An engineered Yarrowia lipolytica strain synthesizing N-acetyl-5-methoxytryptamine using tryptophan as a substrate, its construction and application
By integrating the genes of N-acetylserotonin O-methyltransferase mutants and other related enzymes into Yarrowia lipolytica, a synthesis pathway for N-acetyl-5-methoxytryptamine with tryptophan as a substrate was constructed, solving the problem of insufficient activity of N-acetylserotonin O-methyltransferase and achieving efficient biosynthesis and high yield.
Patent Information
- Application Number
- CN202410060295.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-16
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-01-16
AI Technical Summary
The activity of N-acetylserotonin Oxymethyltransferase in the prior art is low, resulting in a low yield of N-acetyl-5-methoxytryptamine.
A mutant of N-acetylserotonin O-methyltransferase was constructed, and genes encoding aromatic amino acid decarboxylase, tryptamine hydroxylase, and serotonin N-acetyltransferase were integrated into Yarrowia lipolytica. Genome integration was performed using the CRISPR/Cas9 gene editing system to construct a heterologous synthesis pathway with tryptophan as a substrate.
The catalytic activity of N-acetylserotonin O-methyltransferase was significantly improved, achieving efficient biosynthesis of N-acetyl-5-methoxytryptamine using tryptophan as a substrate. The fermentation process was simple and the yield reached 30.7 g/L.
Smart Images

Figure CN118291286B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology and relates to an engineered Yarrowia lipolytica bacteria for biosynthesizing N-acetyl-5-methoxytryptamine using tryptophan as a substrate, as well as its construction and application. Background Art
[0002] Yarrowia lipolytica is a typical unconventional yeast. It is a strictly aerobic bacterium and is also recognized as a GRAS strain (Generally Regard As Safe). Due to its multiple functions such as broad spectrum of carbon sources, efficient protein secretion and low growth requirements, this yeast has become one of the non-model microbial chassis cells that has attracted much attention and has great potential in metabolic engineering and synthetic biology research.
[0003] N-acetyl-5-methoxytryptamine, also known as melatonin (MT) and pinealogenin, exists in a variety of organisms such as bacteria, fungi, algae, plants, insects, and vertebrates. It is widely used to treat insomnia and also exhibits good antioxidant, anti-inflammatory, and free radical scavenging physiological activities. The biosynthesis of MT uses tryptophan as a precursor and is synthesized through four enzymatic reactions: first, tryptophan (Trp) is converted into tryptamine (Try) by aromatic amino acid decarboxylase (Aromatic-L-Amino-Acid Decarboxylase), then tryptamine 5-hydroxylaseenzyme catalyzes tryptamine into 5-hydroxytryptamine (5-HT), then serotonin N-acetyltransferase (SNAT) catalyzes 5-hydroxytryptamine into N-acetyl-5-hydroxytryptamine (N-acetylserotonin, NAS), and finally N-acetyl-5-hydroxytryptamine is methylated by N-acetylserotonin O-methyltransferase (ASMT) to produce N-acetyl-5-methoxytryptamine (MT).
[0004] Although methods for biosynthesizing melatonin (MT) have been successfully established, yields remain low, primarily due to the low activity of ASMT (N-acetylserotonin O-methyltransferase). Research into developing highly active ASMTs and further engineering bacteria capable of biosynthesizing N-acetyl-5-methoxytryptamine using tryptophan as a substrate is of great significance. Summary of the Invention
[0005] The technical problem to be solved by the present invention is to address the deficiencies of the prior art by providing a mutant N-acetylserotonin O-methyltransferase, an encoding gene, and a novel engineered Yarrowia lipolytica strain constructed based on the encoding gene for biosynthesizing N-acetyl-5-methoxytryptamine using tryptophan as a substrate, as well as the construction and application thereof. The N-acetylserotonin O-methyltransferase mutant of the present invention has enhanced catalytic activity of the N-acetylserotonin O-methyltransferase; the N-acetyl-5-methoxytryptamine engineered Yarrowia lipolytica strain of the present invention is used to biosynthesize N-acetyl-5-methoxytryptamine using tryptophan as a substrate, with high yield.
[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows:
[0007] On one hand, the present invention provides an engineered Yarrowia lipolytica strain for biosynthesizing N-acetyl-5-methoxytryptamine using tryptophan as a substrate.
[0008] An engineered Yarrowia lipolytica strain for biosynthesizing N-acetyl-5-methoxytryptamine using tryptophan as a substrate is provided. The engineered strain incorporates a gene (ddc) encoding an aromatic amino acid decarboxylase, a gene (T5H) encoding a tryptamine hydroxylase, a gene (SNAT) encoding a serotonin N-acetyltransferase, and a gene (ASMT) encoding an N-acetylserotonin O-methyltransferase mutant. The N-acetylserotonin O-methyltransferase mutant is obtained by mutation of the original amino acid sequence shown in SEQ ID NO: 2 at one or more amino acid residue sites selected from the group consisting of positions 128, 152, 160, 317, 321, and 322.
[0009] According to the above scheme, the mutation patterns of the amino acid residue sites in the N-acetylserotonin Oxymethyltransferase mutant are: M128L, F152W, A160S, I317A, H321L, N322L, and N322F.
[0010] According to the above scheme, the sequence of the gene ddc encoding aromatic amino acid decarboxylase is shown in any one of SEQ ID NOs. 07-09, the sequence of the gene T5H encoding tryptamine hydroxylase is shown in SEQ ID NO. 06, and the sequence of the gene SNAT encoding serotonin N-acetyltransferase is shown in SEQ ID NO. 3.
[0011] According to the above scheme, the sequence of the gene ASMT encoding the N-acetylserotonin O-methyltransferase mutant is shown as SEQ ID NO.10; the sequence of the gene ddc encoding the aromatic amino acid decarboxylase is shown as SEQ ID NO.07.
[0012] A second aspect of the present invention provides a method for constructing an engineered strain of Yarrowia lipolytica.
[0013] The Yarrowia lipolytica engineered bacteria of the present invention can be obtained by introducing a recombinant vector comprising a gene encoding an aromatic amino acid decarboxylase, ddc, and / or a gene encoding a tryptamine hydroxylase, T5H, a gene encoding an N-acetylserotonin O-methyltransferase mutant, an ASMT gene encoding an N-acetylserotonin O-methyltransferase, and / or a SNAT gene encoding a serotonin N-acetyltransferase into Yarrowia lipolytica, or by integrating a gene encoding an aromatic amino acid decarboxylase, a gene encoding a tryptamine hydroxylase, a gene encoding a serotonin N-acetyltransferase, and a gene encoding an N-acetylserotonin O-methyltransferase mutant into its genome. The genes can be expressed individually or multiple genes can be expressed at the same genomic site. Preferably, the recombinant genetically engineered bacteria of the present invention express four key genes separately at different gene editing sites, such as Ku70, Ku80, intC3, and ddc, to ultimately obtain a Yarrowia lipolytica engineered strain that biosynthesizes N-acetyl-5-methoxytryptamine using tryptophan as a substrate. Specifically, based on the Crispr / Cas9 gene editing system, a tool plasmid pylcas9 that can express Cas9 protein and sgRNA and a donor DNA fragment that expresses the target gene can be constructed to construct an engineered Yarrowia lipolytica strain.
[0014] More specifically, the engineered Yarrowia lipolytica is based on Yarrowia lipolytica PO1f as the starting strain, and the gene ASMT encoding the N-acetylserotonin O-methyltransferase mutant is integrated into the genomic Ku70 gene site, the gene SNAT encoding serotonin N-acetyltransferase is integrated into the genomic Ku80 gene site, the gene T5H encoding tryptamine hydroxylase is integrated into the intC3 site, and the gene ddc encoding aromatic amino acid decarboxylase is integrated into the intE1 site.
[0015] According to the above scheme, the method for constructing the engineered Yarrowia lipolytica is to use CRISPR / Cas9 and plasmid-mediated genome integration technology to sequentially integrate genes into the corresponding positions of the genome, including the following steps:
[0016] (1) Constructing a pylcas9-ΔKu70-gRNA targeting gene plasmid and a donor DNA fragment ΔKu70-ASMT containing the N-acetylserotonin O-methyltransferase gene; co-transforming them into the starting strain PO1f, and screening by colony PCR to obtain the engineered strain YL005;
[0017] (2) The pylcas9-ΔKu80-gRNA targeting gene plasmid and the donor DNA fragment ΔKu80-SNAT containing the serotonin N-acetyltransferase gene were constructed and co-transformed into the engineered strain YL005. The engineered strain YL006 was obtained by PCR screening.
[0018] (3) The pylcas9-intC3-gRNA targeting plasmid and the donor DNA fragment intC3-T5H containing the tryptamine hydroxylase gene were constructed and co-transformed into the engineered strain YL006. The engineered strain YL007 was obtained by PCR screening.
[0019] (4) A targeting gene pylcas9-intE1-gRNA plasmid and a donor DNA fragment intE1-ddc containing a gene encoding an aromatic amino acid decarboxylase were constructed and co-transformed into the engineered strain YL007. The engineered strain YL701, which is the engineered strain of Yarrowia lipolytica that biosynthesizes N-acetyl-5-methoxytryptamine using tryptophan as a substrate of the present invention, was obtained by PCR screening.
[0020] According to the above scheme, the method for constructing the donor DNA fragment ΔKu70-ASMT containing the N-acetylserotonin O-methyltransferase gene is as follows: using the Yarrowia lipolytica genome as a template to amplify the upstream and downstream homology arms of Ku70, using a synthetic gene vector as a template to amplify the ASMT gene encoding the N-acetylserotonin O-methyltransferase mutant, and using the Overlap method to construct and connect the upstream and downstream homology arms of Ku70 and the ASMT fragment to obtain the donor DNA fragment ΔKu70-ASMT;
[0021] Method for constructing a donor DNA fragment ΔKu80-SNAT containing the serotonin N-acetyltransferase gene: The Yarrowia lipolytica genome is used as a template to amplify the upstream and downstream homology arms of Ku80, the N-acetylserotonin O-methyltransferase gene SNAT is amplified using a synthetic gene vector as a template, and the donor DNA fragment ΔKu80-SNAT is constructed by connecting the upstream and downstream homology arms of Ku80 and the SNAT fragment using the Overlap method;
[0022] Donor DNA fragment intC3-T5H containing the tryptamine hydroxylase gene: The Yarrowia lipolytica genome was used as a template to amplify the upstream and downstream homology arms of intC3, and the gene T5H encoding tryptamine hydroxylase was amplified using a synthetic gene vector as a template. The overlap method was used to construct a linker between the upstream and downstream homology arms of intC3 and the T5H fragment to obtain the donor DNA fragment intC3-T5H.
[0023] The donor DNA fragment intE1-ddc containing the gene encoding aromatic amino acid decarboxylase was amplified using the Yarrowia lipolytica genome as a template to obtain the upstream and downstream homology arms of intE1, and the gene ddc encoding aromatic amino acid decarboxylase was amplified using a synthetic gene vector as a template. The donor DNA fragment intE1-ddc was obtained by constructing a fragment connecting the upstream and downstream homology arms of intE1 and the ddc fragment using the Overlap method.
[0024] A third aspect of the present invention provides a use of an engineered strain of Yarrowia lipolytica that produces N-acetyl-5-methoxytryptamine in the biosynthesis of N-acetyl-5-methoxytryptamine using tryptophan as a substrate.
[0025] According to the above scheme, the application method is:
[0026] Cultivating an engineered strain of Yarrowia lipolytica that produces N-acetyl-5-methoxytryptamine to obtain a seed solution;
[0027] The seed liquid is inoculated into a fermentation medium containing glucose and metal elements and nutrients necessary for the growth of Yarrowia lipolytica, and fermentation is carried out in batches. The pH is controlled in the range of 7.0-7.5 during the fermentation process; and the glucose concentration is controlled in the range of 20-40 g / L by batch feeding.
[0028] According to the above scheme, the fermentation temperature is 30°C; the fermentation time is preferably 120h-150h.
[0029] In a fourth aspect, the present invention provides an N-acetylserotonin O-methyltransferase mutant, which is obtained by mutation of the amino acid sequence shown in SEQ ID NO: 2 at one or more amino acid residue positions selected from the following group: position 128, position 152, position 160, position 317, position 321, and position 322.
[0030] According to the above scheme, the mutation patterns of the amino acid residue sites in the N-acetylserotonin Oxymethyltransferase mutant are: M128L, F152W, A160S, I317A, H321L, N322L, and N322F.
[0031] In a fifth aspect, the present invention provides a gene encoding the above-mentioned N-acetylserotonin O-methyltransferase mutant.
[0032] The present invention semi-rationally designed and modified the active site of N-acetylserotonin O-methyltransferase to obtain an N-acetylserotonin O-methyltransferase mutant. Furthermore, by screening isoenzymes of different species of key enzymes in this pathway, L-aromatic amino acid decarboxylase and tryptamine hydroxylase, the aromatic amino acid decarboxylase, tryptamine hydroxylase, serotonin N-acetyltransferase, and the N-acetylserotonin O-methyltransferase mutant were expressed in a Yarrowia lipolytica strain, resulting in an engineered Yarrowia lipolytica strain that biosynthesizes N-acetyl-5-methoxytryptamine using tryptophan as a substrate, with a maximum yield of 1.98 g / L. The fermentation yield in a 5-L fermentor was 30.7 g / L.
[0033] The screening process for the aromatic amino acid decarboxylase and tryptamine hydroxylase from the above-mentioned different sources is as follows: first, the genes Hsddc, OsTDC, and Crtdc of the three aromatic amino acid decarboxylases were expressed in the pINA1269 plasmid, and were separately introduced into the PO1f engineered bacteria. Through a feeding experiment using tryptophan as a substrate, the recombinant engineered bacteria with higher tryptamine production ability were screened. In this way, the aromatic amino acid decarboxylase gene Hsddc was selected to have the highest tryptamine production ability, followed by OsTDC, and then Crtdc.
[0034] The genes ZMT5H, JCT5H, and OsT5H containing three types of tryptamine hydroxylases were then expressed in the pINA1312 plasmid and introduced individually into the PO1f engineered bacteria. By conducting feeding experiments with tryptamine as a substrate, the recombinant engineered bacteria that produced 5-HT were screened, thereby selecting only the tryptamine hydroxylase gene OsT5H that could synthesize 5-hydroxytryptamine.
[0035] Beneficial effects of the present invention:
[0036] The present invention pioneered the use of Yarrowia lipolytica as a base strain to heterologously integrate the genes encoding aromatic amino acid decarboxylase (ddc), tryptamine hydroxylase (T5H), serotonin N-acetyltransferase (SNAT), and N-acetylserotonin O-methyltransferase (ASMT) into the Yarrowia lipolytica strain. This constructs a complete heterologous biosynthesis pathway for N-acetyl-5-methoxytryptamine using tryptophan as a substrate. This pathway uses tryptophan as a substrate and undergoes four enzymatic reactions, resulting in high yield and a simple fermentation process. The N-acetylserotonin O-methyltransferase mutant provided by the present invention significantly improves the catalytic activity of N-acetylserotonin O-methyltransferase, effectively solving the problem of low catalytic efficiency of N-acetylserotonin O-methyltransferase. Based on this mutant, an engineered Yarrowia lipolytica strain was constructed that can biosynthesize N-acetyl-5-methoxytryptamine using tryptophan as a substrate. The strain can produce 30.7 g / L of N-acetyl-5-methoxytryptamine using tryptophan as a substrate in a 5L fermentor by batch fermentation.
[0037] The production process of the invention produces N-acetyl-5-methoxytryptamine without polluting the environment, and has high yield and low cost, thus providing a basis for industrial biosynthesis of N-acetyl-5-methoxytryptamine. BRIEF DESCRIPTION OF THE DRAWINGS
[0038] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.
[0039] Figure 1 : Recombinant vectors pINA1312 and pINA1269 for expressing heterologous genes.
[0040] Figure 2 :The results of ASMT mutant catalyzing the conversion of N-acetyl-5-hydroxytryptamine into MT.
[0041] Figure 3 : Fermentation process curve of YL701 strain. DETAILED DESCRIPTION
[0042] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0043] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.
[0044] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. Unless otherwise indicated, the reagents involved in the examples of the present invention are all commercially available products and can be purchased through commercial channels.
[0045] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the present invention. The present description and examples are intended to be illustrative only.
[0046] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.
[0047] Example 1 Construction and feeding experiment of MT-producing engineered strain using N-acetyl-5-hydroxytryptamine as substrate
[0048] (1) Construction of N-acetylserotonin O-methyltransferase mutant
[0049] The N-acetylserotonin Oxymethyltransferase gene was synthesized by Jinkairui Biological Co., Ltd. and inserted into the pUC57-Amp-ASMT plasmid. The nucleotide sequence of the ASMT gene is shown in SEQ ID NO. 1. The recombinant plasmid pRSFDuet-ASMT was constructed using the ClonExpress II one-step cloning kit and then transformed into the Escherichia coli BL21(DE3) expression host strain to obtain the wild-type engineered strain (WT). Using the constructed pRSFDuet-ASMT plasmid as a template, primers were designed for plasmid amplification and mutagenesis to obtain a linearized plasmid vector with base mutations. This vector was then transformed into E. coli BL21(DE3) and, after in vivo repair and circularization, a plasmid with the base mutations was obtained. The resulting plasmid expressing the mutant was then transformed into BL21(DE3). The above-designed primers were used for plasmid amplification and mutagenesis, including designing single mutant N-acetylserotonin O-methyltransferase and further constructing multiple mutants based on this. Compared with the wild type, mutations were made at one or more amino acid residue sites selected from the following group: 128, 152, 160, 317, 321, and 322, resulting in mutants with at least a 20% increase in activity, with the highest increase reaching 5-fold. Among them, single mutants are exemplified by M1 (M128L), M2 (F152W), and M3 (A160S); double mutants are exemplified by M4 (A160S / I317A) and M5 (A160S / N322L); and triple mutants are exemplified by M6 (A160S / H321L / N322F). The mutation results are shown as follows: Figure 2 The amino acid sequences of mutants M1-M6 are shown in SEQ ID NOs. 57-62, respectively.
[0050] Wild-type and mutant engineered bacteria were cultured overnight in LB seed medium containing 50 μg / mL kanamycin to obtain seed solution. 2% of this seed solution was inoculated into 2YT medium and cultured at 37°C and 220 rpm. After 3 hours of incubation, IPTG was added to a final concentration of 0.5 mM to induce expression at 25°C and 220 rpm. After 16 hours of induction, the induced cells were centrifuged and the resulting pellet was added to the transformation medium. The pellet was resuspended to an OD600 of 10 and subjected to whole-cell catalysis at 37°C and 150 rpm for 24 hours. The transformation medium contained 50 mM Tris-HCl buffer, pH 7.0, and 10 mM N-acetyl-5-hydroxytryptamine. 500 μL of the reaction solution was diluted 1:1 with methanol, centrifuged, and the supernatant was filtered through a 0.22 μm filter into a liquid chromatography flask for high-performance liquid chromatography analysis.
[0051] The liquid chromatography method is as follows: Column: Agilent C18 ZORBAX SB 4.6mm*250mm, 5µm or equivalent; Detection wavelength: 275nm; Mobile phase A: water (containing 0.5ppm acetic acid); Mobile phase B: acetonitrile (chromatographic grade, containing 0.5ppm acetic acid). Elution program: 0-10min, 8%-10% B; 10-15min, 10%-40% B; 15-25min, 40% B; 25-27min, 40%-8% B; 27-30min, 8% B. NAS peaks at approximately 20min, and MT peaks at approximately 23min. Quantitative analysis was performed using the quantitative normalization method.
[0052] The results are as follows Figure 2 As shown, compared with the wild-type (WT) strain, the enzyme activities of the mutant engineered strains were all improved, among which the MT production capacity of M6 increased by 5 times, and the yield reached 2.15g / L.
[0053] (2) Construction of an engineered strain producing MT using N-acetyl-5-hydroxytryptamine as a substrate
[0054] The Crispr-Cas9 system was used to genetically integrate the N-acetylserotonin O-methyltransferase gene, ASMT. The nucleotide codon preference of the N-acetylserotonin O-methyltransferase mutant ASMT(M6) gene was similar to that of Escherichia coli. Considering codon compatibility, the ASMT(M6) gene nucleotide sequence was optimized using Yarrowia lipolytica to obtain the ASMT(M6) nucleotide sequence, as shown in SEQ ID NO. 10. The optimized gene was synthesized by Wuhan Jinkairui Bioengineering Co., Ltd.
[0055] First, the targeting gene plasmid pylcas9-ΔKu70-gRNA was constructed. The sequence position of the Ku70 gene was determined from the Ku70 gene sequence on the Yarrowia lipolytica genome published on the NCBI website, and the gRNA sequence was designed. Ku70-sgRNA-F / ku70-sgRNA-R were used as primers and the pylcas9 plasmid was used as a template for amplification. Subsequently, the plasmid was self-ligated using the T5 exo method to construct the pylcas9-ΔKu70-gRNA plasmid.
[0056] Secondly, with del-ku70-F1 / del-ku70-R1, del-ku70-F2 / del-ku70-R2 as primers, POlf genome as template, Ku70 gene upstream homologous arm and Ku70 gene downstream homologous arm were obtained; using ASMT-F / ASMT-R as primers, pUC57-Amp-ASMT(M6) plasmid as template to amplify ASMT gene fragment. Using the method of Overlap to carry out fusion PCR to obtain donor DNA fragment ΔKu70-ASMT(M6).
[0057] Then the plasmid pylcas9-ΔKu70-gRNA and fragment ΔKu70-ASMT(M6) were co-transformed into PO1f competent cells, and positive clones were screened by PCR. The strain was named YL005.
[0058] The preparation of Yarrowia lipolytica competent cells and transformation were basically carried out according to the Zymogen Frozen-EZ Yeast Transformation kit II kit instructions, which are briefly described as follows:
[0059] Preparation of competent cells: PO1f monoclonal was picked from freshly resuscitated plate in 10 ml of YPD medium, 30℃, 250 rpm incubated overnight, and the OD value of the bacterial solution was increased to 1.0, and the preparation of competent cells was carried out according to the instructions. When the volume of the YPD medium used was reduced, the Solution I and Solution II used in the preparation process were also reduced in the same proportion. The amount of DNA fragment and competent cells was mixed and incubated in 200 ul of Solution III at a ratio of 400 ng:20 ul. The primer sequences used are shown in the following table:
[0060] Primer name sequence ku70-sgRNA-F GcccttgcggacaataacccGTTTTAGAGCTAGAAATAGCAAG, SEQ ID No.11 ku70-sgRNA-R gggttattgtccgcaagggcACGTCAACCTGCGCCGACC, SEQ ID No.12 del-ku70-F1 tcgacggagaggctcaattg, SEQ ID No.13 del-ku70-R1 ATTTCAGTCTCCTCTTCACCActagggaggcacatctaaac, SEQ ID No.14 del-ku70-F2 TAAATTTAGTCTGCAGCCCAtttcaaaaagcggcggttcgt, SEQ ID No.15 del-ku70-R2 tcacgtgttctccacggcatt, SEQ ID No.16 ASMT-F TGGTGAAGAGGAGACTGAAATAGAGACCGGGTTGGCGG, SEQ ID No. 17 ASMT-R TGGGCTGCAGACTAAATTTACAGATGCATTCTTGGGCGG, SEQ ID No.18
[0061] (3) Strain YL005 feeding experiment with N-acetyl-5-hydroxytryptamine as substrate
[0062] YL005 positive monoclonal was picked from the transformation plate in transformation example 1(1) and inoculated into YPD (peptone 2%, yeast extract 1%, glucose 2%) seed medium, which was cultured at 30℃, 220 rpm for 16-20h to obtain seed solution; the seed solution was transferred to a 250ml triangular flask containing 25ml fermentation medium YP50 (peptone 2%, yeast extract 1%, glucose 5%) at an inoculation amount of 5% (v / v) for shaking fermentation, and the culture conditions were 30℃, 250 rpm, and the substrate N-acetyl-5-hydroxytryptamine was added at 5g / L at 0h, and the sample was taken for HPLC treatment after shaking culture for 120h.
[0063] The fermentation broth of strain YL005 after 120 h of fermentation was subjected to HPLC analysis according to the above method. The results are as follows: the substrate NAS remained at 3.12 g / L, and the MT yield was approximately 1.52 g / L.
[0064] Example 2 Construction and feeding experiment of MT-producing engineered strain using 5-hydroxytryptamine as substrate
[0065] Taking the Yarrowia lipolytica engineered strain YL005 as the starting strain, referring to the gene editing method of the engineered strain in Example 1 above, the gene SNAT encoding serotonin N-acetyltransferase was integrated into the genomic Ku80 gene site. SNAT is a gene encoding serotonin N-acetyltransferase, and its nucleotide sequence is shown in SEQ ID NO.03. The gene was synthesized by Jinkairui Biological Co., Ltd. onto the pUC57-Amp-SNAT plasmid. First, the pylcas9-ΔKu80 plasmid and the donor DNA fragment ΔKu80-ASMT were constructed, and then co-transformed into the YL005 strain. The positive single clone was screened by PCR, and the engineered strain was YL006. The specific primers used are shown in the following table:
[0066] Primer name sequence ku80-sgRNA-F cgtctttgctacatacaaggGTTTTAGAGCTAGAAATAGCAAG, SEQ ID No.19 ku80-sgRNA-R ccttgtatgtagcaaagacgACGTCAACCTGCGCCGACC, SEQ ID No.20 del-ku80-F1 GAGCCAACTTACAAGGCTCTGT, SEQ ID No.21 del-ku80-R1 ATTTCAGTCTCCTCTTCACCAGTGTAGATCCACCACATACAC, SEQ ID No. 22 del-ku80-F2 TAAATTTAGTCTGCAGCCCAGTTAATATATATATACAGTATATCG, SEQ ID No. 23 del-ku80-R2 ACGGTGACGGTGACCGAAACAT, SEQ ID No.24 SNAT-F TGGTGAAGAGGAGACTGAAAT, SEQ ID No.25 SNAT-R TGGGCTGCAGACTAAATTTA, SEQ ID No.26
[0067] Referring to the single-step feeding experiment in Example 1, positive single colonies from the transformation plates were selected and inoculated into YPD medium for activation. After activation, the cells were transferred to YP50 fermentation medium at a 5% inoculum size and 5 g / L of 5-hydroxytryptamine was added. After 120 hours of fermentation, liquid chromatography analysis was performed using the same HPLC analysis method as in Example 1. The peak time for 5-HT was approximately 6 minutes. HPLC analysis of the fermentation broth from the YL006 strain after 120 hours of fermentation revealed the following results: a residual 5-HT content of 1.36 g / L, NAS production of 1.12 g / L, and MT production of approximately 1.73 g / L.
[0068] Construction and feeding experiment of MT engineering strain with tryptophan as substrate
[0069] (1) Screening of tryptamine hydroxylase
[0070] Tryptamine hydroxylase catalyzes the production of 5-HT from tryptamine. The nucleotide sequences of the genes encoding tryptamine hydroxylase, ZMT5H (from Zeamays), JCT5H (from Jatropha curcas), and OsT5H (from Oryza sativa), are shown in SEQ ID NOs. 04-06, respectively. These three hydroxylase genes from different sources were codon-optimized and synthesized by Jinkairui Bioengineering Co., Ltd. onto the plasmids pUC57-Amp-ZMT5H, pUC57-Amp-JCT5H, and pUC57-Amp-OsT5H, respectively.
[0071] First, hp4d-ZMT5H-F / xpr2-ZMT5Hc-R, hp4d-JCT5H-F / xpr2-JCT5H-R, and hp4d-OsT5H-F / xpr2-OsT5H-R were used as primers, and pUC57-Amp-ZMT5H, pUC57-Amp-JCT5H, and pUC57-Amp-OsT5H were used as templates to amplify the ZMT5H, JCT5H, and OsT5H fragments containing the 1312 vector backbone and 20bp homologous sequence. Using primers xpr2-F and hp4d-R, the pINA1312 plasmid was used as a template to amplify the 1312-vector fragment. The ZMT5H, JCT5H, and OsT5H fragments were then ligated with the 1312-vector using the T5-EXO method to construct the pINA1312-ZMT5H, pINA1312-JCT5H, and pINA1312-OsT5H plasmids. The specific primer sequences used are as follows:
[0072] Primer name Sequence hp4d-OsT5H-F CACATACAACCACACACATCCACAATGGAGCTGACCATGGCCTCT, SEQ ID No. 27 xpr2-OsT5H-R AGGCCATGGAGGTACTTAGACCTCGGACAGCTCCTCGCCCTTG, SEQ ID No. 28 hp4d-ZMT5H-F CAACCACACACATCCACAATGGAGTTCATTCTGGTGTGTTC, SEQ ID No. 29 xpr2-ZMT5H-R ACAGGCCATGGAGGTACTTAGACGACCACGTCGGTGTCGCC, SEQ ID No. 30 hp4d-JCT5H-F CCACACACATCCACAATGGACCACTTCACCCCCACCATG, SEQ ID No. 31 xpr2-JCT5H-R AGGCCATGGAGGTACTTAGTCTCGGGACTGAATCTCGTCACC, SEQ ID No. 32 xpr2-F TAAgtaccTCCATGGCCTGTCC, SEQ ID No. 33 hp4d-R tgtgGATGTGTGTGGTTGTATGTG, SEQ ID No. 34
[0073] The constructed pINA1312-ZMT5H, pINA1312-JCT5H, and pINA1312-OsT5H plasmids were then digested using NEB's NotI Star Select enzyme. The resulting fragments were NotI-1312-ZMT5H, NotI-1312-JCT5H, and NotI-1312-OsT5H. Referring to Example 1 for yeast transformation and competent cell preparation, the fragments were transformed into the PO1f strain. PCR screening was performed to obtain engineered strains PO1f-ZMT5H, PO1f-JCT5H, and PO1f-OsT5H. The engineered strains were cultured in YPD medium for 16-18 hours to obtain seed liquid. 5% of the seed liquid was inoculated into YP50 medium for fermentation. The substrate tryptamine was added at 2 g / L at hour 0. After 120 hours of shaking culture, samples were collected for HPLC analysis.
[0074] Liquid chromatography detection was performed using a Hypersil ODS2 5µm column, ID 4.6mm x 250mm, detection wavelength 220nm, column oven temperature 40°C, mobile phase 30% methanol and 70% ammonium formate (chromatographic grade, pH 4.0, 5mM), run time 25min, with the Try peak eluting around 6.1min and the 5-HT peak eluting around 15min. Quantitative analysis by HPLC was performed using the area normalization method.
[0075] Shake flask fermentation was performed as described above, with 2 g / L tryptamine added as a substrate at 0 h for 5-HT synthesis. The fermentation broth from 120 h of fermentation was subjected to HPLC analysis, as shown below. These results indicate that only strains expressing the OsT5H gene-tryptamine hydroxylase can catalyze the synthesis of 5-HT from tryptamine.
[0076]
[0077]
[0078] (2) Construction and feeding experiments of MT-producing engineered strains using tryptamine as substrate
[0079] Referring to the Crispr gene editing method in Example 1, the engineered strain YL006 was used as the starting strain, and the gene encoding tryptamine hydroxylase OsT5H was integrated at the intC3 site. First, the pylcas9-intC3 plasmid and the donor DNA fragment were constructed.
[0080] intC3-OsT5H, and then co-transformed into the YL006 strain, and positive single clones were screened by PCR to obtain the engineered bacteria.
[0081] The specific primers used are shown in the following table:
[0082] Primer name Sequence intC3-sgRNA-F ttgttacgatcgtccttgtgGTTTTAGAGCTAGAAATAGCAAG, SEQ ID No. 35 intC3-sgRNA-R cacaaggacgatcgtaacaaACGTCAACCTGCGCCGACC, SEQ ID No. 36 intC3-F1 actgaggtcatgataaggagtg, SEQ ID No. 37 intC3-R1 TTTCAGTCTCCTCTTCACCatacagtgtctatcaacggggc, SEQ ID No. 38 intC3-F2 TAAATTTAGTCTGCAGCCCAgccatagcactattgtagagtgg, SEQ ID No. 39 intC3-R2 tgtatcatatcgcaccaaccgg, SEQ ID No. 40 OsT5H-F TGGTGAAGAGGAGACTGAAAT, SEQ ID No. 41 OsT5H-R TGGGCTGCAGACTAAATTTACATC, SEQ ID No. 42
[0083] Referring to the single-step feeding experiment in Example 1, a positive single colony from the transformation plate was selected and inoculated into YPD medium for activation. After activation, the culture was transferred to YP50 fermentation medium at a 5% inoculum size. 2 g / L of tryptamine was added, and liquid chromatography analysis was performed after 120 hours of fermentation. The HPLC analysis method was similar to that in Examples 1 and 2. The fermentation broth from the YL007 strain after 120 hours of fermentation was subjected to HPLC analysis. The results are shown below: no substrate residue was observed, 5-HT production was 0.21 g / L, NAS production was 0.34 g / L, and MT production was approximately 1.17 g / L.
[0084] Construction and feeding experiment of MT engineering strain with tryptophan as substrate
[0085] (1) Screening of aromatic amino acid decarboxylase
[0086] Aromatic amino acid decarboxylase can catalyze tryptophan to produce tryptamine. The nucleotide sequences of the genes encoding aromatic amino acid decarboxylase, Hsddc (from Homo sapiens), OsTDC (from Oryza sativa), and Crtdc (from Catharanthus roseus), are shown in SEQ ID NOs. 07-09. Decarboxylase genes from different sources were codon-optimized and synthesized by Jinkairui Bioengineering Co., Ltd. onto pUC57-Amp-Hsddc, pUC57-Amp-OsTDC, and pUC57-Amp-Crtdc plasmids, respectively. Reference Example 3 used pINA1269 plasmid as a template to construct pINA1269-Hsddc, pINA1269-OsTDC, and pINA1269-Crtdc plasmids. Specifically, the primer sequences used are as follows:
[0087]
[0088]
[0089] The engineered strains PO1f-Hsddc, PO1f-OsTDC, and PO1f-Crtdc were transformed into the PO1f strain and shake flask fermentation was performed according to the shake flask fermentation method in Example 3. 2 g / L of tryptophan was added at 0 h, and samples were taken for HPLC analysis after 120 h of shaking culture.
[0090] The results of HPLC analysis of the engineered strains PO1f-Hsddc, PO1f-OsTDC, and PO1f-Crtdc after fermentation for 120 hours are shown below. The results show that the strain expressing the decarboxylase Hsddc gene has the best effect in catalyzing the synthesis of tryptophan into tryptamine.
[0091] Strain Trp (Substrate Titer, g / L) Try(Product Titer,g / L) PO1f-Hsddc 1.06 0.63 PO1f-OsTDC 1.01 0.52 PO1f-Crtdc 1.13 0.37
[0092] (2) Construction and feeding experiments of MT-producing engineered strains using tryptophan as substrate
[0093] The engineered strain YL007 was used as the starting strain. Referring to Example 3(2), the gene Hsddc encoding aromatic amino acid decarboxylase was integrated into the intE1 site of the strain. First, the pylcas9-intE1 plasmid and the donor DNA fragment intE1-Hsddc were constructed, and then co-transformed into the YL007 strain. Positive single clones were screened by PCR, and the engineered strain YL701 was obtained. The specific primers used are shown in the following table:
[0094] Primer name Sequence 5'-3' intE1-sgRNA-F gtcgagcgagatgttctcagGTTTTAGAGCTAGAAATAGCAAG, SEQ ID No.49 intE1-sgRNA-R ctgagaacatctcgctcgacACGTCAACCTGCGCCGACC, SEQ ID No.50 intE1-F1 cactgttgattgcttcagttacc, SEQ ID No.51 intE1-R1 TTTCAGTCTCCTCTTCACCAaagcactatcctctgctgcg, SEQ ID No.52 intE1-F2 TAAATTTAGTCTGCAGCCCActccatagaacatagtagtctcag, SEQ ID No.53 intE1-R2 cttaaagcgatgtggcgcag, SEQ ID No.54 Hsddc-F TGGTGAAGAGGAGACTGAAAT, SEQ ID No.55 Hsddc-R TGGGCTGCAGACTAAATTTACATC, SEQ ID No.56
[0095] Referring to the feeding experiment in Example 1, several positive single colonies from the transformation plates were selected and inoculated into YPD medium for activation. After activation, the cells were transferred to YP50 fermentation medium at a 5% inoculum size and 2 g / L of tryptophan was added. After 120 hours of fermentation, liquid chromatography analysis was performed using the same HPLC analysis method as in Example 1. The results of HPLC analysis of the fermentation broth from the 120-hour fermentation of the YL701 strain are shown below: no substrate residue, essentially no tryptamine accumulation, 5-HT production of 0.16 g / L, NAS production of 0.25 g / L, and MT production of approximately 1.98 g / L.
[0096] Example 5: Trp was added to a 5 L fermentation tank of YL701-4 strain to produce MT
[0097] A single YL701-4 clone was picked from the plate and inoculated into a 2ml tube of YPD medium with shaking at 220 rpm at 30°C for 24 hours. The inoculation was then transferred to a 500ml Erlenmeyer flask containing 100ml of YPD medium and shaken for 16-18 hours to obtain the seed solution required for fermentation. The entire 100ml seed solution was transferred to an initial 2L fermentation medium containing 60g / L glucose, 15g / L (NH4)2SO4, 8g / L KH2PO4, 6.15g / L MgSO4, 12ml / L vitamins, and 10ml / L trace metal salts. The trace metal salt solution contains: 5.75 g / L ZnSO4*7H2O, 0.32 g / L MnCI2, 0.32 g / L CuSO4, 0.47 g / L CoCl2, 0.48 g / L Na2MoO4, 2.9 g / L CaCl2·2H2O, 2.8 g / L FeSO4*7H2O, and 0.5 M EDTA. The vitamin solution contains: 0.05 g / L biotin, 1 g / L calcium pantothenate, 1 g / L niacin, 25 g / L inositol, 1 g / L thiamine hydrochloride, 1 g / L pyridoxal phosphate, and 0.2 g / L p-aminobenzoic acid.
[0098] Feed medium: 700 g / L glucose, 10 ml / L trace metal salts, 10 ml / L vitamins; substrate tryptophan was co-added at 40 g / L.
[0099] The temperature of the fed-batch fermentation was 30° C., and the pH was controlled to 7.0-7.5 using NaOH. The glucose concentration was controlled to 10 g / L in the fed-batch fermentation, and the production of products was detected during the fermentation process.
[0100] Finally, the YL701-4 strain fermented and produced 30.7 g / L of MT, which is the highest level of MT synthesis reported so far.
Claims
1. An engineered strain of Yarrowia lipolytica that biosynthesizes N-acetyl-5-methoxytryptamine using tryptophan as a substrate, characterized in that: The engineered bacteria integrate the gene ddc encoding aromatic amino acid decarboxylase, the gene T5H encoding tryptamine hydroxylase, the gene SNAT encoding serotonin N-acetyltransferase, and the gene ASMT encoding an N-acetylserotonin O-methyltransferase mutant. The N-acetylserotonin O-methyltransferase mutant is an A160S / H321L / N322F mutant obtained by mutations at positions 160, 321, and 322 of the sequence shown in SEQ ID NO:
2.
2. The engineered Yarrowia lipolytica strain according to claim 1, characterized in that: The sequence of the gene ddc encoding aromatic amino acid decarboxylase is shown in any one of SEQ ID NOs: 7-9, the sequence of the gene T5H encoding tryptamine hydroxylase is shown in SEQ ID NO: 6, and the sequence of the gene SNAT encoding serotonin N-acetyltransferase is shown in SEQ ID NO:
3.
3. The engineered Yarrowia lipolytica according to claim 1, characterized in that: The sequence of the gene ASMT encoding the N-acetylserotonin O-methyltransferase mutant is shown in SEQ ID NO: 10; the sequence of the gene ddc encoding the aromatic amino acid decarboxylase is shown in SEQ ID NO:
7.
4. The method for constructing the engineered Yarrowia lipolytica according to claim 1, wherein: The yeast is obtained by co-introducing a recombinant vector comprising the gene ddc encoding aromatic amino acid decarboxylase and / or the gene T5H encoding tryptamine hydroxylase, and a recombinant vector comprising the gene ASMT encoding a mutant of N-acetylserotonin O-methyltransferase and / or the gene SNAT encoding serotonin N-acetyltransferase into Yarrowia lipolytica, or by integrating the gene encoding aromatic amino acid decarboxylase, the gene encoding tryptamine hydroxylase, the gene encoding serotonin N-acetyltransferase and the gene encoding a mutant of N-acetylserotonin O-methyltransferase into its genome.
5. Use of the engineered Yarrowia lipolytica strain according to claim 1 in the biosynthesis of N-acetyl-5-methoxytryptamine using tryptophan as a substrate.
6. The use according to claim 5, characterized in that: The application method is: Cultivating the engineered strain of Yarrowia lipolytica to obtain seed liquid; The seed liquid is inoculated into a fermentation medium containing glucose and metal elements and nutrients necessary for the growth of Yarrowia lipolytica, and fermentation is carried out in batches. The pH is controlled in the range of 7.0-7.5 during the fermentation process; and the glucose concentration is controlled in the range of 10-20 g / L by batch feeding.
7. An N-acetylserotonin O-methyltransferase mutant, characterized in that: The N-acetylserotonin O-methyltransferase mutant is an A160S / H321L / N322F mutant obtained by mutations at positions 160, 321, and 322 of the sequence shown in SEQ ID NO:
2.
8. A gene encoding the N-acetylserotonin O-methyltransferase mutant according to claim 7.