TaMADS-3B gene for regulating seed dormancy level and PHS resistance of plants, CAPS marker and application thereof

By identifying and developing the TaMADS-3B gene and its CAPS marker, the problems of few wheat seed dormancy-related genes and complex resistance inheritance mechanisms in existing technologies have been solved, enabling efficient detection and improvement of wheat seed dormancy levels and PHS resistance.

CN118325951BActive Publication Date: 2026-02-10ANHUI AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410547868.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-06
Publication Date
2026-02-10
Estimated Expiration
2044-05-06

AI Technical Summary

Technical Problem

In existing technologies, only a few wheat seed dormancy-related genes have been cloned, resulting in a slow progress in marker-assisted breeding of wheat with strong dormancy/resistance to pre-sprouting. Furthermore, the genetic mechanisms of resistance vary greatly among materials with different genetic backgrounds, making it difficult to effectively regulate seed dormancy levels and PHS resistance.

Method used

The TaMADS-3B gene and its CAPS marker were identified and developed. PCR amplification and restriction endonuclease verification were performed by designing specific primers. The TaMADS-3B-931 polymorphic site was used to determine the dormancy level and PHS resistance of wheat seeds. The CAPS marker TaMADS-3B-931, which is easy to detect on a large scale, was developed.

Benefits of technology

This study enabled efficient detection of wheat seed dormancy levels and PHS resistance, improved the targeting and specificity of molecular marker selection, and promoted the efficiency of genetic improvement of wheat dormancy levels and PHS resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118325951B_ABST
    Figure CN118325951B_ABST
Patent Text Reader

Abstract

The application discloses a TaMADS-3B gene for adjusting seed dormancy level and PHS resistance, a CAPS marker and application thereof, relates to the technical field of plant genetic breeding, and the nucleotide sequence of the TaMADS-3B gene is shown as SEQ ID NO.1, and the TaMADS-3B gene positively regulates the seed dormancy level and the PHS resistance; the CAPS marker is TaMADS-3B-931. The application verifies that the CAPS marker TaMADS-3B-931 is extremely significantly related to a seed germination index GI by using a population composed of 174 families and 192 wheat varieties of Jing411 / hongmangchun21 parents, and the seed germination index GI of the family carrying the HMC21 genotype is significantly smaller than that of the family carrying the J411 genotype, so that the CAPS marker developed in the application can effectively distinguish the strong / weak dormancy or the resistant / susceptible PHS type of the wheat varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetics and breeding technology, specifically to the TaMADS-3B gene and its CAPS marker and application for regulating plant seed dormancy levels and PHS resistance. Background Technology

[0002] Pre-harvest sprouting (PHS) in wheat refers to the phenomenon where wheat grains sprout directly on the wheat ear due to prolonged rainy weather or high humidity before harvest (Groos et al., 2002). PHS causes complex chemical changes within the wheat grain, leading to varying degrees of hydrolysis of stored substances, resulting in reduced yield and deteriorated quality (Chang et al., 2010a).

[0003] Seed dormancy is a major genetic factor in resistance to ear sprouting. Therefore, breeding wheat varieties with strong dormancy and resistance to ear sprouting is the most economical, effective, and safe way to deal with ear sprouting disasters in rainy wheat-growing areas during the harvest season. Discovering seed dormancy genes, developing molecular markers, and using molecular marker-assisted selection technology can accelerate the breeding process of new wheat varieties with strong dormancy and resistance to ear sprouting.

[0004] Currently, only a few genes related to wheat seed dormancy have been cloned, such as TaVp1 (Yang et al. 2007), TaMFT / TaPHS1 (Liu et al. 2013), TaSdr (Zhang et al. 2017), TaMKK3-A (Torada et al. 2016), TaQsd1 (Wei et al. 2019), Myb10-D (Lang et al. 2021), TaSD6 (Xu et al. 2022), TaGATA1 (Wei et al. 2023), and Tapi4K-2A (Tai et al. 2024), which seriously hinders the progress of marker-assisted breeding for strong dormancy / resistance to pre-sprouting in wheat. Given the large and complex wheat genome and the significant differences in resistance inheritance mechanisms among materials with different genetic backgrounds, identifying more new seed dormancy genes / genes regulating seed PHS resistance from different germplasm resources and developing molecular markers will help accelerate the progress of marker-assisted breeding for strong dormancy / resistance to pre-sprouting in wheat. Summary of the Invention

[0005] To overcome the shortcomings of the prior art, the purpose of this invention is to provide the TaMADS-3B gene, its CAPS marker, and its application for regulating plant seed dormancy levels and PHS resistance.

[0006] The present invention achieves the above objectives through the following technical solutions:

[0007] This invention provides an application of the TaMADS-3B gene in regulating plant seed dormancy levels and PHS resistance. The nucleotide sequence of the TaMADS-3B gene is shown in SEQ ID NO.1. The TaMADS-3B gene positively regulates plant seed dormancy levels and PHS resistance.

[0008] As a further optimization of the present invention, the plants are wheat, rice and Arabidopsis thaliana.

[0009] A CAPS marker for identifying dormancy level and PHS resistance in wheat seeds, the CAPS marker being TaMADS-3B-931, comprising:

[0010] Primers used to amplify the sequence of the -931 polymorphic site in the promoter region of the TaMADS-3B gene and its upstream and downstream nucleotides, wherein the polymorphic site in the promoter region of the TaMADS-3B gene has a T insertion or deletion.

[0011] Restriction endonuclease used to verify the base type of TaMADS-3B-931.

[0012] As a further optimization of the present invention, the restriction endonuclease used to verify the base type of TaMADS-3B-931 is Dde I.

[0013] The application of a CAPS marker in identifying dormancy levels and PHS resistance in wheat seeds, wherein wheat seeds of type TaMADS-3B-931-del are strongly dormant or PHS-resistant wheat varieties, and wheat seeds of type TaMADS-3B-931-ins are weakly dormant or PHS-susceptible wheat varieties.

[0014] As a further optimization of the present invention, the nucleotide sequence containing the TaMADS-3B-931 base in strongly dormant or PHS-resistant wheat is shown in SEQ ID NO.6, and the nucleotide sequence containing the TaMADS-3B-931 base in weakly dormant or PHS-sensitive wheat is shown in SEQ ID NO.7.

[0015] A method for identifying dormancy level and PHS resistance in wheat seeds using CAPS markers includes the following steps:

[0016] S1. Extract total RNA from wheat seeds and reverse transcribe it into cDNA;

[0017] S2. Using the nucleotide sequence composed of the TaMADS-3B-931 polymorphic site and its upstream and downstream nucleotides as the amplification template, CAPS primers were designed and PCR amplification was performed to obtain the amplification product containing the TaMADS-3B-931 polymorphic site.

[0018] S3. Verify the genotype of TaMADS-3B-931 using the restriction endonuclease Dde I, determine the gene type of the amplified product based on the genotype of TaMADS-3B-931, and determine the dormancy level of wheat seeds based on the gene type.

[0019] As a further optimization of the present invention, the CAPS primers are specifically as follows:

[0020] SEQ ID NO.4: TaMADS-3B-931-F: 5' GTGGAGACGGAAGGGGA 3';

[0021] SEQ ID NO. 5: TaMADS-3B-931-R: 5' AGGCAAGGGCTGCTG 3'.

[0022] The present invention has the following beneficial effects:

[0023] This invention identifies a gene, TraesCS3B02G470000 (named TaMADS-3B), that positively regulates seed dormancy level and PHS resistance in plants through transcriptome analysis of Jing 411 (J411, weak dormancy, PHS-sensitive) and Hongmangchun 21 (HMC21, strong dormancy, PHS-resistant) infiltration treatments. Based on the sequence differences of this gene in strong / weak dormancy (PHS-resistant / PHS-sensitive) wheat materials, a gene functional marker (CAPS marker) TaMADS-3B-931, which is easy to detect on a large scale, was developed. The CAPS marker (TaMADS-3B-931) showed clear bands after electrophoresis, with significant differences in band patterns among different strong / weak dormancy (PHS-resistant / PHS-sensitive) wheat varieties. The detection method is simple and helps to improve the targeting and specificity of molecular marker selection, thereby improving the efficiency of genetic improvement of wheat dormancy level and PHS resistance. Attached Figure Description

[0024] Figure 1 Figure 1 shows the expression analysis of TaMADS-3B gene in different seed soaking stages, different tissues, and different growth stages of wheat varieties J411 (weak dormancy, susceptible to PHS) and HMC21 (strong dormancy, resistant to PHS). **P<0.01.

[0025] Figure 2 The promoter sequence differences of the TaMADS-3B gene in Jing 411 (J411, weak dormancy / susceptible to pre-budding and PHS) and Hongmangchun 21 (HMC21, strong dormancy / resistant to pre-budding and PHS) are shown.

[0026] Figure 3 This is a chromatogram of agarose gel electrophoresis results.

[0027] Figure 4 Validation experimental data showing that the CAPS marker TaMADS-3B-931 was significantly associated with seed dormancy and anti-germination traits (seed germination index GI, population consisting of the parental line Jing 411 / Hongmangchun 21 and 174 families).

[0028] Figure 5 Validation data plot of the CAPS marker TaMADS-3B-931 significantly associated with seed dormancy and anti-germination traits (seed germination index GI, population of 192 wheat varieties).

[0029] Figure 6 Seed germination morphology (6A, 6C) and germination rate statistics (6B) of Arabidopsis thaliana lines heterologously overexpressing the TaMADS-3B gene (35S:TaMADS-3B-10, 35S:TaMADS-3B-12 and 35S:TaMADS-3B-16) and wild-type.

[0030] Figure 7 The graphs show the expression levels (7A), germination rate (7B), and germination phenology (7C) of seeds from Arabidopsis thaliana homolog AtMADS-box51 overexpression lines (AtMADS-box51-OE6, AtMADS-box51-OE16, AtMADS-box51-OE17) and wild-type seeds.

[0031] Figure 8 Seed germination morphology (8A, 8C) and germination rate statistics (8B) of rice lines heterologously overexpressing the TaMADS-3B gene (35S:TaMADS-3B-18, 35S:TaMADS-3B-22 and 35S:TaMADS-3B-24) and wild-type. Detailed Implementation

[0032] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.

[0033] 1. Materials

[0034] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.

[0035] 2. Method

[0036] 2.1 Identification and analysis of the wheat gene TaMADS-3B

[0037] 2.1.1 Transcriptome Analysis

[0038] Seeds of wheat varieties Jing 411 (J411, weak dormancy / susceptible to pre-budding, susceptible to PHS) and Hongmangchun 21 (HMC21, strong dormancy / resistant to pre-budding, resistant to PHS) were immersed in water. Seed samples were collected at different immersion times (1h, 6h, 9h, 12h, and 36h, representing the dormancy breaking process) and analyzed using transcriptome sequencing (https: / / www.ncbi.nlm.nih.gov / bioproject / PRJNA895954). Transcriptome data from Jing 411 (J411, weak dormancy / susceptible to pre-budding) and Hongmangchun 21 (HMC21, strong dormancy / resistant to pre-budding) were used to identify a MADS-box family gene TaMADS-3B (TraesCS3B02G470000, named TaMADS-3B) associated with seed dormancy. The expression patterns of the TaMADS-3B gene at different seed infiltration stages, different tissues, and different growth stages in the two wheat varieties (Jing 411 and Hongmangchun 21) were investigated.

[0039] Transcriptome sequencing (RNA-seq) data of wheat varieties Jing 411 (J411, weak dormancy / susceptible to pre-budding, susceptible to PHS) and Hongmangchun 21 (HMC21, strong dormancy / resistant to pre-budding, resistant to PHS) were analyzed, and the results are as follows: Figure 1 As shown, Figure 1 A represents the relative expression levels of the TaMADS-3B gene in wheat varieties J411 and HMC21 at 1 h, 6 h, 9 h, 12 h, and 36 h (representing the seed dormancy breaking process). Figure 1 B represents the relative expression levels of the TaMADS-3B gene in different wheat tissues (root, stem, leaf, and grain) obtained from a public expression database (http: / / 202.194.139.32 / expression / wheat.html); **P<0.01;

[0040] It can be seen that the relative expression level of the TaMADS-3B gene in the wheat variety Hongmangchun 21 (HMC21, strong dormancy / resistant to pre-sprouting, resistant to PHS) was significantly higher than that in Jing 411 (J411, weak dormancy / susceptible to pre-sprouting, susceptible to PHS) at 1 h, 6 h, 9 h, 12 h and 36 h of soaking time, suggesting that the TaMADS-3B gene may be closely related to seed dormancy.

[0041] 2.1.2 qRT-PCR analysis

[0042] Quantitative real-time PCR (qRT-PCR) is a method that uses fluorescent chemicals to measure the total amount of product after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. The basic principle is to add a fluorescent group to the PCR reaction system, monitor the entire PCR process in real time by accumulating fluorescence signals, and finally quantify unknown templates using a standard curve. The fluorescent substances used in qRT-PCR include fluorescent probes and fluorescent dyes. This experiment uses SYBR fluorescent dye. The principle is that a certain amount of SYBR fluorescent dye is added to the PCR reaction system. SYBR dye specifically incorporates into the DNA double strand and emits a fluorescent signal, while SYBR dye molecules not incorporated into the strand do not emit any fluorescent signal, thus ensuring that the increase in fluorescence signal is completely synchronized with the increase in PCR product. SYBR only binds to double-stranded DNA; therefore, the specificity of the PCR reaction can be determined by using a melting curve.

[0043] Wheat seeds from different soaking stages were collected in step 2.1.1. Wheat seed RNA was extracted and reverse transcribed into cDNA. Reverse transcription was performed using the PrimeScript RT-Reagent Kit (Takara Biotechnology, Dalian, China). Quantitative real-time PCR was then performed according to the instructions of the SYBR Premix Ex Taq GC Kit (Takara Biotechnology, Dalian, China). The PCR primer sequences, PCR reaction system, and PCR reaction procedure are as follows:

[0044] PCR amplification primer sequences:

[0045] SEQ ID NO.8: TaMADS-3B-qRT-PCR-F: GCTTGAAGAGATTACTACCTGGTC;

[0046] SEQ ID NO.9: TaMADS-3B-qRT-PCR-R: CTGGAGTTCTCGCCGCTT;

[0047] PCR reaction system: The total qPCR reaction volume was 20 µL, including 10 µL of SYBR Advantage Premix (2×), 2.0 µL of reverse transcribed cDNA, and 7.2 µL of ddH2O. 0.4 µL each of 10 µM forward and reverse primers for mRNA quantification were added.

[0048] PCR reaction program: For quantification, the mRNA quantification program was 95℃ for 2 min, 95℃ for 10 s, and 60℃ for 30 s, with 40 cycles. The real-time PCR process was run on a 7500 Real-Time PCR System (Bio-Rad Laboratories, Shanghai, China). Actin was selected as the internal reference gene for mRNA, and each sample was replicated in quadruplicate. The Ct values ​​for each group of samples were calculated using the 2-ΔCt algorithm to determine the change in relative expression levels.

[0049] Analyze the qRT-PCR test data of wheat varieties Jing 411 and Hongmangchun 21. Figure 1 C represents the relative expression level of the TaMADS-3B gene in wheat varieties J411 and HMC21 seeds at 1 h, 6 h, 9 h, 12 h, and 36 h (representing the seed dormancy breaking process); Figure 1 D represents the relative expression level of the TaMADS-3B gene in different wheat tissues (root, stem, leaf, and grain) as verified by qRT-PCR; **P<0.01; Figure 1 E represents the relative expression level of the TaMADS-3B gene in wheat seeds at different post-flowering stages (20 DPA, 24 DPA, 28 DPA, 32 DPA, 36 DPA, representing the seed dormancy formation process).

[0050] This indicates that the TaMADS-3B gene is expressed in seeds, and qRT-PCR verification shows that its expression level is highest in seeds. At 1 h, 6 h, 9 h, 12 h, and 36 h of immersion, the relative expression level of the TaMADS-3B gene in Hongmangchun 21 (HMC21, strong dormancy / resistant to pre-budding, resistant to PHS) was significantly higher than that in Jing 411 (J411, weak dormancy / susceptible to pre-budding, susceptible to PHS). This demonstrates that the TaMADS-3B gene is involved in regulating seed dormancy and germination, and that the TaMADS-3B gene positively regulates the level of seed dormancy and PHS resistance in plants.

[0051] 2.2 Development of CAPS markers for the TaMADS-3B gene

[0052] Cleaved Amplified Polymorphism Sequences (CAPS), also known as RFLP-PCR, works by screening DNA sequences containing known restriction enzyme sites and designing corresponding specific PCR primers. The DNA fragment at that site is then amplified using these primers. The amplified product is then digested with a restriction endonuclease that specifically recognizes the site. Gel electrophoresis separates the digested fragments, and staining and analysis of site changes are performed. CAPS markers are co-dominant markers, relatively simple to use, and can be detected directly by agarose gel electrophoresis. However, CAPS markers require suitable restriction endonucleases, making their development a significant undertaking.

[0053] 2.2.1 Cloning of candidate genes

[0054] The TaMADS-3B gene and its promoter region (2000 bp) were obtained from the wheat reference genome (IWGSC RefSeq v.1.0). Using the obtained TaMADS-3B gene and promoter region sequences as templates, specific primers were designed using PrimerPremier 5.0 software (https: / / www.PremierBiosoft.com) for fragment amplification. The TaMADS-3B gene and its promoter region sequences were cloned in the PHS-sensitive material Jing 411 (J411) and the PHS-resistant material Hongmangchun 21 (HMC21) as follows:

[0055] Because the TaMADS-3B gene and its promoter region are relatively long, three pairs of specific primers were used to clone its coding and promoter regions. The specific primer sequences are as follows:

[0056] SEQ ID NO.10: TaMADS-3B-Clone1-F: 5' GGCTCAGGGTGATACTC 3';

[0057] SEQ ID NO.11: TaMADS-3B-Clone1-R: 5' ACACCACGCAGTCCA 3';

[0058] SEQ ID NO.12: TaMADS-3B-Clone2-F: 5' CTGGTAACGCCCACATA 3';

[0059] SEQ ID NO.13: TaMADS-3B-Clone2-R: 5' CGGAACAATACGGACAC 3';

[0060] SEQ ID NO.14: TaMADS-3B-Clone3-F: 5' CAAATCAACCACCTCTT 3';

[0061] SEQ ID NO. 15: TaMADS-3B-Clone3-R: 5' AGCAAACTCTGCCTACT 3'.

[0062] PCR amplification was performed using the high-fidelity enzyme Fastpfu, which has high amplification efficiency and speed, according to the following reaction system: 10 µL 5×PCR Buffer (15 mM MgCl2), 5 µL dNTPmix (2.5 mM), 2 µL upstream primer (10 µM), 2 µL downstream primer (10 µM), 4 µL template DNA (50-100 ng / µL), 1 µL L Fastpfu (2.5 U / µL), and distilled water to a final volume of 50 µL.

[0063] Reaction procedure: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 20 s, annealing for 20 s at the required annealing temperature for each primer pair, extension at 72℃ (extension time can be calculated based on fragment length and Fastpfu amplification efficiency of 2-4 kb / min), repeat the denaturation-annealing-extension cycle 35 times, supplement with 72℃ extension for 5 min, and store the product at 4℃.

[0064] Add 2 µL of 6× DNA loading buffer to the PCR product and perform electrophoresis on a 1.5% agarose gel. After electrophoresis, cut off the gel block containing the target fragment and use the agarose gel DNA recovery kit purchased from Kangwei Century Biotechnology Co., Ltd., following the instructions (https: / / www.cwbiotech.com / uploads / websitepdf / 216c4037-3eae-4ac2-b86a-762277a7adc1.pdf) to recover and purify the target fragment.

[0065] Add 1 µL of plasmid (Blunt-zero, purchased from TransGen Biotech, http: / / www.transgen.com.cn / ) and 4 µL of PCR purification product to the sample tube, ligate at 25°C for 20 min, and cool at 12°C. Remove the ligated sample and add 50 µL of competent cells (Trans-T, stored at -80°C before use) to a UV-sterilized workbench. Mix gently and incubate on ice for 20 min. After completion, transfer the sample to a water bath and heat shock at 42°C for 45 s, then immediately place it on ice for 2 min. On a sterile workbench, add 950 µL of SOC medium (formulation per 100 mL: 2 g tryptone, 0.5 g yeast extract, 0.06 g NaCl, 0.02 g KCl, 0.2033 g MgCl2·6H2O, 0.2465 g MgSO4·7H2O, 0.36 g glucose, 100 mL ultrapure water) to the sample and incubate at 37°C for 1–1.5 h. Next, in a sterile workbench, spread 100–200 µL of the bacterial culture evenly onto LB solid medium containing kanamycin (formulation per 100 mL: 1 g tryptone, 0.5 g yeast extract, 0.5 g NaCl, 1.5 g agar powder, 100 µL kanamycin solution, 100 mL ultrapure water) and incubate at 37°C for 15–16 h. Once the bacterial colonies have grown to a suitable size, add 6 µL of sterile water to each PCR sample well. Use a pipette with a maximum volume of 10 µL to transfer the bacteria into the well. Gently mix the bacteria, then transfer 4 µL to a centrifuge tube containing 1000 µL of LB liquid medium (per 100 mL: 1 g tryptone, 0.5 g yeast extract, 0.5 g NaCl, 100 µL kanamycin solution, 100 mL ultrapure water). Incubate the centrifuge tube at 37°C for 4–6 h. Simultaneously, using the remaining 2 µL of bacterial culture in each well as a template, perform PCR detection using the universal primer M13 for bacterial culture sequencing. If the PCR reaction is positive and contains the target fragment, the sample can be sent for sequencing.

[0066] The M13 primer sequence is:

[0067] SEQ ID NO.16: M13-F:5' CAGGAAACAGCTATGACCATGAT 3';

[0068] SEQ ID NO. 17: M13-R: 5'GTAAAACGACGGCCAGTGC 3'.

[0069] 2.2.2 Sequence Analysis of Candidate Genes

[0070] The alignment and structural analysis of candidate gene sequencing results were performed using DNAMAN software (https: / / www.lynnon.com / dnaman.html). Sequence alignment of strong / weak dormancy (resistant / susceptible to pre-budding, Hongmangchun 21 / Jing 411) revealed numerous sequence differences in the promoter region (e.g., Figure 2 As shown in the figure, through sequence analysis of the promoter regions of the clones of Hongmangchun 21 (HMC21, strong dormancy / resistant to pre-budding, resistant to PHS) and Jing 411 (J411, weak dormancy / susceptible to pre-budding, susceptible to PHS) (the promoter sequence of the TaMADS-3B gene in the PHS-resistant material is shown in SEQ ID NO.2, and the promoter sequence in the PHS-susceptible material is shown in SEQ ID NO.3), it was found that the TaMADS-3B gene has a 1 bp insertion or deletion (insertion or deletion of T at the position of -931 bp in the promoter region) in the promoter region of HMC21 and J411, which causes a change in an ACE cis-acting element. Specific primers (as shown in SEQ ID NO.4-5) were designed using PrimerPremier5.0 software (http: / / www.premierbiosoft.com) to target this mutation, and CAPS markers, namely TaMADS-3B-931, were developed.

[0071] The nucleotide sequences of the specific primers are as follows:

[0072] SEQ ID NO.4: TaMADS-3B-931-F: 5' GTGGAGACGGAAGGGGA 3';

[0073] SEQ ID NO. 5: TaMADS-3B-931-R: 5' AGGCAAGGGCTGCTG 3'.

[0074] 2.2.3 Amplification, restriction enzyme digestion, and electrophoresis of CAPS markers

[0075] PCR amplification program: 1 µL 2.5 mM dNTP, 0.25 µL 10 µM primer, 1 µL 10×EasyTaqBuffer, 0.5 U EasyTaq, 100 ng DNA template, and bring the total volume to 10 µL with double-distilled water.

[0076] PCR amplification program: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; annealing for 30 s with a 0.3℃ decrease per cycle starting at 62℃; extension at 72℃ for 30 s, 40 cycles; extension at 72℃ for 8 min.

[0077] Post-amplification enzyme digestion system: 5 µL PCR product, 1 µL 10×CutSmart Buffer, 0.5 U Dde I, and bring the total volume to 10 µL with double-distilled water.

[0078] Enzyme digestion procedure: After digestion with Dde I (its recognition sequence is C'TNAG) at 37℃ for 8 h, add 3 µL of 6×DNA Loading Buffer to the sample, and take 5 µL of the digested product for typing by 2.5% agarose gel electrophoresis.

[0079] like Figure 3 As shown, the band of Jing411 (weakly dormant / PHS-sensitive, TaMADS-3B-931-ins allelic variant) cannot be digested, while the band of Hongmangchun 21 (strongly dormant / PHS-resistant, TaMADS-3B-931-del allelic variant) can be digested. Figure 3 As can be seen, the length of the Jing411 band is greater than that of the Hongmangchun 21 band, and the bands are clearly visible and easy to identify. The nucleotide sequence of the amplified product of Hongmangchun 21 (strong dormancy / PHS resistance, TaMADS-3B-931-del allelic variant) is shown in SEQ NO.6, and the nucleotide sequence of the amplified product of Jing411 (weak dormancy / PHS responsive, TaMADS-3B-931-ins allelic variant) is shown in SEQ NO.7.

[0080] 2.2.4 Validation of CAPS markers in linked and natural populations

[0081] Germination index (GI) measurement

[0082] Fifty whole seeds from the parent line Jing 411 / Hongmangchun 21, 174 families (JH-RILs), and 192 wheat varieties were collected at different post-harvest times (5 days, 15 days, and 30 days after harvest) from 2014-2021 and 2015-2017, in two replicates. The seeds were evenly placed ventrally downwards in 90 mm diameter Petri dishes, with 10 mL of sterile water added. The dishes were incubated for 3 days at 20℃ under 14 h (daytime) / 10 h (nighttime) conditions. The number of germinated seeds (n1) on day 1, n2 on day 2, n3 on day 3, and the number of ungerminated seeds (n0) after 3 days were recorded. The germination index (GI) was calculated using the following formula:

[0083] GI=(3*n1+2*n2+n3) / 3* (n1+n2+n3+n0).

[0084] The phenotypic data was prepared using Excel software, and the correlation analysis between the phenotypic data and the labels was performed using SPSS software.

[0085] In the linked population (JH-RILs, containing 174 families) composed of two parental hybrids, Jing 411 and Hongmangchun 21 (Table 1 and...), the linkage population (JH-RILs, containing 174 families) (Table 1 and...) was established. Figure 4 ) and in a natural population of 192 wheat varieties (Table 2 and Figure 5 The Manny-Whitney test (U-test) analysis between different allelic types (TaMADS-3B-931-ins and TaMADS-3B-931-del types) and the PHS trait was performed using IBM SPSS Statistics 20 software (www.spss.com).

[0086] Table 1. Association between two allelic types, TaMADS-3B-931-ins and TaMADS-3B-931-del, and PHS traits, using the Jing 411 / Hongmangchun 21 linkage group.

[0087]

[0088] Note: 14GI-5, 15GI-5, 16GI-5, 17GI-5, 18GI-5, 19GI-5, and 21GI-5 refer to the seed germination index (GI) measured on the 5th day after wheat harvest in 2014, 2015, 2016, 2017, 2018, 2019, and 2021, respectively; 15GI-15, 16GI-15, 17GI-15, and 21GI-15 refer to the seed germination index (GI) measured on the 15th day after wheat harvest in 2014, 2015, 2016, 2017, and 2021, respectively; 16GI-30 is the seed germination index (GI) measured on the 30th day after wheat harvest in 2016.

[0089] * indicates that the two different allelic variants of the marker are highly significantly correlated with the seed dormancy phenotype at the 0.05 level;

[0090] **This indicates that the two different allelic variants of the marker are highly significantly correlated with the seed dormancy phenotype at the 0.01 level.

[0091] Table 2. Validation of the association between two allelic types, TaMADS-3B-931-ins and TaMADS-3B-931-del, and the PHS trait using a natural population of 192 wheat varieties.

[0092]

[0093] Note: 15ABAGI-5 and 15ABAGI-15 refer to the sensitivity of wheat seeds to ABA measured on the 5th and 15th days after wheat harvest in 2015, respectively; 15GI-5 and 15GI-15 refer to the seed germination index (GI) measured on the 5th and 15th days after wheat harvest in 2015, respectively; 17GI-5 refers to the seed germination index (GI) measured on the 5th day after wheat harvest in 2017.

[0094] * indicates that the two different allelic variants of the marker are highly significantly associated with the seed dormancy phenotype at the 0.05 level.

[0095] **This indicates that the two different allelic variants of the marker are highly significantly correlated with the seed dormancy trait at the 0.01 level.

[0096] From Table 1 and Figure 4 and Table 2 and Figure 5 It was found that the differences in PHS phenotypic values ​​(GI) between wheat varieties carrying the two allelic variants TaMADS-3B-931-del and TaMADS-3B-931-ins were extremely significant (P < 0.01).

[0097] 2.3 Determination of seed germination rate in plants overexpressing the TaMADS-3B gene

[0098] 2.3.1 Obtaining TaMADS-3B overexpressing plant materials

[0099] The Arabidopsis plants used in this application all share a common background, namely the Colombian ecotype (Col-0) of Arabidopsis.

[0100] (1) Obtaining and identifying homozygous Arabidopsis thaliana overexpressing TaMADS-3B

[0101] Fifty seeds with intact embryos from the Red Mangchun 21 variety were collected, mixed, and seed RNA was extracted and reverse transcribed into cDNA. The TaMADS-3B coding region sequence (as shown in SEQ ID NO.1) was amplified from the cDNA and inserted into the multiple cloning site of the pCAMBIA1305 vector. Expression was initiated using the CaMV35S promoter (the 35S promoter of cauliflower mosaic virus). Subsequently, the resulting plasmid was introduced into wild-type (Col-0) Arabidopsis thaliana through Agrobacterium-mediated transformation.

[0102] After sterilizing the obtained Arabidopsis thaliana T0 seeds, they were evenly spread on MS plates (with 50 mg / mL hygromycin Hyg added). When the Arabidopsis thaliana grew to the 7-leaf stage, 2-3 leaves were taken from each marked small square pot, and DNA from wild-type (Col-0) and transgenic plants was extracted. The homozygous transgenic line was finally determined by PCR amplification of the target gene.

[0103] Finally, homozygous Arabidopsis overexpression lines (T2 generation) were selected, including 35S:TaMADS-3B-10, 35S:TaMADS-3B-12 and 35S:TaMADS-3B-16, for further study.

[0104] (2) Obtaining TaMADS-3B overexpressing rice plants and identifying homozygotes

[0105] The plasmid obtained in step 2.3.1 (1) above was introduced into wild-type Nipponbare (Nip) rice by Agrobacterium-mediated transformation. The obtained rice T0 seedlings were planted in season, and the DNA of wild-type (Nip) and transgenic plants was extracted. The target gene was amplified by PCR to finally determine the homozygous transgenic line.

[0106] Three homozygous rice overexpression lines (T2 generation) were finally selected for further study: 35S:TaMADS-3B-18, 35S:TaMADS-3B-22, and 35S:TaMADS-3B-24.

[0107] (3) Obtaining Arabidopsis thaliana homologous gene overexpression plants and identifying homozygous lines

[0108] The Arabidopsis homology gene AtMADS-box51 (AT4G22950) was purchased from AraShare Science (https: / / www.arashare.cn / index.html).

[0109] AtMADS-box51 overexpressing homozygous lines were identified using hygromycin primers. The specific primer sequences are as follows:

[0110] SEQ ID NO.18: AtMADS-box51-F: 5' ACGGGTTCGTCCATCACAGTTTGCC 3';

[0111] SEQ ID NO. 19: AtMADS-box51-R: 5'TTCCGGAAGTGCTTGACATTGGGGA 3'.

[0112] Finally, homozygous Arabidopsis overexpression lines (T2 generation) were selected, including AtMADS-box51-OE6, AtMADS-box51-OE16, and AtMADS-box51-OE17, for further research.

[0113] 2.3.2 Growth Management of Plant Materials

[0114] (1) Seeds of heterologous overexpressing Arabidopsis thaliana (35S:TaMADS-3B-10, 35S:TaMADS-3B-12 and 35S:TaMADS-3B-16) and overexpressing Arabidopsis thaliana homologous gene overexpressing plants (AtMADS-box51-OE6, AtMADS-box51-OE16, AtMADS-box51-OE17), as well as wild-type seeds, were vernalized in MS medium for 3 days (4℃) to break dormancy. Subsequently, they were transferred to an incubator with a daytime temperature of 23℃, a nighttime temperature of 20℃, a photoperiod of 16 h, a dark period of 8 h, and a relative humidity of 60% for 10 days. Then, Arabidopsis thaliana seedlings were transplanted into small square pots (black soil:vermiculite = 1:3), covered with plastic wrap for 3-4 days, and watered regularly. Seeds were harvested 25 days after flowering (i.e., when most of the flowers on the first branch of Arabidopsis thaliana were in bloom).

[0115] (2) The T2 generation homozygous line of overexpressing rice plants and its wild type were cultured in a well-managed growth chamber. The temperature of the growth chamber was set at 28℃ during the day and 25℃ at night, with a photoperiod of 10 days, a dark period of 14 days, a relative humidity of 70%, and a light intensity of 200 mol photonsm-2s-1 until wild type and T2 transgenic rice seeds were obtained.

[0116] 2.3.3 Determination of Seed Dormancy Phenotype

[0117] 2.3.3.1 Determination of dormancy phenotype in Arabidopsis seeds

[0118] (1) Disinfect the Arabidopsis seeds harvested in step 2.3.2 (1), then evenly spot them on an MS plate and place them in a greenhouse (the greenhouse is set with a light time of 16 h and a dark time of 8 h; the light intensity is set to 100-150 umol / m-2s-1; the indoor temperature is set to 22℃ under light conditions and 20℃ under dark conditions; a humidity control system is selected and the relative humidity is set to 70%).

[0119] (2) Observe and record the seed germination rate and germination index after 3 days. Continue to plant the phenotyped and stable lines, repeat the germination test, and take pictures for preservation.

[0120] Figure 6-7 The image shown is of the TaMADS-3B transgenic strain ( Figure 6 ) and homologous gene overexpression ( Figure 7 Seed germination rate determination results of Arabidopsis thaliana lines (both wild-type and wild-type (WT, Col-0)) are as follows: Figure 6 The results showed that the seed germination rate of the 35S:TaMADS-3B line (70%) was lower than that of the WT line (87%), which highlights the positive regulatory effect of TaMADS-3B on seed dormancy and panicle germination resistance.

[0121] like Figure 7 The results showed that the seed germination rate (80%) of the Arabidopsis homolog overexpression lines AtMADS-box51-OE6, AtMADS-box51-OE16, and AtMADS-box51-OE17 was lower than that of the WT line (90%), indicating that the AtMADS-box51 gene has a similar function to the TaMADS-3B gene and promotes seed dormancy.

[0122] 2.2.3.2 Determination of seed dormancy phenotype in rice overexpression lines

[0123] (1) Add germination paper to a round glass petri dish with a diameter of 11 cm, sterilize, and set aside;

[0124] (2) The wild-type and T2 transgenic rice seeds harvested in step 2.3.2 (2) were disinfected with 0.1% sodium hypochlorite solution for 15 min, rinsed 5 times with distilled water, and 50 seeds were selected from each seed and sown in 3 petri dishes. 10 mL of distilled water was added for treatment. The seeds were then exposed to light at 28 ℃ for 16 h and then in darkness at 26 ℃ for 8 h with a relative humidity of 60%.

[0125] (3) Observe and record the germination rate and germination index of seeds after 5-7 days. Continue to plant the phenotyped and stable lines, repeat the germination test, and take photos for preservation.

[0126] Figure 8 The results of seed germination rate determination for TaMADS-3B transgenic and wild-type (WT, Nipponbare, Nipponbare) rice lines showed that the germination rate of seeds from the 35S:TaMADS-3B overexpression line was significantly lower than that of WT seeds during the soaking process. These results indicate that heterologous overexpression of TaMADS-3B improves rice seed dormancy and enhances panicle germination resistance.

[0127] 3. Conclusion

[0128] This application used transcriptome sequencing to identify a candidate seed dormancy gene, TaMADS-3B. qRT-PCR was used to detect the relative expression levels of TaMADS-3B at different seed infiltration stages in two wheat varieties, Jing 411 (J411, weak dormancy / susceptible to pre-sprouting) and Hongmangchun 21 (HMC21, strong dormancy / resistant to pre-sprouting), which showed significant differences in seed dormancy levels and pre-sprouting resistance. The results showed that the relative expression level of TaMADS-3B in the strong dormancy (resistant to pre-sprouting) variety HMC21 was significantly higher than that in the weak dormancy (susceptible to pre-sprouting) variety J411, consistent with the transcriptome sequencing results. This verifies that the TaMADS-3B gene is closely related to seed dormancy and positively regulates plant seed dormancy levels and PHS resistance (pre-sprouting resistance).

[0129] The results of cloning and sequencing comparison of the TaMADS-3B gene in J411 and HMC21 show that the TaMADS-3B gene has a 1 bp insertion or deletion (insertion or deletion of T) in the promoter region (promoter region -931 bp position), which causes a change in an ACE cis-acting element.

[0130] Based on this sequence variation, this application developed a CAPS marker TaMADS-3B-931 (containing two allelic variant types, TaMADS-3B-931-del and TaMADS-3B-931-ins); and used a linkage population (JH-RILs, including 174 families) composed of crosses of Jing 411 and Hongmangchun 21 and a natural population composed of 192 wheat varieties to jointly verify the above-mentioned CAPS marker TaMADS-3B-931 and the seed germination index. The seed germination index (GI) was highly significantly correlated with that of wheat varieties carrying the HMC21 genotype (TaMADS-3B-931-del allelic variant). The GI of wheat varieties carrying the J411 genotype (TaMADS-3B-931-ins) was significantly lower than that of wheat varieties carrying the J411 genotype (TaMADS-3B-931-ins). This indicates that the CAPS marker TaMADS-3B-931 developed in this invention can effectively distinguish between wheat varieties with strong / weak dormancy (resistant / susceptible to PHS), providing important genetic resources and molecular markers for creating new germplasm with strong dormancy / resistant to pre-sprouting and for breeding new varieties with strong dormancy / resistant to pre-sprouting through transgenic or gene editing methods.

[0131] Furthermore, through germination rate experiments on TaMADS-3B transgenic Arabidopsis overexpression lines, Arabidopsis homolog overexpression lines, and TaMADS-3B transgenic rice overexpression lines, it was further demonstrated that the TaMADS-3B gene positively regulates plant seed dormancy level and PHS resistance (pre-sprout germination resistance).

[0132] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. The application of a TaMADS-3B gene in regulating seed dormancy levels and PHS resistance in plants, characterized in that, The nucleotide sequence of the TaMADS-3B gene is shown in SEQ ID NO.

1. The TaMADS-3B gene positively regulates the seed dormancy level and PHS resistance in plants, and the plants are wheat, rice or Arabidopsis thaliana.

2. The application of a CAPS marker in identifying dormancy levels and PHS resistance in wheat seeds, characterized in that, The CAPS is labeled TaMADS-3B-931, which includes primers for amplifying the sequence of the -931st polymorphic site in the promoter region of the TaMADS-3B gene and its upstream and downstream nucleotides. The genotype of the -931st polymorphic site in the promoter region of the TaMADS-3B gene is an insertion or deletion of T. The nucleotide sequence of the TaMADS-3B gene is shown in SEQ ID NO.

1. The restriction endonuclease Dde I was used to verify the TaMADS-3B-931 genotype. When the wheat seeds are of the TaMADS-3B-931-del genotype, they are strong dormancy or PHS-resistant wheat varieties; when the wheat seeds are of the TaMADS-3B-931-ins genotype, they are weak dormancy or PHS-susceptible wheat varieties.

3. The application according to claim 2, characterized in that, Strongly dormant or PHS-resistant wheat contains the nucleotide sequence shown in SEQ ID NO. 6, and weakly dormant or PHS-susceptible wheat contains the nucleotide sequence shown in SEQ ID NO.

7.

4. A method for identifying dormancy level and PHS resistance in wheat seeds using CAPS markers, characterized in that, Includes the following steps: S1. Extract total RNA from wheat seeds and reverse transcribe it into cDNA; S2. Using the nucleotide sequence composed of the TaMADS-3B-931 polymorphic site and its upstream and downstream nucleotides as the amplification template, CAPS primers were designed and PCR amplification was performed to obtain the amplification product containing the TaMADS-3B-931 polymorphic site. S3. Verify the genotype of TaMADS-3B-931 using restriction endonucleases, determine the gene type of the amplified product based on the genotype of TaMADS-3B-931, and determine the dormancy level of wheat seeds based on the gene type. The CAPS is labeled TaMADS-3B-931, which includes primers for amplifying the sequence of the -931st polymorphic site in the promoter region of the TaMADS-3B gene and its upstream and downstream nucleotides. The genotype of the -931st polymorphic site in the promoter region of the TaMADS-3B gene is an insertion or deletion of T. The nucleotide sequence of the TaMADS-3B gene is shown in SEQ ID NO.

1. The restriction endonuclease Dde I was used to verify the TaMADS-3B-931 genotype. When the wheat seeds are of the TaMADS-3B-931-del genotype, they are strong dormancy or PHS-resistant wheat varieties; when the wheat seeds are of the TaMADS-3B-931-ins genotype, they are weak dormancy or PHS-susceptible wheat varieties.

5. The method according to claim 4, characterized in that, The specific CAPS primers are as follows: SEQ ID NO.4: TaMADS-3B-931-F: 5' GTGGAGACGGAAGGGGA 3'; SEQ ID NO.5:TaMADS-3B-931-R:5' AGGCAAGGGCTGCTGTG 3'。

Citation Information

Patent Citations

  • Gene related to dormancy / pre-harvest germination resistance of wheat seeds and application thereof

    CN114958872A

  • SNP (Single Nucleotide Polymorphism) molecular marker related to wheat pre-harvest sprouting resistance and application of SNP molecular marker

    CN114959101A