates to a wheat leaf rust resistance molecular marker and an application thereof in the field of biotechnology. Background Art
[0002] Wheat leaf rust is caused by the fungus Puccinia tirticina. It is a fungal disease that primarily harms wheat leaves. In severe cases, it can also infect wheat stems and ears. Wheat leaf rust is characterized by airborne transmission, widespread prevalence, strong destructiveness, obligate parasitism, and cyclical infection. It frequently occurs in my country's major wheat-producing areas. Wheat leaf rust primarily harms wheat leaves, reducing the plant's photosynthetic rate, which in turn affects grain filling, leading to a decrease in thousand-grain weight. This typically reduces yield by 5% to 15%, and yield losses in susceptible varieties can be as high as 40%. The use of chemicals to control leaf rust not only increases production costs but also easily causes environmental pollution. The cultivation and planting of wheat leaf rust-resistant varieties is the most economical, effective, and environmentally friendly method of prevention and control.
[0003] To date, using various genetic research methods, more than 82 leaf rust resistance genes or alleles have been discovered in common wheat, durum wheat, and diploid wheat varieties, including Lr1 to Lr82, LrAlt, and LrTt1. However, due to the continuous evolution and mutation of Pt subspecies, most initially effective rust resistance genes usually have a short useful life. Currently, the only genes that still maintain effective resistance in production are Lr9, Lr19, Lr24, Lr38, Lr47, Lr51, and Lr53. The Lr genes that have been discovered to confer resistance in adult plants include Lr12, Lr13, Lr22 (a and b), Lr34, Lr35, Lr37, Lr44, Lr46, Lr48, Lr49, Lr67, Lr68, Lr74, Lr75, Lr77, and Lr78. Lr12, Lr13, and Lr22b are race-specific and associated with hypersensitive cell death, while the other genes are non-race-specific and can confer resistance to multiple physiological races. Currently, eight wheat leaf rust resistance genes have been cloned: Lr1, Lr10, Lr13, Lr14a, Lr21, Lr22a, Lr34, and Lr67. A total of 80 QTLs for wheat leaf rust have been reported, distributed across nearly all 21 wheat chromosomes, with the exception of chromosomes 1A, 1D, 3D, 6D, and 7A, where QTLs may not exist or remain undiscovered. Some QTLs, despite using different markers, share the same general chromosomal location. QTLs that can be located across diverse disease-resistant accessions are more stable and widely distributed, making them more worthy of in-depth study. Due to the rapid mutation rate of wheat leaf rust, which can lead to the loss of resistance in some genes and the linkage of some genes to undesirable traits, the number of genes truly useful for improving leaf rust resistance in wheat breeding is very limited. Therefore, identifying new leaf rust resistance genes (QTLs) and developing molecular markers closely linked to them are crucial for breeding for disease resistance.
[0004] Molecular marker-assisted breeding has accelerated the progress of traditional breeding. Single nucleotide polymorphisms (SNPs) are caused by the replacement, deletion, or addition of a single base pair in the genome, thereby changing the base sequence and causing DNA sequence polymorphism. SNPs are widely distributed in the genome and are highly stable. With the rapid development of molecular biology technology, they have higher use value and greater development space, and people can use them for molecular marker-assisted selection. Therefore, competitive allele-specific PCR (KASP) technology for detecting SNPs has shown good development prospects, mainly because KASP markers have the advantages of high throughput, high stability, and high accuracy. At present, KASP marker technology is very mature and is widely used in wheat genetic breeding.
[0005] Jimai 22 is a high-yield, multi-resistant, high-quality medium-gluten wheat variety. It passed national approval for the northern Huanghuai region in 2006 and completed registration for introduction into Anhui and Henan provinces in 2010 and 2011, respectively. It is suitable for cultivation in the northern and southern Huanghuai winter wheat regions of Henan and Anhui provinces. Zhongmai 578 is a high-yield, multi-resistant, high-quality strong-gluten wheat variety. It passed national approval in June 2021 and is suitable for cultivation in irrigated areas in the northern Huanghuai winter wheat region. Summary of the Invention
[0006] The technical problem to be solved by the present invention is how to detect wheat leaf rust resistance.
[0007] To solve the above technical problems, the present invention first provides an application of a substance for detecting a molecular marker of wheat leaf rust resistance in detecting or assisting in detecting wheat leaf rust resistance;
[0008] The wheat leaf rust resistance molecular marker is the nucleotide at position 71 on the wheat chromosome 5B corresponding to SEQ ID No. 4 in the sequence list, which is C or T.
[0009] In the above application, the substance for detecting the wheat leaf rust resistance molecular marker may include: a primer set capable of amplifying the DNA fragment shown at position 71 of SEQ ID No. 4 in the sequence listing.
[0010] In the above application, the primer set can be composed of three single-stranded DNAs named upstream primer F1, upstream primer F2 and downstream primer R, wherein the upstream primer F1 contains the single-stranded DNA shown at positions 22-41 of SEQ ID No.1, the upstream primer F2 contains the single-stranded DNA shown at positions 22-41 of SEQ ID No.2, and the downstream primer R is the single-stranded DNA shown in SEQ ID No.3.
[0011] Specifically, the upstream primer F1 may be a single-stranded DNA shown in SEQ ID No. 1, and the upstream primer F2 may be a single-stranded DNA shown in SEQ ID No. 2.
[0012] The present invention also provides a method for detecting wheat leaf rust resistance, which comprises: detecting the nucleotide corresponding to the 71st position of SEQ ID No. 4 in the sequence list in the genomic DNA of the wheat to be tested, and the leaf rust resistance of the homozygous wheat to be tested in which the nucleotide corresponding to the 71st position of SEQ ID No. 4 in the sequence list in the genomic DNA is C is higher or can be higher than that of the homozygous wheat to be tested in which the nucleotide corresponding to the 71st position of SEQ ID No. 4 in the sequence list in the genomic DNA is T.
[0013] In the above method, the detection of the nucleotide corresponding to position 71 of SEQ ID No. 4 in the sequence list in the genomic DNA of the wheat to be tested can be carried out using the substance for detecting the wheat leaf rust resistance molecular marker.
[0014] In the above method, the detection of the nucleotide corresponding to position 71 of SEQ ID No. 4 in the sequence listing in the genomic DNA of the wheat to be tested can be completed by direct sequencing, or by amplifying the three single-stranded DNAs represented by SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3 in a reaction system of KASP primers and then detecting the fluorescent signal in the reaction system.
[0015] In one embodiment of the present invention, the reaction system may contain KASP 2x Master Mix (LGC, Catalog No.: 13448166). The fluorescent signal in the reaction system is displayed as FAM, and the nucleotide corresponding to the 71st position of SEQ ID No. 4 in the sequence list of the wheat to be tested is C (i.e., the wheat to be tested is homozygous for C); the fluorescent signal in the reaction system is displayed as HEX, and the nucleotide corresponding to the 71st position of SEQ ID No. 4 in the sequence list of the wheat to be tested is T (i.e., the wheat to be tested is homozygous for T); the fluorescent signal in the reaction system is displayed as FMA and HEX, and the nucleotide corresponding to the 71st position of SEQ ID No. 4 in the sequence list of the wheat to be tested is C and T (i.e., the wheat to be tested is heterozygous for C and T).
[0016] The substance for detecting the wheat leaf rust resistance molecular marker also falls within the protection scope of the present invention.
[0017] The substance for detecting the wheat stripe rust resistance molecular marker can be a kit.
[0018] The DNA molecule shown in SEQ ID No. 4 also falls within the scope of protection of the present invention.
[0019] The present invention also provides any of the following uses of the wheat leaf rust resistance molecular marker or the DNA molecule shown in SEQ ID No. 4:
[0020] X1) Detecting or assisting in detecting wheat leaf rust resistance;
[0021] X2) Compare the leaf rust resistance of different wheat varieties;
[0022] X3) Breeding wheat with strong resistance to leaf rust;
[0023] X4) Screening or eliminating wheat with weak leaf rust resistance;
[0024] X5) Wheat breeding.
[0025] The present invention also provides any of the following applications of the substance for detecting the wheat leaf rust resistance molecular marker:
[0026] Y1) preparing a product for detecting or assisting in detecting wheat leaf rust resistance;
[0027] Y2) Compare the leaf rust resistance of different wheat varieties;
[0028] Y3) preparing a product for comparing the leaf rust resistance of different wheat varieties;
[0029] Y4) Breeding wheat with strong leaf rust resistance;
[0030] Y5) preparing products for breeding wheat with strong leaf rust resistance;
[0031] Y6) Screening or eliminating wheat with weak leaf rust resistance;
[0032] Y7) preparing a product for screening or eliminating wheat with weak leaf rust resistance;
[0033] Y8) Wheat breeding.
[0034] The present invention also provides a wheat breeding method, which comprises: detecting the nucleotide corresponding to the 71st position of SEQ ID No. 4 in the sequence list in the wheat genomic DNA, selecting homozygous wheat whose 71st position corresponding to SEQ ID No. 4 in the sequence list is C as a parent for breeding, and screening the homozygous wheat whose 71st position corresponding to SEQ ID No. 4 in the sequence list in the genomic DNA is C in the offspring to obtain wheat with leaf rust resistance.
[0035] In the present invention, the wheat can be selected from the hybrid offspring of Zhongmai 578 and Jimai 22, or the 115 wheat materials in Table 2 or their offspring.
[0036] In a specific embodiment of the present invention, the leaf rust resistance is reflected by the MDS level of the leaves. A high MDS level indicates weak leaf rust resistance, while a low MDS level indicates strong leaf rust resistance.
[0037] The wheat leaf rust resistance molecular marker of the present invention is associated with wheat leaf rust resistance. Homozygous wheat in which the nucleotide at position 71 corresponding to SEQ ID No. 4 in the sequence listing is C has higher leaf rust resistance than homozygous wheat in which the nucleotide at position 71 corresponding to SEQ ID No. 4 in the sequence listing is T. The wheat leaf rust resistance molecular marker can be used to detect wheat leaf rust resistance and further used in molecular marker-assisted breeding. The present invention is of great significance for breeding wheat with enhanced leaf rust resistance.
[0038] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 This is the QLr.caas-5BL curve mapped in the Zhongmai 578×Jimai 22 RIL population.
[0040] Figure 2 The genotyping results of 115 wheat accessions using the KASP marker Kasp_5B_LR are shown. The blue genotype represents the Zhongmai 578 genotype, and the red genotype represents the Jimai 22 genotype. DETAILED DESCRIPTION
[0041] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in literature in the field or in accordance with product specifications. Materials, reagents, and instruments used in the following examples are commercially available unless otherwise noted. In the following examples, unless otherwise noted, the first position of each nucleotide sequence in the sequence listing refers to the 5′-terminal nucleotide of the corresponding DNA / RNA, and the last position refers to the 3′-terminal nucleotide of the corresponding DNA / RNA.
[0042] Example 1. Discovery of Leaf Rust Resistance QTL in Zhongmai 578×Jimai 22 RIL Population and Acquisition and Application of KASP Markers
[0043] 1. Acquisition of phenotypic data
[0044] Using Zhongmai 578 as the maternal parent and Jimai 22 as the paternal parent, an F5 RIL population containing 262 families was constructed using the single-seed descent method. Plantings were conducted in Xinxiang, Henan Province in 2021-2022 and in Xinxiang, Henan Province, Zhengzhou, Henan Province, and Baoding, Hebei Province in 2022-2023. A completely randomized block design with three replications was used, with six rows in plots of 4 m long and 0.25 m wide, and 270 seeds per square meter were sown. Throughout the wheat growth process, field management followed conventional local cultivation techniques. Field disease surveys were conducted on the population and its parents when leaf rust was at its most severe (i.e., when the leaves of the susceptible control, Zhengzhou 5389, were nearly completely covered with uredulia). The survey metric was maximum severity (MDS), defined as the percentage of leaf rust uredulia area on a leaf.
[0045] Genomic DNA from young leaves of 262 families was extracted using the CTAB method. DNA concentration was measured using a NanoDrop 2000c spectrophotometer, and DNA samples were adjusted to a standard concentration of 50 ng / μl. DNA quality was then tested on a 0.8% agarose gel. DNA of acceptable quality was used for SNP typing. SNP analysis was performed using a 50K SNP array developed in collaboration between the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences, and Affymetrix Axiom.
[0046] 2. Construction of linkage map
[0047] The RILs and both parents were genotyped using the CapitalBio Corporation (http: / / www.capitalbio.com) wheat 50K SNP array, encompassing a total of 55,224 SNPs. Genotype data were filtered to exclude non-polymorphic markers, families with marker loss rates greater than 20%, and markers with a minor allele frequency less than 30%. The remaining 9354 high-quality polymorphic markers were used for subsequent analysis. The filtered polymorphic markers were processed using the BIN function in IciMapping v4.2 (http: / / www.isbreeding.net / ; Meng et al. 2015), grouping markers with identical genotypes into a single bin. Thirty-four linkage groups, comprising 1501 bins, were constructed. Genetic linkage maps were constructed using JoinMap v4.0 and MapChart v2.32 software (https: / / www.wur.nl / en / show / Mapchart.htm; Voorrips, 2002).
[0048] 3. QTL Analysis
[0049] QTLs were detected using the complete interval mapping method of QTL Cartographer v2.5, with an LOD threshold of 2.5. A relatively stable QTL was located on chromosome 5B and named QLr.caas-5BL ( Figure 1 The flanking markers are AX-1105294353 and AX-95660479, with a physical interval of 669.1–702.9 Mb. Under different environmental conditions, 3.42–10.55% of the phenotypic variation can be explained (see Table 1, Figure 1 The flanking marker AX-95660479 was transformed into Kasp_5B_LR, and the genotypes of 115 wheat materials were detected.
[0050] Table 1. QLr.caas-5BL of Zhongmai 578×Jimai 22 RIL population detected by composite interval mapping
[0051] Genetic position (cM) Marking interval Physical location (Mb) LOD value PVE (%) Add 55.51 AX-1105294353-AX-95660479 669.1-702.9 2.67-5.82 3.42-10.55 -2.36--5.31
[0052] 4. Design and Utilization of KASP Primers
[0053] 1. Design of KASP primers
[0054] The SNP site AX-95660479, corresponding to the Kasp_5B_LR marker, is located at 702.9 Mb in the wheat reference genome (chromosome 5B) Chinese Spring RefSeq v1.0 (reference genome website: https: / / urgi.versailles.inra.fr / blast_iwgsc / ). The SNP variants of marker AX-95660479 (sense strand), which is tightly linked to QLr.caas-5BL, between Zhongmai 578 and Jimai 22, and the surrounding nucleotide sequences are shown in SEQ ID No. 4 (Y represents C or T).
[0055] The KASP marker primer sequence was designed based on the antisense strand of the SNP site marker AX-95660479 as follows:
[0056] Upstream primer F1: 5'- GAAGGTGACCAAGTTCATGCT ACCCCTCAAGTCTGAGCTTG-3' (SEQ ID No. 1, the underlined part is the specific fluorescent tag sequence FAM);
[0057] Upstream primer F2: 5'- GAAGGTCGGAGTCAACGGATT ACCCCTCAAGTCTGAGCTTA-3' (SEQ ID No. 2, the underlined part is the specific fluorescent tag sequence HEX);
[0058] Downstream primer R: 5'-GCTGACAAGGACCTCGACG-3' (SEQ ID No. 3).
[0059] The last base at the 3' end of the two upstream primers corresponds to the SNP site AX-95660479 (antisense strand). The SNP site AX-95660479 on wheat chromosome 5B corresponds to position 71 of SEQ ID No. 4 (sense strand), which is C or T (represented by Y in SEQ ID No. 4).
[0060] The upstream primer F1 is used to amplify the case where the nucleotide at the SNP site AX-95660479 (antisense chain) on wheat chromosome 5B is G (corresponding to the sense chain, the nucleotide at this SNP site is C), and the upstream primer F2 is used to amplify the case where the nucleotide at the SNP site AX-95660479 (antisense chain) on wheat chromosome 5B is A (corresponding to the sense chain, the nucleotide at this SNP site is T); the downstream primer R is a universal primer.
[0061] The single-stranded DNA molecules shown in SEQ ID No. 1 and SEQ ID No. 3 amplify a fragment in which the nucleotide at the SNP site AX-95660479 (antisense strand) on wheat chromosome 5B is homozygous for G (corresponding to the sense strand, the genotype of the SNP site is homozygous for C:C).
[0062] The single-stranded DNA molecules shown in SEQ ID No. 2 and SEQ ID No. 3 amplify a fragment in which the nucleotide at the SNP site AX-95660479 (antisense strand) on wheat chromosome 5B is homozygous for A (corresponding to the sense strand, the genotype of the SNP site is T:T homozygous).
[0063] The single-stranded DNA molecules shown in SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3 amplify a fragment in which the nucleotides at the SNP site AX-95660479 (antisense strand) on wheat chromosome 5B are heterozygous for G and A (corresponding to the sense strand, the genotype of the SNP site is T:C heterozygous).
[0064] 2. Establishment of KASP detection method
[0065] The principle of KASP: two forward competitive primers (the 5' end of the primer has a base sequence that is complementary to the fluorescent groups HEX and FAM, and the other sequences differ only at the SNP at the 3' end) and a reverse common primer; the PCR reaction system contains a universal sequence modified with fluorescent groups and quenching groups (Master Mix provided by LGC). The two forward primers can emit two different colors of light. If the site is homozygous, a single fluorescence is emitted; if it is heterozygous, two fluorescences can be emitted simultaneously.
[0066] The KASP marker PCR amplification system was as follows: 2.0 μl KASP 2x Master Mix (LGC, Catalog No. 13448166), 0.048 μl KASP primers (a mixture of three primers, total concentration 50 μM, with a molar ratio of two upstream primers to one downstream primer of 2:2:5), and 1.952 μl template DNA (50 ng / μl). Amplification was performed using a 384-well PCR instrument (BIO-RAD, S1000™ Thermal Cycler) with the following program: 94°C for 15 min; 10 cycles of 94°C for 20 s, followed by 63-55°C for 1 min (1°C decrease between cycles); and 32 cycles of 94°C for 20 s, followed by 55°C for 60 s. The PCR amplification products were placed in an automatic focusing fluorescence multifunctional microplate reader (PHERAstarplus SNP, BMG LABTECH) to read the final fluorescence data, and then the data were imported into Klustercallerv3.4 (LGC, Hoddesdon, UK) for genotyping.
[0067] For the Kasp_5B_LR marker (SNP site AX-95660479): If the fluorescence signal data of the amplified product is close to the Y-axis (FAM fluorescence signal) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is CC homozygous; if the fluorescence signal data of the amplified product is close to the X-axis (HEX fluorescence signal) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is TT homozygous; if the fluorescence signal data of the amplified product is located between the X-axis and the Y-axis (with both FAM and HEX signals) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is TC heterozygous.
[0068] 3. KASP detection
[0069] The experimental materials were 115 accessions from the Huanghuai wheat region (Liu JD, He ZH, Rasheed A, Wen WE, Yan J, Zhang PZ, Wan YX, Zhang Y, Xie CJ, Xia XC (2017) Genome wide association mapping of black point reaction in common wheat (Triticum aestivum L.). BMC Plant Biology, https: / / doi.org / 10.1186 / s12870-017-1167-3.), as shown in Table 2.
[0070] 115 wheat accessions from the Huanghuai wheat region were planted in Zhengzhou, Henan (2020-2021) and Baoding, Hebei (2021-2022). All experiments used a randomized block design with three replicates, three rows, 2 m row length, 25 cm row spacing, and 50 seeds per row. Field management followed local regulations, and leaf rust resistance was assessed. At the jointing stage, wheat was inoculated with a mixed inoculum (THTT, PHTN, THKT, THDL, and THGS). The strains and inoculation methods were described in Li ZF, Xia XC, He ZH, Li X, Zhang LJ, Wang HY, Meng QF, Yang WX, Li GQ, and Liu DQ. Seedling and slow rusting resistance to leaf rust in Chinese wheat cultivars. Plant Dis, 2010, 94:45–53.
[0071] Field disease surveys were conducted on the population and its parents at the peak of leaf rust disease. The survey metric was maximum severity (MDS), defined as the percentage of leaf rust spore area on a leaf relative to the total leaf area. The mean values for the two environments are shown in Table 2.
[0072] Extract genomic DNA from all experimental materials and use it as a template to detect using the KASP primers designed in step 2. For specific operations, see step 2.
[0073] The results are shown in Table 2 and Figure 2Of the 115 wheat accessions, 92 were CC homozygous (Zhongmai 578 genotype) and 23 were TT homozygous (Jimai 22 genotype). The mean MDS value of CC homozygous wheat accessions was 8.46% lower than that of TT homozygous wheat accessions, a significant difference at the 0.05 level (Table 3). This indicates that the Kasp_5B_LR marker of the present invention is associated with wheat leaf rust resistance.
[0074] Table 2. Genotype detection results of 115 wheat materials
[0075]
[0076]
[0077]
[0078]
[0079]
[0080] Note: CC: Zhongmai 578 genotype; TT: Jimai 22 genotype.
[0081] Table 3. MDS effects of 15 natural populations of QLr.caas-5B1
[0082]
[0083] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. Application of substances for detecting molecular markers of wheat leaf rust resistance in detecting or assisting in detecting wheat leaf rust resistance; The wheat leaf rust resistance molecular marker is the nucleotide at position 71 on the wheat chromosome 5B corresponding to SEQ ID No. 4 in the sequence list, which is C or T.
2. The use according to claim 1, characterized in that: The substance for detecting the wheat leaf rust resistance molecular marker comprises: a primer set capable of amplifying a DNA fragment represented by position 71 of SEQ ID No. 4 in the sequence listing; The primer set consists of three single-stranded DNAs named upstream primer F1, upstream primer F2 and downstream primer R, wherein the upstream primer F1 is the single-stranded DNA shown in SEQ ID No.1, the upstream primer F2 is the single-stranded DNA shown in SEQ ID No.2, and the downstream primer R is the single-stranded DNA shown in SEQ ID No.
3.
3. A method for detecting wheat leaf rust resistance, comprising: The nucleotide corresponding to the 71st position of SEQ ID No. 4 in the sequence list is detected in the genomic DNA of the wheat to be tested. The leaf rust resistance of the homozygous wheat to be tested in which the nucleotide corresponding to the 71st position of SEQ ID No. 4 in the sequence list in the genomic DNA is C is higher or can be higher than that of the homozygous wheat to be tested in which the nucleotide corresponding to the 71st position of SEQ ID No. 4 in the sequence list in the genomic DNA is T.
4. The method according to claim 3, wherein: The nucleotide corresponding to position 71 of SEQ ID No. 4 in the sequence list in the genomic DNA of the wheat to be tested is detected using the substance for detecting the wheat leaf rust resistance molecular marker as claimed in claim 1 or 2.
5. Any of the following uses of the substance for detecting the wheat leaf rust resistance molecular marker according to claim 1 or 2: Y1) Preparation of products for detecting or assisting in detecting wheat leaf rust resistance; Y2) Compare the leaf rust resistance of different wheat varieties; Y3) Prepare products to compare the leaf rust resistance of different wheat varieties; Y4) Breeding wheat for strong leaf rust resistance; Y5) Preparation of products for breeding wheat with enhanced leaf rust resistance; Y6) Screening or culling wheat with weak leaf rust resistance; Y7) preparing products for screening or culling wheat with weak leaf rust resistance; Y8) Wheat breeding, breeding trait for wheat leaf rust resistance.
6. Wheat breeding methods, including: The method comprises detecting the nucleotide at position 71 corresponding to SEQ ID No. 4 in the sequence list in wheat genomic DNA, selecting homozygous wheat whose genomic DNA corresponding to position 71 of SEQ ID No. 4 in the sequence list is C as a parent for breeding, and screening the homozygous wheat whose genomic DNA corresponding to position 71 of SEQ ID No. 4 in the sequence list is C in the offspring to obtain wheat with leaf rust resistance.