Wheat SNP loci and their multiple applications

Abstract

The present invention discloses a wheat SNP site and multiple applications thereof, a wheat SNP site, the SNP site corresponds to the 363rd base in the sequence shown in SEQ ID NO.1, and its variation space includes: G / G homozygous genotype, A / A homozygous genotype, G / A heterozygous genotype; the G / G homozygous genotype has a higher wheat spikelet number per ear phenotype than the A / A homozygous genotype; the use is to develop and construct theoretical research and / or wheat breeding applications and / or agricultural industry applications related to the number of spikelets per ear of wheat based on the SNP site. On the basis of the research related to wheat thousand-grain weight, the present invention further develops SNPs related to the trait of the number of spikelets per ear of wheat, which provides important gene resources and technical foundations for the research on the development and regulation mechanism of the number of spikelets per ear of wheat, especially for the directional breeding related to the number of spikelets per ear of wheat.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular biology, in particular to a wheat single nucleotide polymorphism site with multiple application values. Background Art

[0002] Wheat (Triticum aestivum L.), as one of the most important food crops, is an important source of energy and protein for people. my country is a major producer and consumer of wheat. Breeding high-yield wheat varieties and continuously increasing wheat yields are important measures to ensure my country's food security. The number of grains per ear is one of the three elements of wheat yield, and the number of spikelets per ear is the key influencing factor of the number of grains per ear. Therefore, revealing the genetic basis for the formation of the number of spikelets per ear of wheat is of great theoretical and practical significance for breeding high-yield wheat varieties.

[0003] At present, researchers have located a large number of QTLs that regulate the number of spikelets per ear. Hu detected the total number of spikelets per ear locus QSN.yaas-3B in 2017, with a phenotypic contribution rate of 6.12%. Zuo found four major A-QTLs (QSns.acs-2A.1, QKns.acs-2A.2, QKns.acs.5B.1 and QPtn.acs-7B.1) on chromosomes 2A, 5B and 7B that can all be stably expressed. Yulian Li used the Chinese local variety Banmangzi and "Jimai 22" to construct a parent population (F6), and used the 55K wheat chip to construct a genetic linkage map, and found that there are 5 loci that control the number of spikelets per ear. Pang collected and used a total of 768 excellent wheats from the main wheat producing areas in China, and conducted simplified genome sequencing analysis. Through association analysis, 9 loci that control the number of spikelets per ear were obtained, which can be repeatedly detected in multiple environments.

[0004] Although a large number of QTLs related to the number of spikelets per ear of wheat have been located, it is difficult to apply these QTLs to the genetic improvement of the number of spikelets per ear of wheat because the phenotypic contribution rate of most of these QTLs is small and the repeatability between different years and environments is poor.

[0005] Therefore, the development of utility quantitative trait loci related to the number of spikelets per ear of wheat, especially single nucleotide polymorphism sites, has important theoretical and practical significance and is an important research topic at present. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide a wheat SNP site and multiple applications thereof.

[0007] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0008] A wheat SNP site, the SNP site corresponds to the 363rd base in the sequence shown in SEQ ID NO.1, and its variation space includes: G / G homozygous genotype, A / A homozygous genotype, G / A heterozygous genotype; the G / G homozygous genotype has a higher wheat spikelet number per ear phenotype than the A / A homozygous genotype.

[0009] The use of a wheat SNP site, wherein the SNP site corresponds to the 363rd base in the sequence shown in SEQ ID NO.1, and its variation space includes: G / G homozygous genotype, A / A homozygous genotype, and G / A heterozygous genotype; the G / G homozygous genotype has a higher wheat spikelet number per ear phenotype than the A / A homozygous genotype; the use is to develop and construct theoretical research related to the number of spikelets per ear of wheat and / or wheat breeding applications and / or agricultural industry applications based on the SNP site.

[0010] As a preferred technical solution of the present invention, the use is to conduct theoretical research on the development principle of the number of spikelets per ear of wheat based on the SNP site.

[0011] As a preferred technical solution of the present invention, the use is to study the molecular regulatory pathway of the development of the number of spikelets per ear of wheat based on the SNP site.

[0012] As a preferred technical solution of the present invention, the use is to confirm, identify and / or distinguish the downstream associated effector molecules based on the SNP site through the site genotype difference, so as to construct a molecular regulation pathway for the number of spikelets per ear of wheat; the effector molecules include but are not limited to messenger RNA, proteins, associated biological enzymes, various molecular regulatory components, and various molecular signal components.

[0013] As a preferred technical solution of the present invention, the use is to identify and confirm the main effect or key regulatory nodes and their corresponding biological macromolecules or small molecule components based on the construction of a molecular regulatory pathway for the number of spikelets per ear of wheat based on the SNP site.

[0014] As a preferred technical solution of the present invention, the use is to identify or assist in identifying the phenotype of spikelet number per ear of wheat in the early stage of breeding through molecular marker assisted selection breeding (MAS) operation in wheat breeding applications.

[0015] As a preferred technical solution of the present invention, in the early stage of molecular marker-assisted selection breeding (MAS), primers are designed to perform PCR amplification on any DNA fragment containing the SNP site in the wheat genomic DNA to be tested, the wheat genotype is identified by enzyme digestion of the PCR amplification product, and the phenotype of the number of spikelets per ear of wheat is identified or assisted in identification based on the following correlation between genotype and phenotype: the G / G homozygous genotype has a higher number of spikelets per ear of wheat than the A / A homozygous genotype.

[0016] As a preferred technical solution of the present invention, the use is to regulate the number of spikelets per ear of wheat according to production needs in the agricultural industry based on the SNP site.

[0017] As a preferred technical solution of the present invention, the number of spikelets per ear of wheat is regulated, including: increasing the number of spikelets per ear of wheat based on the G / G homozygous genotype; reducing the number of spikelets per ear of wheat based on the A / A homozygous genotype.

[0018] As a preferred technical solution of the present invention, the number of spikelets per ear of wheat is increased based on the G / G homozygous genotype, and its potential possible application scenarios include: increasing the total wheat yield and using high-yield wheat for animal husbandry and feed industry; the number of spikelets per ear of wheat is reduced based on the A / A homozygous genotype, and its potential possible application scenarios include: improving wheat quality and using high-quality wheat for high-end food manufacturing or high-end beverage brewing.

[0019] The beneficial effect of adopting the above technical solution is that: our previous research analyzed and verified the quantitative trait loci of wheat thousand-grain weight, and the present invention further found that the relevant SNP has a clear phenotypic influence on the trait of spikelet number per ear of wheat. This provides a new research and development path for the study of the development and regulation mechanism of the number of spikelets per ear of wheat. In particular, this new discovery provides important genetic resources for the directional breeding of wheat (increasing or reducing the number of spikelets per ear of wheat). BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a diagram showing the electrophoresis detection result of the dCAPS-labeled enzyme cleavage product of the SNP of the present invention in Example 3; in the figure, M is used as a molecular weight standard; lane A is a band cut by PstI, and lane G is a band that cannot be cut by PstI.

[0021] Figure 2 This is a schematic diagram of the results of the association analysis between the gene polymorphism sites in the natural population of Example 5 and the number of spikelets per ear; in all planting locations and years, the number of spikelets per ear of type I was higher than that of type II, and the P values ​​were all less than 0.05 or 0.01, and most were less than 0.01, indicating that there was a significant association between the gene polymorphism sites and the number of spikelets per ear. DETAILED DESCRIPTION

[0022] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are all conventional commercial products and can be directly obtained through market purchase. The wheat materials used in the following examples are all from the National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm), and the material information can be found in the China Crop Germplasm Information Network, website: http: / / icgr.caas.net.cn.

[0023] It should be understood that when used in the specification of the present application and the appended claims, the term "comprising" indicates the presence of the described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in the specification of the present application and the appended claims refers to any combination of one or more of the items listed in association and all possible combinations, and includes these combinations. In addition, in the description of the specification of the present application and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the description, and cannot be understood as indicating or implying relative importance. The reference "one embodiment" or "some embodiments" described in the specification of the present application means that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Thus, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification are not necessarily all referring to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "include", "comprising", "having" and variations thereof mean "including but not limited to", unless specifically emphasized otherwise.

[0024] Embodiment 1, technical overview of the present invention

[0025] The present invention discloses a SNP site related to the number of spikelets per ear of wheat and its application. The present invention analyzes the genetic variation of the promoter region of the ROXY1-2A gene in a natural variation population of wheat and finds a SNP corresponding to the 363rd position in sequence table 1. The SNP has two genotypes: genotype A (G) and genotype B (A). Association analysis proves that in the homozygous types of these two genotypes, the number of spikelets per ear is: wheat homozygous for genotype A> wheat homozygous for genotype B. The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher number of spikelets per ear can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yield wheat varieties or research.

[0026] In the present invention, the genotype of the SNP site is named as follows: when the site is homozygous for G / G, the corresponding genotype is type A or type I; when the site is homozygous for A / A, the corresponding genotype is type B or type II. The names of genotypes are differentiated based on different chapters below, and they refer to the substantially corresponding genotypes according to the above names.

[0027] Example 2: Detection of SNPs related to the number of spikelets per wheat ear and their PCR-enzyme polymorphism

[0028] Specific primers were used to amplify the genome fragment containing the wheat SNP and the sequence was analyzed; a SNP was found in the promoter region of the gene ROXY1 on the wheat genome, corresponding to the 363rd position in Sequence Table 1; this site has two genotypes in the natural variation population of wheat: genotype A: G; genotype B: A.

[0029] According to the sequence differences of different wheat genomes, specific primers were designed to PCR amplify the DNA fragments containing the SNP sites:

[0030] F1: ACATGCGCCTCTTCTCACTTGTAG (SEQ ID NO.2);

[0031] R1: GCACACGCACACCAGTGATCTATAA (SEQ ID NO.3);

[0032] F2: CGATGCCGGTCACCTTGGCTGC (SEQ ID NO.4);

[0033] R2:TTCACGGCGTGGCACATGCAGC (SEQ ID NO.5);

[0034] The target sequence amplified by PCR using F1 and R1 as primers is the 155-808 sequence shown in Sequence 1 of the sequence list; the target sequence amplified by PCR using F2 and R2 as primers is the 341-455 sequence shown in Sequence 1 of the sequence list. Enzyme digestion analysis showed that the polymorphisms can be recognized by PstI respectively.

[0035] Example 3: PCR-enzyme polymorphism detection of wheat spikelet number per ear SNP site

[0036] Establishment of PCR-enzyme digestion polymorphism detection and genotyping method

[0037] 1) Extracting genomic DNA of wheat to be tested;

[0038] 2) Using the genomic DNA from step 1) as a template, PCR amplification was performed with primers F1 and R1. The PCR amplification system (10 μL) was: ddH2O μL, 1 μL 10×PCRBuffer, 0.3 μL each of primer F1 (5 μmol / L) and primer R1 (5 μmol / L), 0.6 μL dNTP (2.5 μmol / L), 0.1 μL Taq enzyme, and 0.5 μL template (20 ng / μL).

[0039] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 30 s, 56°C for 30 s, 72°C for 30 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0040] 3) The PCR product of step 2) was diluted 100 times and used as a template for PCR amplification with primers F2 and R2. The PCR amplification system (10 μL) was: ddH2O μL, 1 μL 10×PCR Buffer, 0.3 μL each of primer F2 (5 μmol / L) and primer R2 (5 μmol / L), 0.6 μL dNTP (2.5 μmol / L), 0.1 μL Taq enzyme, and 0.5 μL template (20 ng / μL).

[0041] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 30 s, 56°C for 30 s, 72°C for 10 s, 32 cycles; 72°C for 10 min, and storage at 16°C.

[0042] 4) See Appendix Figure 1 , the PCR product obtained in step 3) is digested with PstI to obtain the digestion product, and 4% agarose gel electrophoresis is performed to detect whether the PCR product is cut into two fragments, and the situation of the wheat to be tested at the site is determined and recorded according to the following method:

[0043] If the enzyme cleavage product is a fragment, the wheat to be tested is homozygous for G at the site (expressed as G / G) ( Figure 1If the enzyme cleavage product is two fragments, the wheat to be tested is homozygous for A at the site (expressed as A / A) ( Figure 1 Lane A in the figure.

[0044] 5) According to the result of step 4), the wheat is divided into two types, I and II, with the conditions at the said locus as follows: I: G / G (i.e. homozygous for genotype A); II: A / A (i.e. homozygous for genotype B); the “ / ” before the “ / ” refers to the condition on one homologous chromosome, and the “ / ” after the “ / ” refers to the condition on another homologous chromosome.

[0045] Example 4: Typing of natural populations using dCAPs markers and association analysis with the trait of spikelet number per ear

[0046] Each wheat in the natural population consisting of 323 hexaploid wheats was used as the wheat to be tested, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.

[0047] Table 1 The situation of the polymorphic sites in natural wheat populations

[0048]

[0049]

[0050]

[0051]

[0052]

[0053] Example 5: Natural group planting experiment

[0054] See attached Figure 2 In 2015, the natural population wheat was planted in the dryland of the Experimental Farm of Crop Science Institute of Chinese Academy of Agricultural Sciences (Shunyi, Beijing), and in 2016, the dryland and waterland of the Experimental Farm of Crop Science Institute of Chinese Academy of Agricultural Sciences (Shunyi, Beijing and Changping, Beijing). The number of spikelets per ear of each wheat variety was investigated, and the association analysis between the number of spikelets per ear and the polymorphic loci was performed using Tassel2.1 software. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, with P<0.05 as the significance level. The results are shown in Table 2.

[0055] Table 2 Results of association analysis between gene polymorphisms and the number of spikelets per ear in natural populations

[0056]

[0057] The results of association analysis in Table 2 show that the differences in the number of spikelets per ear of the two types formed by the natural population composed of 323 hexaploid wheats shown in Table 1 reached a significant level (P<0.05). Among them, the number of spikelets per ear of wheat of type I is higher than that of wheat of type II. In several environments, the number of spikelets per ear of wheat materials of type I is 0.27, 0.26, 0.13, 0.27, 0.22, 0.38, 0.37 and 0.44 higher than that of wheat of type II, respectively. Studies on natural populations have shown that type I is an excellent genotype for increasing the number of spikelets per ear of wheat.

[0058] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0059] From the above embodiments, it can be seen that the present invention has found a SNP corresponding to position 363 in sequence 1 of the sequence table through genetic variation analysis of the promoter of the ROXY1 gene in the natural variation population of wheat. The SNP has two genotypes: genotype A (G) and genotype B (A). Association analysis has shown that in the homozygous types of these two haplotypes, the number of spikelets per ear is: wheat homozygous for genotype A > wheat homozygous for genotype B. Experiments have shown that by detecting the SNP, wheat with a relatively high number of spikelets per ear can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in breeding high-yield wheat varieties and research.

[0060] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. The use of wheat SNP loci, characterized in that: The SNP site corresponds to the 363rd base in the sequence shown in SEQ ID NO.1, and its variation space includes: G / G homozygous genotype, A / A homozygous genotype, and G / A heterozygous genotype; the G / G homozygous genotype has a higher wheat spikelet number per ear phenotype than the A / A homozygous genotype; the use is to identify or assist in identifying the wheat spikelet number per ear phenotype in the early stage of wheat breeding through molecular marker assisted selection breeding MAS operation in wheat breeding applications.

2. The use of the wheat SNP locus according to claim 1, characterized in that: In the early stage of molecular marker-assisted selection breeding (MAS), primers are designed to perform PCR amplification on any DNA fragment containing the SNP site in the wheat genomic DNA to be tested, the wheat genotype is identified by enzyme digestion of the PCR amplification product, and the phenotype of the number of spikelets per ear of wheat is identified or assisted in identification based on the following correlation between genotype and phenotype: the G / G homozygous genotype has a higher number of spikelets per ear of wheat than the A / A homozygous genotype.

3. The use of wheat SNP loci, characterized in that: The SNP site corresponds to the 363rd base in the sequence shown in SEQ ID NO.1, and its variation space includes: G / G homozygous genotype, A / A homozygous genotype, G / A heterozygous genotype; the G / G homozygous genotype has a higher wheat spikelet number per ear phenotype than the A / A homozygous genotype; the use is to regulate the number of wheat spikelets per ear according to production needs in the agricultural industry based on the SNP site.

4. The use of wheat SNP loci according to claim 3, characterized in that: The number of spikelets per wheat ear is regulated, including: increasing the number of spikelets per wheat ear based on the G / G homozygous genotype; and reducing the number of spikelets per wheat ear based on the A / A homozygous genotype.

Images