Molecular marker of BBOX1 gene related to anti-vibrio disease trait of penaeus vannamei and application thereof

Abstract

The application discloses a BBOX1 gene molecular marker related to the Vibrio resistance trait of Penaeus vannamei, which comprises any one or more of a molecular marker A, a molecular marker B and a molecular marker C, and the molecular markers are located on a gamma-butyrobetaine dioxygenase gene sequence of the Penaeus vannamei; the molecular marker is used as a functional marker of the Vibrio resistance trait of the Penaeus vannamei, the genomic DNA of muscle tissue of the Penaeus vannamei to be detected is extracted, and then the genomic DNA is used as template DNA to perform PCR amplification and purification of a PCR amplification product, and then the product is sequenced to determine the genotypes of the molecular marker A, the molecular marker B and the molecular marker C, so that the genotypic individuals with the Vibrio resistance advantage are screened to breed the Penaeus vannamei, the obtained result is accurate and has high application value, the breeding process of the fine variety with the Vibrio resistance trait can be accelerated, and the survival rate of the shrimp culture is improved, which has important significance.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of breeding of Penaeus vannamei, and particularly relates to a BBOX1 gene molecular marker related to an anti-Vibrio disease trait of Penaeus vannamei and application thereof. BACKGROUND

[0002] Vibrio disease caused by Vibrio parahaemolyticus is the most common and most harmful bacterial disease in the breeding of Penaeus vannamei, and its main symptoms are red legs or rotten gills, reduced or stopped appetite, decreased activity, and accompanied by intestinal inflammation, and finally leading to a large number of deaths, with a mortality rate of up to 100%.

[0003] L-carnitine is an intrinsic substance necessary for fat metabolism, which can increase the rate of beta-oxidation of fatty acids, promote the conversion of fat burning into energy, and reduce the content of serum cholesterol. In addition, it can also enhance the body's resistance and play an important role in the growth and development and reproduction of organisms. Gamma-butyrobetaine dioxygenase (BBOX1) belongs to the family of dioxygenases, which can catalyze the formation of L-carnitine from gamma-butyrobetaine, and is the last step in the biosynthetic pathway of L-carnitine. BBOX1 has the highest activity in human kidneys, and also exists in the liver and other tissues. Studies have shown that BBOX1 plays a key role in the transport of fatty acids across the mitochondrial membrane and plays an important role in the development of cancer.

[0004] In recent years, molecular-assisted breeding technology has developed rapidly and has become the main direction of new variety breeding. By using molecular markers closely related to target traits for selection, the economic traits of offspring can be quickly and accurately improved. Single nucleotide polymorphism (SNP) as the third generation of molecular markers has shown broad application prospects in breeding technology. In the breeding of Penaeus vannamei, SNP markers have been successfully applied, and molecular markers related to ammonia-nitrogen tolerance traits, nitrate tolerance traits and growth traits have been reported. However, due to the complexity of the genetic structure of the shrimp population, the existing markers are not enough to cover most of the strains, and there is a lack of SNP markers related to anti-Vibrio parahaemolyticus traits for genetic trait evaluation and genome selection analysis. SUMMARY

[0005] In view of the above, the application discloses a BBOX1 gene molecular marker related to the Vibrio disease resistance of Penaeus vannamei, a SNP molecular marker related to the Vibrio disease resistance of Penaeus vannamei is screened based on a gamma-butyrobetaine dioxygenase gene of the Penaeus vannamei, the SNP molecular marker is used as a functional marker of the Vibrio disease resistance of the Penaeus vannamei, and is used for breeding of a Penaeus vannamei variety with good Vibrio resistance.

[0006] The application is implemented by adopting the following technical scheme:

[0007] The BBOX1 gene molecular marker related to the Vibrio disease resistance of the Penaeus vannamei comprises a molecular marker A, a molecular marker B and a molecular marker C.

[0008] The molecular marker A is located at a 5700 bp site of a nucleotide sequence shown in sequence 1 in the sequence listing, is recorded as D.5700 G>A, the base of the site is A or G, and the mutation type is A / A homozygous type or G / G homozygous type.

[0009] The molecular marker B is located at a 5710 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, is recorded as D.5710 C>T, the base of the site is C or T, and the mutation type is C / C homozygous type or T / T homozygous type.

[0010] The molecular marker C is located at a 5715 bp site of the nucleotide sequence shown in sequence 1 in the sequence listing, is recorded as D.5715 T>A, the base of the site is A or T, and the mutation type is A / A homozygous type, A / T heterozygous type or T / T homozygous type.

[0011] The nucleotide sequence shown in sequence 1 in the sequence listing is a nucleotide sequence of a gamma-butyrobetaine dioxygenase gene.

[0012] The application of the BBOX1 gene molecular marker related to the Vibrio disease resistance of the Penaeus vannamei is that the molecular marker A, the molecular marker B and the molecular marker C are used for selective breeding of the Penaeus vannamei, specifically, genomic DNA of muscle tissue of a to-be-tested Penaeus vannamei is extracted, the genomic DNA is used as template DNA for PCR amplification and purification of a PCR amplification product, and then the PCR amplification product is sequenced to determine the genotypes of the molecular marker A, the molecular marker B and the molecular marker C.

[0013] When the genotype of the molecular marker A is the GG genotype of the dominant genotype, the individual is selected as a back parent for Penaeus vannamei breeding; when the genotype of the molecular marker B is the CC genotype of the dominant genotype, the individual is selected as a back parent for Penaeus vannamei breeding; when the genotype of the molecular marker C is the AA genotype of the dominant genotype, the individual is selected as a back parent for Penaeus vannamei breeding.

[0014] The present application extracts DNA from the appendage muscle tissue of Penaeus vannamei, which does not cause too much impact on the shrimp body. Breeding can be carried out by using the method of molecular assisted breeding, for example, using the method of gene knockout or gene editing to process the varieties obtained after the molecular marker.

[0015] In the PCR amplification process, the primer set for detecting the BBOX1 gene molecular marker of Penaeus vannamei includes primer F and primer R, the sequence of the primer F is GATTAAAAGAATCCCGTCTCCCTACTG (sequence 2 in the sequence listing), and the sequence of the primer R is CGACACTGACTTACTTTATAGTTGGTTCTTG (sequence 3 in the sequence listing).

[0016] The PCR amplification system is composed of the following components: 2.0 μL of 10×Taq buffer, 0.4 μL of dNTP (10 mmol / L each), 0.2 μL of Taq DNA polymerase with a concentration of 5 U / μL, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template DNA.

[0017] The reaction program of the PCR amplification includes the following steps:

[0018] S1, pre-denaturation at 95℃ for 5min;

[0019] S2, denaturation at 95℃ for 30s, annealing at 60℃ for 30s, extension at 72℃ for 30s, and 34 cycles;

[0020] S3, extension at 72℃ for 5min.

[0021] The present technical solution has the following beneficial effects compared with the prior art:

[0022] The application is based on a SNP molecular marker related to Vibrio parahaemolyticus resistance trait screened from a gamma-butyrobetaine dioxygenase gene of Penaeus vannamei, which can be applied to breeding of new Penaeus vannamei varieties resistant to Vibrio parahaemolyticus, and the genotypes of the selected individuals are stable and do not occur genetic differentiation, and the method has good breeding efficiency and accuracy, and provides a good basis for Penaeus vannamei variety breeding and improvement research. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 is a partial fragment sequence of the product obtained by amplifying the gamma-butyrobetaine dioxygenase gene in the examples, a represents the 121st to 125th positions, wherein the AA, GG peak value graph of the D. 5700 G>A site is shown; b represents the 131st to 135th positions, wherein the CC, TT peak value graph of the D. 5710 C>T site is shown; c represents the 136th to 140th positions, wherein the AA, AT, TT peak value graph of the D. 5715 T>A site is shown. DETAILED DESCRIPTION

[0024] The application is further illustrated by the following examples, but is not limited thereto. The specific experimental conditions and methods not specified in the following examples are generally conventional means known to those skilled in the art.

[0025] Example: The screening process of the BBOX1 gene molecular marker related to Vibrio parahaemolyticus resistance trait of Penaeus vannamei according to the application is as follows:

[0026] (1) 245 Penaeus vannamei with a body weight of about 20 grams were selected and temporarily raised for 5 days, and then 100 μL of Vibrio parahaemolyticus with a concentration of 7×10 6 cfu / mL was injected into the Penaeus vannamei individuals; in order to exclude the death caused by injection factors, the death individuals were recorded after 6 hours of challenge, and 60 Penaeus vannamei that died first and 60 Penaeus vannamei that still survived after 96 hours were selected as samples of the Vibrio parahaemolyticus sensitive group and the Vibrio parahaemolyticus resistant group, respectively;

[0027] (2) 5 Penaeus vannamei were randomly selected from the sensitive group and the resistant group, respectively, the muscle tissues were extracted, and the conventional phenol chloroform extraction method was used to extract the genomic DNA, and the obtained genomic DNA was stored at -20 °C for standby;

[0028] (3) The primer F and the primer R are designed according to the sequence of the gamma-butyrobetaine dioxygenase gene of Penaeus vannamei, and then the SNP site located in the gamma-butyrobetaine dioxygenase gene is amplified and screened;

[0029] The sequence of the primer F is GATTAAAAGAATCCCGTCTCCCTACTG.

[0030] The sequence of the primer R is CGACACTGACTTACTTTATAGTTGGTTCTTG.

[0031] The PCR amplification system is composed of the following components: 2.0 μL of 10×Taq buffer, 0.4 μL of dNTP (10 mmol / L each), 0.2 μL of Taq DNA polymerase (5 U / μL), 0.5 μL of the primer F, 0.5 μL of the primer R, 14.4 μL of ddH2O, and 2.0 μL of the template DNA.

[0032] The reaction procedure of the PCR amplification comprises the following steps:

[0033] S1, pre-denaturation at 95℃ for 5 min;

[0034] S2, denaturation at 95℃ for 30 s, annealing at 60℃ for 30 s, extension at 72℃ for 30 s, and 34 cycles;

[0035] S3, extension at 72℃ for 5 min;

[0036] (4) After the PCR amplification product is detected by 1% agarose gel electrophoresis, the product is purified and sequenced, the sequencing results are analyzed by using the DNAstar software, including nucleotide sequence alignment and peak graph analysis, and the related SNPs site is screened out; the sequence of the PCR amplification product of one sample is shown as follows:

[0037] GATTAAAAGAATCCCGTCTCCCTACTGTATCTCTAGGTCCAGCTGCTACACTGCATCAGCCAGTATGAAGGCCACGGAGGAGACAACCTCTTGGTGGACTCCTTCTGCGTCGCCGAGAAGCTGCGAGAAGTGCACCCTGAGAAATTCAAACTCCTCACAGACACTCTCGTCGACTTCTACGACATCGGTGTGGAAGATGGGATAAATTTCCATGCTATTAATCAAGAACCAACTATAAAGTAAGTCAGTGTCG, wherein position 123 is D. 5700 G>A, position 133 is D. 5710 C>T, and position 138 is D. 5328 5715 T>A;

[0038] 5) According to the screened SNP sites, the sensitive group and the resistant group of Penaeus vannamei were detected and genotyped according to the above method, respectively. The samples of different SNP sites in the sensitive group and the resistant group were counted, the genotype frequency and the allele frequency were calculated, and the independence test was carried out by chi-square analysis. The chi-square analysis results are shown in Table 1.

[0039] According to the analysis in Table 1, the dominant type of molecular marker A is GG genotype, the dominant type of molecular marker B is CC genotype, and the dominant type of molecular marker C is AA genotype.

[0040] Table 1: Chi-square analysis results of the sites

[0041]

[0042] In addition, it should be understood that although the present specification is described in terms of embodiments, not every embodiment contains only one independent technical solution, and the description of the specification is only for the sake of clarity. The skilled person should consider the specification as a whole, and the technical solutions in each embodiment can be appropriately combined to form other embodiments that can be understood by the skilled person.

Claims

1. The application of a molecular marker for the BBOX1 gene associated with resistance to Vibrio spp. in Litopenaeus vannamei, characterized in that: The molecular markers associated with the Vibrio resistance trait in Litopenaeus vannamei include molecular marker A, molecular marker B, and molecular marker C; The molecular marker A is located at the 5700 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D. 5700G>A. The base at this site is A or G, and the genotype is A / A homozygous or G / G homozygous. The molecular marker B is located at the 5710 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D.5710C>T. The base at this site is C or T, and the genotype is C / C homozygous or T / T homozygous. The molecular marker C is located at the 5715 bp site of the nucleotide sequence shown in Sequence 1 of the sequence listing, denoted as D. 5715T>A. The base at this site is A or T, and the genotypes are A / A homozygous, A / T heterozygous, and T / T homozygous. The application involves using molecular markers A, B, and C for selective breeding of Litopenaeus vannamei. Specifically, genomic DNA is first extracted from the muscle tissue of the Litopenaeus vannamei to be tested, then used as template DNA for PCR amplification and purification of the PCR amplification products. The obtained PCR amplification products are then sequenced to determine the genotypes of molecular markers A, B, and C. When the genotype of molecular marker A is the dominant genotype GG, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker B is the dominant genotype CC, that individual is selected as a backup parent for breeding Litopenaeus vannamei; when the genotype of molecular marker C is the dominant genotype AA, that individual is selected as a backup parent for breeding Litopenaeus vannamei. The breeding program aims to screen for Litopenaeus vannamei varieties with resistance to Vibrio parahaemolyticus.

2. The application of the BBOX1 gene molecular marker related to the Vibrio resistance trait in Litopenaeus vannamei according to claim 1, characterized in that: During the PCR amplification process, the primer set used to detect the molecular marker of the BBOX1 gene in Litopenaeus vannamei includes primer F and primer R. The sequence of primer F is GATTAAAAGAATCCCGTCTCCCTACTG, and the sequence of primer R is CGACACTGACTTACTTTATAGTTGGTTCTTG.

3. The application of the BBOX1 gene molecular marker related to the vibrio resistance trait in Litopenaeus vannamei according to claim 2, characterized in that: The PCR amplification system consists of the following components: 2.0 μL of 10×Taq buffer, 0.4 μL of dNTPs, 0.2 μL of Taq DNA polymerase at a concentration of 5 U / μL, 0.5 μL of primer F, 0.5 μL of primer R, 14.4 μL of ddH2O, and 2.0 μL of template DNA.

4. The application of the BBOX1 gene molecular marker related to the Vibrio resistance trait in Litopenaeus vannamei according to claim 1, characterized in that: The PCR amplification reaction procedure includes the following steps: S1. Pre-denaturate at 95℃ for 5 min; S2. Perform 34 cycles of denaturation at 95℃ for 30s, annealing at 60℃ for 30s, and extension at 72℃ for 30s. S3, extend at 72℃ for 5 minutes.

Images