Use of Parabacteroides in the treatment of psoriasis

Abstract

The present application relates to the technical field of exosome application, and specifically discloses a psoriasis treatment use of Parabacteroides exosomes. The Parabacteroides is selected from any one or more of Parabacteroides distasonis, Parabacteroides gordonii, Parabacteroides johnsonii, Parabacteroides merdae and Parabacteroides goldsteinii. The exosomes of the present application, especially Parabacteroides goldsteinii, have excellent effects in treating psoriasis.

Description

Technical Field

[0001] The present application relates to the technical field of exosome application, and more specifically, to the use of Parabacteroides in the treatment of psoriasis. Background Art

[0002] Psoriasis is an innate and adaptive immune system disease. It is a common chronic, relapsing skin disease with clinical symptoms of papules covered with multiple layers of silvery-white scales. Keratinocytes, dendritic cells and T cells play a core role in the disease. Recent studies have shown that psoriasis is associated with many complications, especially metabolic diseases. Intestinal microorganisms not only have an important impact on psoriasis, but also have a regulatory effect on host metabolism and obesity. Studies have shown that the intestinal microbiota plays a key role in maintaining the integrity of the epithelial barrier and forming the mucosal immune system to fight exogenous pathogens.

[0003] At present, the treatment methods for psoriasis include topical medication and oral medication. Among them, topical medications include: emollients, glucocorticoid creams or ointments, vitamin A preparations, vitamin D3 derivatives, salicylic acid ointments, tar preparations, anthralin ointments and compound preparations. Topical medications are generally applied to the symptom site to achieve the purpose of alleviating and treating the disease. They have the advantages of fast onset and few systemic adverse reactions. However, local adverse reactions may occur after long-term application, it is inconvenient for patients with widespread skin lesions to apply, and there are large differences in patient compliance. In addition, for patients with severe conditions and large areas of skin lesions, there is no good treatment effect, and oral medications are needed for combined treatment. Among them, oral medications include: immunosuppressants, biological agents (targeted immunomodulatory preparations), antibiotics and hormone drugs. However, this type of drug has problems such as large side effects and repeated illness. For example, long-term use of immunosuppressive drugs such as methotrexate will cause greater damage to the liver, stomach and kidneys; for example, after taking hormone drugs, the drug is discontinued, and the recurrence of the disease is more significant.

[0004] Therefore, it is necessary to develop new uses for treating psoriasis, which can provide a new direction for improving the problem that current topical drugs cannot completely cure the disease. Summary of the invention

[0005] The present application provides a use of Parabacteroides in the treatment of psoriasis; Parabacteroides exosomes introduce new genes or proteins to improve psoriasis at the genetic level, providing a new direction for the treatment of psoriasis.

[0006] The present application provides a method for treating psoriasis with Parabacteroides exosomes using the following technical solution:

[0007] A method for treating psoriasis with exosomes of Parabacteroides, wherein the Parabacteroides is selected from Parabacteroides distilogenes ( Parabacteroides distasonis), Parabacteroides gordonii ( Parabacteroides gordonii ), Parabacteroides johnsonii ( Parabacteroides johnsonii ), Parabacteroides faecium ( Parabacteroides merdae ) and Parabacteroides gordonii ( Parabacteroides goldsteinii ) any one or more of ).

[0008] The interleukin (IL)-23 / Th17 axis in patients with psoriasis has received increasing attention because IL-23 drives the differentiation of Th17 cells, which then produce IL-22 and IL-17; these inflammatory cytokines, especially IL-17, accelerate the development of psoriasis. Therefore, it is of great significance to explore the IL-23 / Th17 axis for the treatment of psoriasis. Bacterial extracellular vesicles (OMVs) are spherical nanovesicles formed by the outward protrusion of the outer membrane of bacteria during growth. The particle size is 10~300nm, mainly composed of phospholipids, proteins, lipopolysaccharides (LPS), nucleic acids and bacterial metabolites. They play a key role in intercellular communication by transporting bioactive molecules (proteins, nucleic acids, lipids, metabolites) from donor cells to recipient cells. These active molecules enter the host, bind to certain receptor cell proteins, and produce an immune response. Among them, this application shows that Parabacteroides has a therapeutic effect on psoriasis.

[0009] Optionally, the Parabacteroides is Parabacteroides gordonii ( Parabacteroides goldsteinii ).

[0010] Parabacteroides gordonii ( Parabacteroides goldsteinii, Abbreviation P. goldsteinii ) is a new type of intestinal symbiotic probiotic, oral P. goldsteinii It can treat obesity and related metabolic disorders in mice, reduce inflammation and insulin resistance. This application verifies the probiotics from the intestine through mouse experiments. P. goldsteinii The extracellular vesicles (PG-OMVs) can improve the symptoms of psoriasis model mice. The results of H&E staining showed that the epidermal skin of psoriasis model mice became thinner, the invasion of the spinous part into the dermis was reduced, and the skin damage was alleviated. In other words, after PG-OMVs acted on psoriasis model mice, they could significantly improve the psoriasis symptoms of psoriasis model mice. In addition, the PG-OMVs can significantly improve the expression levels of related pro-inflammatory factors at the mRNA level, such as IL-1β and IL-23 / IL-17 axis-related cytokines (IL-23α, IL-22, IL-17A, IL17F). In other words, the PG-OMVs have the potential to target and cure psoriasis.

[0011] Optionally, when the Parabacteroides exosomes are used to treat psoriasis, they are prepared into a pharmaceutical composition for use, and the dosage form of the pharmaceutical composition is selected from any one or more of microneedles, sprays, solutions, gelatin capsules, soft capsules, lozenges, chewing gum and dry powder preparations.

[0012] When the Parabacteroides exosomes of the present application are used to treat acute lung injury, they can be prepared into various administrable pharmaceutical dosage forms in the form of pharmaceutical compositions. Specific pharmaceutical dosage forms include but are not limited to those listed above, and any pharmaceutical dosage forms that can achieve the effect of Parabacteroides exosomes are acceptable.

[0013] Optionally, the components in the pharmaceutical composition further include other auxiliary components, and the other auxiliary components are selected from one or more of probiotics, adjuvants, excipients, auxiliary agents, dispersants, food additives and pharmaceutical additives.

[0014] When used to treat acute lung injury, the Parabacteroides exosomes of the present application can be prepared into a pharmaceutical composition, and the above-listed substances can be added to the pharmaceutical composition to satisfy the desired pharmaceutical dosage form. In addition, other strains that do not affect the effect, such as probiotics, can be added to the pharmaceutical composition, which is also within the scope of protection of the present application.

[0015] Optionally, the Parabacteroides exosomes are isolated from Parabacteroides culture fluid;

[0016] When the Parabacteroides is Parabacteroides gordonii, the method for preparing the Parabacteroides gordonii culture solution comprises the following steps:

[0017] The Parabacteroides gordonii is inoculated into the culture medium and anaerobically cultured at 34-38°C for 65-80 hours to obtain the product.

[0018] Optionally, the anaerobic culture environment includes the following gas components in volume percentage:

[0019] 3-7% hydrogen, 8-12% carbon dioxide and the balance nitrogen.

[0020] Optionally, the components of the culture medium include:

[0021] 0.5-1.5 mg / mL L-cysteine, 30-42 mg / mL brain heart infusion broth, 0.005-0.015 mL / mL 0.02-0.08 wt% hemin solution, and 0.01-0.03 mL / mL 7-13 wt% sodium bicarbonate solution.

[0022] Optionally, the method for preparing Parabacteroides exosomes comprises the following steps:

[0023] The Parabacteroides culture fluid is subjected to solid-liquid separation to obtain exosome fluid, and the exosome fluid is concentrated and purified to obtain;

[0024] The solid-liquid separation step includes filtration, dialysis and microfiltration.

[0025] Optionally, the filtration includes filtering with a filter screen or filter bag with a pore size range of 250-350 mesh, and collecting the filtrate; the dialysis includes filtering with a membrane with a pore size of 100-200nm, and collecting the dialysate; the microfiltration includes filtering with a membrane with a pore size of 0.4-0.55μm, and collecting the filtrate.

[0026] Optionally, the purification comprises purification using a size exclusion chromatography column.

[0027] In summary, this application has the following beneficial effects:

[0028] The present application provides a new use of Parabacteroides in the treatment of psoriasis, especially Parabacteroides gordonii, which can significantly improve the skin symptoms of psoriasis model mice and inhibit the expression of related pro-inflammatory factors at the mRNA level, so as to achieve the purpose of treating psoriasis. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 is the concentration and particle size distribution diagram of the exosome fluid obtained in Example 2;

[0030] Figure 2 This is an electron microscopic image of the exosomes in Example 2;

[0031] Figure 3 This is a standard curve diagram for the determination of exosome protein in Example 2;

[0032] Figure 4 is an H&E staining image of mice after administration of the exosomes of Example 2;

[0033] Figure 5 The expression of psoriasis-related inflammatory factor mRNA in mice after administration of the exosomes of Example 2. DETAILED DESCRIPTION

[0034] The present application is further described in detail below in conjunction with the accompanying drawings and examples. It is particularly noted that if no specific conditions are specified in the following examples, the experiments are carried out under conventional conditions or conditions recommended by the manufacturer. Unless otherwise specified, the raw materials used in the following examples can all be sourced from common commercial sources.

[0035] Parabacteroides gordonii, Parabacteroides goldsteinii, which is commercially available, product number: ATCC BAA-1180; hemin, purchased from Shanghai Aladdin Biochemical Technology Co., Ltd., product number H140872. L-cysteine, purchased from Beijing Solebow Technology Co., Ltd., product number C0012. Brain heart infusion broth, referred to as BHI, was purchased from Guangdong Huankai Microbiological Technology Co., Ltd., product number 024053.

[0036] When the Parabacteroides exosomes of the present application are used to treat psoriasis, they are prepared into a pharmaceutical composition for use; wherein the dosage form of the pharmaceutical composition is selected from any one or more of microneedles, sprays, solutions, gelatin capsules, soft capsules, lozenges, chewing gum, and dry powder preparations.

[0037] Furthermore, the components in the pharmaceutical composition also include other auxiliary components; the other auxiliary components are selected from one or more of probiotics, adjuvants, excipients, auxiliary agents, dispersants, food additives and pharmaceutical additives. Example

[0038] Preparation of Parabacteroides gordonii exosomes, the specific method is:

[0039] 1. Place Parabacteroides gordonii on a culture medium and culture it in an anaerobic incubator at 34°C for 80 hours, and collect the bacterial solution; wherein the gas composition in the anaerobic incubator is: 3Vol.% H2, 12Vol.% CO2, and 85Vol.% N2. The components of the culture medium are: 0.5mg / mL L-cysteine, 30mg / mL brain heart infusion broth, 0.005mL / mL 0.02wt% hemin solution, and 0.01mL / mL 7wt% sodium bicarbonate solution.

[0040] 2. The bacterial solution was subjected to PEG precipitation to extract the extracellular vesicles of bacteria to obtain the exosomes of Parabacteroides gordonii, which were abbreviated as PG-OMVs. The details are as follows:

[0041] S1. Centrifuge the bacterial solution, collect the supernatant, coarsely filter the supernatant through a flange positive pressure filter bag (300 mesh), and collect the filtrate; finely filter the filtrate through a ceramic membrane (100-200nm membrane core, pressure 0.2MPa), and collect the dialysate; filter the dialysate through a disc two-phase filter microporous membrane (PVDF material, 0.45μm), and collect the filtrate.

[0042] S2. The filtrate finally obtained in S1 is concentrated by tangential flow (PES material, 100KD) and the concentrate is collected.

[0043] S3. Purify the concentrated solution finally obtained from S2 through a size exclusion chromatography column (cross-linked agarose, CL-6B), and collect the eluate.

[0044] S4. The eluate finally obtained from S3 was subjected to ultracentrifugation (10,000 × g, 4°C, 60 min) to precipitate, the supernatant was removed, the precipitate was resuspended with 2000 μL of pre-cooled PBS buffer, and then filtered with a 0.22 μm filter to obtain PG-OMVs.

[0045] Preparation of Parabacteroides gordonii exosomes, the specific method is:

[0046] 1. Take Parabacteroides gordonii and place it on the culture medium. Incubate it in an anaerobic incubator at 37°C for 72 hours and collect the bacterial solution. The gas composition in the anaerobic incubator is: 5Vol.% H2, 10Vol.% CO2 and 85Vol.% N2. The components of the culture medium are: 1.0mg / mL L-cysteine, 37mg / mL brain heart infusion broth, 0.01mL / mL 0.05wt% hemin solution, and 0.02mL / mL 10wt% sodium bicarbonate solution.

[0047] 2. The bacterial liquid was subjected to PEG precipitation method to extract the extracellular vesicles of bacteria to obtain the exosomes of Parabacteroides gordonii, which were abbreviated as PG-OMVs; the details were as described in Example 1.

[0048] Preparation of Parabacteroides gordonii exosomes, the specific method is:

[0049] 1. Take Parabacteroides gordonii and place it on the culture medium. Incubate it in an anaerobic incubator at 38°C for 65 hours and collect the bacterial liquid. The gas composition in the anaerobic incubator is: 7Vol.% H2, 8Vol.% CO2 and 85Vol.% N2. The components of the culture medium are: 1.5mg / mL L-cysteine, 42mg / mL brain heart infusion broth, 0.015mL / mL 0.08wt% hemin solution, and 0.03mL / mL 13wt% sodium bicarbonate solution.

[0050] 2. The bacterial liquid was subjected to PEG precipitation method to extract the extracellular vesicles of bacteria to obtain the exosomes of Parabacteroides gordonii, which were abbreviated as PG-OMVs; the details were as described in Example 1.

[0051] The difference between this embodiment and embodiment 2 is that the Parabacteroides selected is the exosomes of Parabacteroides dissimilar, and Parabacteroides dissimilar is obtained by culturing in a conventional manner. The exosomes of Parabacteroides dissimilar are obtained by referring to the method of embodiment 1. The method for obtaining the exosomes of Parabacteroides dissimilar is specifically as follows:

[0052] S1. Centrifuge the bacterial solution, collect the supernatant, coarsely filter the supernatant through a flange positive pressure filter bag (300 mesh), and collect the filtrate; finely filter the filtrate through a ceramic membrane (100-200nm membrane core, pressure 0.2MPa), and collect the dialysate; filter the dialysate through a disc two-phase filter microporous membrane (PVDF material, 0.45μm), and collect the filtrate.

[0053] S2. The filtrate finally obtained in S1 is concentrated by tangential flow (PES material, 100KD) and the concentrate is collected.

[0054] S3. Purify the concentrated solution finally obtained from S2 through a size exclusion chromatography column (cross-linked agarose, CL-6B), and collect the eluate.

[0055] S4. The eluate finally obtained from S3 was subjected to ultracentrifugation (10000×g, 4°C, 60min) to precipitate, the supernatant was removed, the precipitate was resuspended with 2000μL pre-cooled PBS buffer, and then filtered with a 0.22μm filter to obtain the exosomes of Parabacteroides distichum.

[0056] The difference between this embodiment and embodiment 2 is that the Parabacteroides selected is the exosomes of Parabacteroides johnsonii, and Parabacteroides johnsonii is obtained by culturing in a conventional manner. The exosomes of Parabacteroides johnsonii are obtained by referring to the method of embodiment 1. The method for obtaining the exosomes of Parabacteroides johnsonii is specifically as follows:

[0057] S1. Centrifuge the bacterial solution, collect the supernatant, coarsely filter the supernatant through a flange positive pressure filter bag (300 mesh), and collect the filtrate; finely filter the filtrate through a ceramic membrane (100-200nm membrane core, pressure 0.2MPa), and collect the dialysate; filter the dialysate through a disc two-phase filter microporous membrane (PVDF material, 0.45μm), and collect the filtrate.

[0058] S2. The filtrate finally obtained in S1 is concentrated by tangential flow (PES material, 100KD) and the concentrate is collected.

[0059] S3. Purify the concentrated solution finally obtained from S2 through a size exclusion chromatography column (cross-linked agarose, CL-6B), and collect the eluate.

[0060] S4. The eluate finally obtained from S3 was subjected to ultracentrifugation (10000×g, 4°C, 60min) to precipitate, the supernatant was removed, the precipitate was resuspended with 2000μL pre-cooled PBS buffer, and then filtered with a 0.22μm filter to obtain the exosomes of Parabacteroides johnsonii.

[0061] The difference between this embodiment and embodiment 2 is that the Parabacteroides selected is the exosomes of Parabacteroides gordonii, and Parabacteroides gordonii is obtained by culturing in a conventional manner. The exosomes of Parabacteroides gordonii are obtained by referring to the method of embodiment 1. The method for obtaining the exosomes of Parabacteroides gordonii is specifically as follows:

[0062] S1. Centrifuge the bacterial solution, collect the supernatant, coarsely filter the supernatant through a flange positive pressure filter bag (300 mesh), and collect the filtrate; finely filter the filtrate through a ceramic membrane (100-200nm membrane core, pressure 0.2MPa), and collect the dialysate; filter the dialysate through a disc two-phase filter microporous membrane (PVDF material, 0.45μm), and collect the filtrate.

[0063] S2. The filtrate finally obtained in S1 is concentrated by tangential flow (PES material, 100KD) and the concentrate is collected.

[0064] S3. Purify the concentrated solution finally obtained from S2 through a size exclusion chromatography column (cross-linked agarose, CL-6B), and collect the eluate.

[0065] S4. The eluate finally obtained from S3 was subjected to ultracentrifugation (10,000 × g, 4°C, 60 min) to precipitate, the supernatant was removed, the precipitate was resuspended with 2000 μL of pre-cooled PBS buffer, and then filtered with a 0.22 μm filter to obtain the exosomes of Parabacteroides gordonii.

[0066] 1. Exosome sample determination

[0067] The PG-OMVs of Example 2 were tested below, and the specific method and test results are as follows.

[0068] (1) PG-OMVs particle size analysis: Take out 10μL of PG-OMVs and dilute it to 30μL. Use standard products to test the instrument performance and then load the exosome sample. Note that gradient dilution is required to avoid clogging the injection needle. After the sample is tested, the particle size and concentration information of the exosome detected by the instrument can be obtained. The average particle size of PG-OMVs is 84.9nm and the concentration is 7.9×10 12 / mL, particle size and concentration diagram is shown in Figure 1 .

[0069] (2) Electron microscopy test of PG-OMVs: 20 μL of PG-OMVs was used for electron microscopy test. The specific results are shown in Figure 2 . This field of view shows the coexistence of cells and exosomes.

[0070] (3) Protein extraction and concentration determination of PG-OMVs: The protein concentration of exosomes was determined by BCA. The specific steps are as follows: rapidly thaw the exosomes at 37°C and quickly add 5× RIPA lysis buffer; mix well and lyse on ice for 30 minutes, mixing well during the process; prepare the standard sample for measuring protein concentration by BCA method, and take 20 μL of the diluted sample and add it to the BCA mixed solution, mix well; incubate at 37°C for 30 minutes, detect the absorbance at OD562nm on the microplate reader and record it; calculate the protein concentration of the sample to be tested according to the standard curve. The standard curve is shown in Figure 3 After testing, the optical density (OD 562nm ) was 0.404; before dilution, the protein concentration was 6.64μg / μL; after 8-fold dilution and addition of lysis buffer, the protein concentration was 0.66μg / μL.

[0071] (4) Sterility test of PG-OMVs: Take 5 mL of LB medium, add 10 μL of exosomes, culture on a shaker at 37°C for 24 hours, and observe the contamination. The results showed that there were no foreign bacteria in the exosome samples.

[0072] 2. Animal experiments

[0073] The PG-OMVs of Example 2 were tested below, and the specific methods and test results are as follows. BALB / c mice aged 6-8 weeks were divided into four groups, namely: Control group, IMQ group, IMQ-G group and IMQ-GO group, with 6 mice in each group. The hair of each mouse was removed. In the IMQ group, IMQ-G group, and IMQ-GO group, 62.5 mg of imiquimod (IMQ for short) cream was applied with a scraper every day for 7 consecutive days to form a psoriasis-like model in the mice, while the Control group was applied with vaseline. On the 5th day, the mice in the IMQ-GO group were orally administered with a mixture of PG-OMVs and PF-127 hydrogel (PF-127 hydrogel was purchased from Sigma, product number 9003-11-6), PG-OMVs (concentration of 7.9×10 12 The dosage of 25 mg / kg was 25 mg / mL. The IMQ-G group took the same volume of hydrogel mixed with saline. All mice were killed on the eighth day.

[0074] H&E staining experiment

[0075] I. Embedding process

[0076] On the 8th day of the experiment, the skin specimens from the back of the mice were obtained. Before embedding, the tissues were washed overnight with running water to remove the residual fixative, and then dehydrated, transparentized and wax-impregnated according to the procedures in Table 1.

[0077] Table 1 Dehydration, clearing and wax dipping procedures

[0078] 50Vol.% ethanol 1 h 75Vol.%Ethanol 1 h (or long-term storage at 4 °C) 85Vol.%Ethanol 30 min 95Vol.%EthanolⅠ 30 min 95Vol.%EthanolⅡ 90 min 100Vol.%EthanolⅠ 10 min 100Vol.% Ethanol Ⅱ 10 min Xylene Ⅰ 5 min Xylene Ⅱ 5 min Xylene Ⅲ 5 min Paraffin I 20 min Paraffin II 10 min Paraffin III 10 min

[0079] II. H&E staining

[0080] II-I. Preparation of paraffin sections. Set the section thickness to 5 μm and slice. After cutting, rinse the slices in 30 Vol.% ethanol solution, spread the slices in 48°C warm water, and bake them in a 60°C constant temperature oven for 2 hours.

[0081] II-II. Refer to Table 2 for the dewaxing and rehydration procedures of the sections.

[0082] Table 2 Dewaxing and rehydration procedures for sections

[0083] Xylene I 10min Xylene II 10min Xylene 1: 100% alcohol I 5min 100Vol.% Alcohol I 5min 100Vol.% Alcohol II 5min 95Vol.% Alcohol 5min 80Vol.% Alcohol 5min 70Vol.% Alcohol 5min Tap water 5min

[0084] II-III. Stain with hematoxylin solution for 5 minutes and wash quickly with tap water.

[0085] II-IV, separate with 0.5% hydrochloric acid ethanol for 1-2 seconds, and quickly wash with distilled water.

[0086] II-V. Re-blue with 1wt% ammonia solution. Immerse the slices in 1wt% ammonia solution until the tissue turns blue. Wash with tap water for 30-60s and check the degree of cell nucleus color separation under a microscope.

[0087] II-VI, use 1wt% eosin for 15s, and then quickly wash with distilled water.

[0088] II-VII, rapid washing with 80Vol.%, 90Vol.%, and 95Vol.% ethanol solutions, respectively, for 10s at each level, and then monitoring the color contrast between the cell nucleus and cytoplasm under a microscope.

[0089] II-VIII. Wash twice with 100 Vol.% ethanol solution, 2 min each time.

[0090] II-IX, wash twice with xylene, 2 min each time, and seal with neutral gum.

[0091] II-X. Take photos of the samples for archiving, observe the staining results, and calculate the skin epidermal thickness.

[0092] The specific staining results are as follows Figure 4 shown.

[0093] To analyze the effects of PG-OMVs, hematoxylin and eosin staining was performed on the injured skin of mice. Figure 4As shown in the figure, compared with the Control group, the epidermal area of ​​the skin of the psoriasis model mice (IMQ group) after IMQ treatment increased significantly due to the excessive proliferation of keratinocytes, and the spinous layer thickened and invaded the dermis. The epidermal thickness of the mice on the back was subsequently measured, and the epidermal thickness of the mice in the IMQ group was significantly thickened compared with that in the Control group. There was no significant difference in the data between the IMQ group and the IMQ-G group, indicating that the hydrogel had no effect on psoriasis; by comparing the hematoxylin and eosin staining results of the IMQ group and the IMQ-GO group, it was found that after treatment with PG-OMVs, the epidermal skin of the mice in the IMQ-GO group became thinner, the invasion of the spinous part into the dermis was reduced, and the skin damage was alleviated, indicating that the application of PG-OMVs to psoriasis-like mice induced by imiquimod (IMQ) reduced the pathological characteristics of the mouse skin, and PG-OMVs had the effect of alleviating psoriasis.

[0094] 3. Determination of mRNA expression of inflammatory factors

[0095] (1) Tissue RNA extraction

[0096] I. Tissue Grinding

[0097] On the 8th day of the experiment, skin specimens from the injured area on the back of the mice were obtained for tissue RNA extraction.

[0098] Pre-treat the grinding tube, scissors, tweezers and grinding beads with DEPC-H2O (ultrapure water treated with diethylpyrocarbonate and sterilized by high temperature and high pressure, colorless liquid). Before grinding, pre-cool the grinding tube and adapter in -80℃. Prepare a 2mL centrifuge tube, add 2 6mm beads, cut the sample into small pieces of about 1-2mm, add them to the tube, cover the tube tightly and freeze it in liquid nitrogen for 60s, then add 1mL TRIzol reagent. Put the grinding tube into the adapter, place it symmetrically to keep the load flat, and finally install the test tube clamp and tighten the fixing nut. Start grinding, and take out the grinding tube containing the sample after it is finished.

[0099] II. Separation stage

[0100] The homogenized sample was placed at room temperature for 5 minutes to completely separate the nucleic acid-protein complex. 0.2 mL of chloroform was added to each 1 mL of TRIzol, and the mixture was shaken and mixed for 30 seconds. After standing at room temperature for 10 minutes, the mixture was centrifuged at 12000 g / min at low temperature (4°C) for 15 minutes. The sample was divided into three layers: the bottom layer was an organic phase, the upper layer was a colorless layer, and an intermediate layer was used. RNA was mainly in the upper aqueous phase, and the volume of the aqueous phase was about 50% of the TRIzol reagent used.

[0101] III. RNA precipitation

[0102] Pipette the upper aqueous phase into a new centrifuge tube, add 0.5 mL of isopropanol to every 1 mL of TRIzol, mix gently, let stand at room temperature for 10 min, and centrifuge at 12000 g / min at low temperature (4°C) for 10 min. After centrifugation, the RNA precipitate is collected on the side of the bottom of the centrifuge tube. The RNA precipitate is white and slightly transparent and is not easy to observe. The RNA precipitate is usually not visible before centrifugation, forming a gelatinous flaky precipitate attached to the wall and bottom of the test tube.

[0103] IV. Elution of RNA

[0104] Add at least 1 mL of pre-cooled 75 Vol.% ethanol to every 1 mL of TRIzol. Mix well and centrifuge at 7500g / min for 5 minutes at low temperature (4°C). After centrifugation, discard the waste liquid, open the cap of the centrifuge tube, turn it upside down on the filter paper, and leave it to dry at room temperature or vacuum dry the RNA precipitate for about 8 minutes to dry the RNA precipitate.

[0105] V. Redissolution of RNA

[0106] When the RNA precipitate becomes translucent, add 50 μL DEPC-H2O to the centrifuge tube to dissolve the RNA precipitate.

[0107] VI. RNA concentration determination

[0108] Use a spectrophotometer to test the RNA solution and keep a record of the sample name, concentration, and purity.

[0109] (2) Reverse transcription-polymerase chain reaction

[0110] The following reactions were performed using Vazyme's HiScript Ш qRT SuperMix for qPCR kit.

[0111] I. Genomic DNA Removal

[0112] Prepare the mixed solution 1 shown in Table 3 in an RNase-free centrifuge tube; then gently pipette to mix, and incubate at 42°C for 2 minutes.

[0113] Table 3 Components of mixed solution 1

[0114] <![CDATA[RNase-free ddH2O]]> Add to 16 μL 4×gDNA wiper Mix 4μL Template RNA Total RNA: 500 pg

[0115] II. Configure the reverse transcription reaction system

[0116] Directly add 4 μL of 5×HiScript Ш qRT SuperMix to the reaction tube in the first step and mix gently by pipetting.

[0117] III. Perform reverse transcription reaction: Incubate the mixture obtained in II at 37°C for 15 minutes, then incubate at 85°C for 5 seconds to obtain the product. Store the product at -20°C and use it within half a year; for long-term storage, store it at -80°C after aliquoting. Avoid repeated freezing and thawing of cDNA.

[0118] (3) Real-time fluorescence quantitative PCR

[0119] This part of the experiment was performed using Vazyme's ChamQ Universal SYBR qPCR Master Mix kit. Primers were designed as shown in Table 4.

[0120] Table 4 Primer information

[0121] Primer name sequence Serial Number β-actin-F ACGGCCAGGTCATCACTATTG SEQ ID NO:1 β-actin-R TGGAAAAGAGCCTCAGGGC SEQ ID NO:2 TNF-α-F CTTCTGTCTACTGAACTTCGGG SEQ ID NO:3 TNF-α-R CAGGCTTGTCACTCGAATTTTG SEQ ID NO:4 IL-1β-F GAGGACATGAGCACCTTCTTT SEQ ID NO:5 IL-1β-R GCCTGTAGTGCAGTTGTCTAA SEQ ID NO:6 IL-23a(p19)-F CCCGTATCCAGTGTGAAGATG SEQ ID NO:7 IL-23a(p19)-R GGCTCCCCTTTGAAGATGTC SEQ ID NO:8 IL-22-F CGACCAGAACATCCAGAAGAA SEQ ID NO:9 IL-22-R GAGACATAAACAGCAGGTCCA SEQ ID NO:10 IL-17A-F CAAACATGAGTCCAGGGAGAG SEQ ID NO:11 IL-17A-R ACACGCTCTGAGCTTGAGG SEQ ID NO:12 IL-17F-F GTCGCCATTCAGCAAGAAATC SEQ ID NO:13 IL-17F-R GAGCATCTTCTCCAACCTGAA SEQ ID NO:14

[0122] Prepare Mixture 2 as shown in Table 5 in a qPCR tube. Perform qPCR reaction according to the procedure shown in Table 6.

[0123] Table 5 Components of Mixture 2

[0124] 2×ChamQ Universal SYBR qPCR Master Mix 10.0μL Primer 1 (10 μM) 0.4μL Primer 2 (10 μM) 0.4μL Template DNA / cDNA 5μL <![CDATA[ddH2O]]> Replenish to 20.0 μL

[0125] Table 6 qPCR reaction procedure

[0126]

[0127] Expression of psoriasis-related inflammatory factor mRNA Figure 5 As shown. Cytokines play important physiological and pathological roles in many diseases. Therefore, in order to further explore whether PG-OMVs can inhibit the production of pro-inflammatory and IL-23 / IL-17 axis-related cytokines, this application uses real-time fluorescence quantitative PCR analysis to detect the expression of psoriasis-related cytokines in skin lesions. The results of real-time fluorescence quantitative PCR are shown in the figure. Compared with the Control group, the expression levels of related inflammatory factors in the psoriasis model mice (IMQ group) increased, indicating that our model was successfully established. There was no significant difference between the IMQ group and the IMQ-G group, indicating that the hydrogel has no therapeutic effect on psoriasis. Comparing the IMQ group with the IMQ-G group, and the IMQ-G group with the IMQ-GO group, the results showed that treatment with PG-OMVs significantly reduced the levels of proinflammatory cytokine mRNA that cause psoriasis in mice, including IL-1β and IL-23 / IL-17 axis-related cytokines (IL-23α, IL-22, IL-17A, IL17F), but the expression of tumor necrosis factor-α was not reduced, indicating that PG-OMVs treat psoriasis not by regulating TNF-α.

[0128] In addition, the Parabacteroides exosomes of Examples 4-6 were further subjected to mouse experiments, and 6-8 week old BALB / c mice were divided into four groups, namely IMQ-GO-4, IMQ-GO-5 and IMQ-GO-6, with 6 mice in each group. The hair of each mouse was removed, and 62.5 mg of imiquimod (abbreviated as IMQ) cream was applied with a scraper every day in the IMQ-GO-4, IMQ-GO-5 and IMQ-GO-6 groups for 7 consecutive days to form a psoriasis-like model in the mice. On the 5th day, the mixture of the exosomes of Example 4 and PF-127 hydrogel was orally administered to the mice in the IMQ-GO-4 group, the mixture of the exosomes of Example 5 and PF-127 hydrogel was orally administered to the mice in the IMQ-GO-5 group, and the mixture of the exosomes of Example 6 and PF-127 hydrogel was orally administered to the mice in the IMQ-GO-6 group. The exosome concentration of each group was 7.9×10 12 The mice were killed on the eighth day. The H&E staining experiment was carried out by the above method to obtain the surface thickness of the mouse skin of Example 4, Example 5 and Example 6, respectively. The specific results are shown in Table 7.

[0129] Table 7 The thickness of the epidermis of the skin of psoriasis model mice after administration of different Parabacteroides exosomes

[0130] Implementation cnotrol group IMQ Group IMQ-G Group Example 2 IMQ-GO Group Skin epidermis thickness / μm 28 121 123 70 Implementation Example 4 IMQ-GO-4 Group Example 5 IMQ-GO-5 Group Example 6 IMQ-GO-6 Group Skin epidermis thickness / μm 103 110 92

[0131] From the data results in Table 7, it can be seen that the exosomes of Parabacteroides distichous of Example 4, the exosomes of Parabacteroides johnsonii of Example 5, and the exosomes of Parabacteroides gordonii of Example 6 have a certain therapeutic effect on psoriasis, but compared with Parabacteroides gordonii, the effect is average.

[0132] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed. However, as long as it is within the scope of the claims of the present application, it shall be protected by the patent law.

Claims

1. A use of Parabacteroides in preparing a pharmaceutical composition for treating psoriasis, characterized in that: Prepared by the following steps: S1. Centrifuge the bacterial solution, collect the supernatant, coarsely filter the supernatant through a flange positive pressure filter bag, and collect the filtrate; finely filter the filtrate through a ceramic membrane with a 100-200nm membrane core, and collect the dialysate; filter the dialysate through a disc two-phase filter microporous membrane, and collect the filtrate; S2, subjecting the filtrate finally obtained in S1 to 100KD tangential flow concentration, and collecting the concentrate; S3, purifying the concentrated solution finally obtained in S2 through a size exclusion chromatography column, and collecting the eluate; S4, the eluate finally obtained from S3 was subjected to ultracentrifugation precipitation at 10000×g, 4°C, 60 min, the supernatant was removed, the precipitate was resuspended in 2000 μL pre-cooled PBS buffer, and then filtered with a 0.22 μm filter to obtain; The Parabacteroides is selected from Parabacteroides gordonii, with a product number of ATCC BAA-1180.

2. The use of a Parabacteroides according to claim 1 in preparing a pharmaceutical composition for treating psoriasis, characterized in that: The dosage form of the pharmaceutical composition is selected from any one or more of microneedle, spray, solution, capsule, lozenge, chewing gum and dry powder preparation.

3. The use of a Parabacteroides according to claim 2 in preparing a pharmaceutical composition for treating psoriasis, characterized in that: The components in the pharmaceutical composition also include other auxiliary components, and the other auxiliary components are selected from one or more of probiotics, excipients, adjuvants, and dispersants.

4. The use of a Parabacteroides according to claim 3 in preparing a pharmaceutical composition for treating psoriasis, characterized in that: The method for preparing the culture solution of Parabacteroides gordonii comprises the following steps: The Parabacteroides gordonii is inoculated into the culture medium and anaerobically cultured at 34-38°C for 65-80 hours to obtain the product.

5. The use of a Parabacteroides according to claim 4 in preparing a pharmaceutical composition for treating psoriasis, characterized in that: The anaerobic culture environment includes the following gas components in volume percentage: 3-7% hydrogen, 8-12% carbon dioxide and the balance nitrogen.

6. The use of a Parabacteroides according to claim 5 in preparing a pharmaceutical composition for treating psoriasis, characterized in that: The components of the culture medium include: 0.5-1.5 mg / mL L-cysteine, 30-42 mg / mL brain heart infusion broth, 0.005-0.015 mL / mL 0.02-0.08 wt% hemin solution, and 0.01-0.03 mL / mL 7-13 wt% sodium bicarbonate solution.

Images