Rice heading stage control gene yth07, its encoded protein and application

Abstract

The application discloses a rice heading stage gene YTH07 and an encoding protein and application thereof. The gene encodes a protein containing a YT521-B-like homology (YTH) domain, the gene sequence is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2. Genetic transformation experiments prove that YTH07 promotes rice heading under long-day and short-day conditions. Since the yth07 knockout mutant is later than the wild type in days of heading, the days of heading are more stable under long-day and short-day conditions, so it is of great significance to introduce the yth07 knockout mutant into conventional varieties through hybridization or gene editing to avoid the harm of extreme weather and improve regional adaptability.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a minor gene YTH07 that controls the heading stage of rice, its encoded protein, and its applications. Background Technology

[0002] With the global pandemic and frequent extreme weather events, ensuring food security has become an urgent priority. Rice, as one of the world's most important food crops, feeds more than half of the world's population. Heading date is a crucial agronomical trait in rice, determining both the seasonal and regional adaptability of rice varieties and influencing yield and quality by regulating the accumulation of photosynthetic products. Therefore, identifying key genes regulating rice heading date, gaining a deeper understanding of their molecular mechanisms, and improving the rice heading date regulatory network will benefit breeders in selecting superior varieties adapted to different regions.

[0003] Scientists have cloned many heading date genes through forward genetics, reverse genetics, and population genetics. However, most of these genes have significant effects, often accompanied by substantial changes in rice yield and plant height. Slightly delaying the heading date (3-7 days) allows rice to fully utilize the light and temperature conditions during the vegetative growth stage, improving rice quality and yield. Conversely, slightly advancing the heading date can prevent rice from experiencing high-temperature stress during flowering. The sluggish yield growth of rice varieties in recent years indicates a bottleneck in germplasm resource development; the aggregation of genes with minor effects may be another effective method to increase yield. Currently, the discovery and utilization of genes with minor effects on heading date are relatively limited.

[0004] Discovering genes with minor effects during the heading stage can provide a genetic resource reserve and theoretical basis for improving the regional adaptability of rice varieties, which is of great significance for improving varieties at the heading stage. Summary of the Invention

[0005] The purpose of this invention is to disclose the gene YTH07, which has a minor effect on controlling the heading stage of rice, its encoded protein, and its applications.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] This invention provides a minor gene YTH07 for controlling the heading stage of rice. The gene sequence is shown in SEQ ID NO.1, which encodes a protein containing a YT521-B-like homology (YTH) domain. The amino acid sequence is shown in SEQ ID NO.2.

[0008] The present invention also provides a primer for knocking out or silencing YTH07, the sequence of which is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0009] The present invention also provides an sgRNA for knocking out or silencing YTH07, the sequence of which is shown in SEQ ID NO.5.

[0010] The present invention also provides a mutant gene yth07, the sequence of which is shown in SEQ ID NO.6 or SEQ ID NO.7.

[0011] The present invention also provides the application of the micro-effect gene YTH07 or the mutant gene yth07 for controlling heading period in rice variety improvement.

[0012] The present invention also provides the application of the aforementioned micro-effect gene YTH07 or mutant gene yth07 for controlling heading stage in rice heading stage regulation breeding.

[0013] The present invention also provides the application of the aforementioned gene YTH07 or mutant gene yth07 that controls the heading period in the breeding of rice varieties with delayed heading period, specifically by knocking out or silencing gene YTH07 in wild-type varieties, or by transferring mutant gene yth07 into wild-type varieties.

[0014] The present invention also provides a method for breeding rice varieties with delayed heading date, specifically by knocking out or silencing the gene YTH07 in a wild-type variety or by transferring the mutant gene yth07 into a wild-type variety to obtain a rice variety with a delayed heading date compared to the wild-type variety.

[0015] The beneficial effects of this invention are:

[0016] By knocking out YTH07 in wild-type materials using gene editing, rice varieties with a functional defective genotype of yth07 (slightly delayed heading date compared to the wild type) can be obtained. This invention improves the regional adaptability of rice varieties and provides technical support for increasing genetic diversity in heading date improvement. Compared to existing technologies, it has the following advantages:

[0017] (1) This invention identifies a minor promoter YTH07 that regulates the heading time of rice through reverse genetics. Transgenic knockout can obtain rice varieties that exhibit a slightly delayed heading phenotype after the loss of YTH07 function.

[0018] (2) By using gene editing to transfer the yth07 gene into wild-type materials, rice varieties with a functional defect genotype of yth07 and a heading period slightly later than that of wild-type rice can be obtained.

[0019] (3) The phenotype of yth07, which is slightly delayed in heading compared to the wild type, is more stable under long and short day conditions. Therefore, the mutant gene yth07 can be introduced into conventional varieties through hybridization or gene editing.

[0020] (4) The genes of this invention can be used to adjust the heading time of rice, thereby adjusting the regional adaptability of rice varieties, obtaining rice varieties with different growth periods adapted to different regions, and providing technical support for the genetic diversity of heading period improvement. Attached Figure Description

[0021] Figure 1 These are two genotypes of YTH07 that have undergone gene editing.

[0022] Figure 2 Phenotypic charts of wild-type Dongjin and knockout mutant yth07 and their heading dates under long and short day conditions. Detailed Implementation

[0023] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0024] Example 1

[0025] I. Construction of gene knockout vector

[0026] a) Design knockout primers for YTH07 using the website http: / / CRISPR.hzau.edu.cn / CRISPR / . The primer sequences are as follows:

[0027] YTH07-CRISPR-F:

[0028] AGATGATCCGTGGCAGCCTCTAGAGTCACGCCTTGGTTTTAGAGCTATGC(SEQ ID NO.3)

[0029] YTH07-CRISPR-R:

[0030] TTCTAGCTCTAAAACGGCTGAGGGGTATACACATTCTGAGCCTCAGCGCAGCAGCTTA(SEQ IDNO.4)

[0031] b) Using the CRISPR-JIEYAO-1 / 2 plasmid (Wang et al., 2023) as a template, the U6c promoter and sgRNA scaffold (SEQ ID NO.5) were amplified using the YTH07-CRISPR-F and YTH07-CRISPR-R primers described above. The amplification program was as follows: 94℃ for 2 min; 98℃ for 10 s, 58℃ for 30 s, 68℃ for 1 min / 1 kb, for a total of 33 cycles; 68℃ for 10 min; 4℃ for 10 min. After amplification, the results were detected by agarose gel electrophoresis, and the corresponding bands were recovered. The recovered fragments were recombined with the BsaI-linearized pYLCRISPR / Cas9Pubi-H backbone (Ma et al., 2015), and the reaction system was as follows:

[0032]

[0033] The above mixture was reacted at 50°C for 20 minutes.

[0034] c) The recombinant product was placed on ice for 2 min, then transferred into competent E. coli cells and placed on ice for 30 min.

[0035] e) Heat shock in a 42℃ water bath for 90 seconds, then place on ice for 2 minutes;

[0036] f) Add 700 μL of liquid LB medium and incubate at 37°C and 220 rpm for 1 h on a shaker.

[0037] g) Spread evenly on solid LB medium plates containing kanamycin and incubate upside down at 37°C for 16 hours;

[0038] h) Select single clones, activate them, and then sequence them. Extract plasmids from the single clones that are correctly sequenced.

[0039] i) The correctly recombinant knockout vector was transferred into Agrobacterium using the freeze-thaw method to obtain the Agrobacterium strain with the YTH07 knockout vector.

[0040] II. Obtaining Transgenic Plants

[0041] 1. Genetically modified callus infection

[0042] a) The callus that grows from the mature embryo of rice (Dongjin, a well-known and widely used variety, a japonica rice variety) after 2 weeks of induction is transferred to a subculture medium and then induced and cultured for another half month;

[0043] b) The successfully induced callus was mixed evenly with the Agrobacterium bacterial suspension (OD600 between 0.6 and 1) containing the YTH07 knockout vector prepared in step one and incubated for 30 min. The bacterial suspension was then blotted dry with sterile filter paper and transferred to co-culture medium. The mixture was then incubated in the dark for 3 days.

[0044] c) 0.2% carboxybenzyl killed uninfected Agrobacterium; callus was transferred to selection medium and screened for 15 days;

[0045] d) Select healthy callus and transfer it to the selection medium again for selection for 15 days;

[0046] e) The selected surviving callus was transferred to differentiation medium and differentiated for 21 days;

[0047] f) After differentiation, transfer to rooting medium for 15 days, and then transplant to a greenhouse or field for growth.

[0048] 2. Identification of transgenic plants

[0049] Amplification primers were designed approximately 250 bp upstream and downstream of the knockout target site. DNA was extracted from leaves of T0 generation transgenic plants for PCR amplification, and the editing method was analyzed by sequencing. The sequencing identification primers are shown below:

[0050] yth07-JD-F:ACTAGGAAGTGCCTCCACAT

[0051] yth07-JD-R:ATGTGCAACGTAGAGCAGCA

[0052] Sequence sequencing analysis identified two homozygous yth07 knockout mutants with different editing methods. yth07-1 involves an insertion of a single T base in the second exon (mutated sequence shown in SEQ ID NO. 6), while yth07-4 involves a deletion of two bases (CG) in the second exon (mutated sequence shown in SEQ ID NO. 7). Both editing methods result in frameshift mutations, causing premature termination of the encoded protein. Figure 1 As shown.

[0053] The above-mentioned homozygous T1 transgenic plants were planted, and the heading period of the knockout mutant and wild-type Dongjin was investigated and photographed under natural long-day (NLD) conditions in Nanjing and natural short-day (NSD) conditions in Hainan.

[0054] The results are as follows Figure 2 The results showed that both independent yth07 knockout families exhibited heading 3-5 days later than the wild-type Dongjin under natural long-day conditions in Nanjing and natural short-day conditions in Hainan, indicating that YTH07 is a positive regulator of rice heading time. The method of this invention can be used to enhance the regional adaptability of rice.

[0055] By transferring the mutant gene into wild-type material using traditional hybridization or gene editing methods, the homozygous genotype yth07 is obtained, which has a later heading time than the wild type, and the heading time of the target variety can be directionally regulated.

Claims

1. A method for breeding rice varieties with delayed heading date, specifically comprising knocking out or silencing the gene shown in SEQ ID NO. 1 in a wild-type variety. YTH07 Rice varieties with a delayed heading period compared to wild types were obtained.

2. The method for cultivating rice varieties with delayed heading date according to claim 1, characterized in that, Knockout gene YTH07 The sgRNA used is shown in SEQ ID NO.

5.

3. The method for cultivating rice varieties with delayed heading date according to claim 2, characterized in that, The primers for amplifying sgRNA are shown in SEQ ID NO.3 and SEQ ID NO.4.

Images