Methods for base editing ectopic kidneys and spatial omics imaging monitoring methods

By using APOBEC3 base editing enzyme CD68 cell conditional knockout mice, an ectopic kidney development model was established. Combined with spatial omics imaging technology, the problems of gene silencing and treatment strategy failure during ectopic kidney development were solved, and effective monitoring and evaluation of renal function were achieved.

CN118340131BActive Publication Date: 2025-11-28BEIHANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410590915.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-13
Publication Date
2025-11-28
Estimated Expiration
2044-05-13

AI Technical Summary

Technical Problem

In existing technologies, the genes of engineered cells are easily silenced during the development of ectopic kidneys, making it difficult to predict changes in organoid morphology and function. Furthermore, in vivo base editing causes engineered cell therapy strategies to fail, making it difficult to effectively monitor and evaluate kidney organoid development in autoimmune disease models.

Method used

Using APOBEC3 base editing enzyme CD68 cell conditional knockout mice, the Apobec3 gene in CD68+ macrophages was knocked out in the C57BL/6 mouse gene background to obtain cytidine deaminase conditional knockout engineered cells, which were then implanted into an autoimmune disease mouse model. Kidney function was monitored using spatial omics imaging technology to establish an autoimmune-renal model.

Benefits of technology

It simplifies the experimental procedure, reduces the immune response, prolongs the effect of cell transplantation, and provides a therapeutic research model in the context of immune diseases by quantitatively assessing renal function through gene mapping.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118340131B_ABST
    Figure CN118340131B_ABST
Patent Text Reader

Abstract

The application relates to the field of biotechnology and relates to immune monitoring and imaging, and particularly discloses a base editing ectopic kidney method and a spatial omics imaging monitoring method. The base editing ectopic kidney method comprises the following steps: extracting and screening cytidine deaminase conditional knockout engineered cells of base editing conditional knockout young mice; the cytidine deaminase conditional knockout engineered cells are implanted into a spontaneous immune disease mouse model characterized by nephritis, and an autoimmune-kidney generation model is established. The young mice of APOBEC3 base editing enzyme CD68 cell conditional knockout mice are used as a functional cell source, the cytidine deaminase is not translated, the young mice are suitable for ectopic kidney generation, and the time cost required by single cell amplification, breeding and screening in a traditional cell transplantation scheme is avoided, and the experimental process is greatly simplified.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and relates to immune monitoring and imaging, in particular to a method for base editing ectopic kidney and a method for spatial omics imaging monitoring. BACKGROUND

[0002] For autoimmune diseases, cell therapy and ectopic organogenesis are the frontiers of clinical technology. This technology is to transplant the functional cells of the required organ into the lymph node to differentiate into ectopic organ of the lymph node, so as to achieve the personalized treatment goal of ectopic compensation function. This technology has the technical advantage of being not affected by the in-situ environment of the diseased organ.

[0003] However, in the evolution process of the lymph node ectopic organ of the autoimmune disease model, the important genes of the engineered cells are prone to be silenced, making the morphology and function of the organoid difficult to predict. Therefore, there is an urgent need for a monitoring technology for the immune microenvironment of the ectopic organ regeneration, and a method for spatial omics measurement of the structure and cell molecular function of the organoid.

[0004] For example, 15% of patients with lupus nephritis will develop end-stage renal disease, and the 5-year survival rate of patients receiving kidney transplantation will double. However, the immune environment of the renal tissue region of lupus patients is complex and variable, and the external available kidney sources are scarce. Recent frontier research shows that during the evolution of autoimmune diseases, the increase in C to T base mutations of the whole genome DNA sequence mediated by APOBEC3 base editing enzyme (cytidine deaminase) is associated with immune regulation disorders, making the silencing of the genes encoding the surface receptors of the engineered cells, the deterioration or difficulty in predicting the cell therapy.

[0005] In summary, for autoimmune diseases, the realization of kidney organogenesis in the lymph node and in vivo base editing targeted monitoring will significantly improve the treatment prognosis of lupus nephritis, but there is a frontier technology problem in the prior art that in vivo base editing leads to the failure of engineered cell therapy strategies. SUMMARY

[0006] Based on this, the present application provides a method for base editing ectopic kidney and a method for spatial omics imaging monitoring, which is suitable for important application scenarios of engineered cell research for kidney organ failure and difficult in-situ transplantation.

[0007] According to a first aspect of the present application, a method for base editing ectopic kidney is provided, comprising the following steps:

[0008] Extract and screen cytidine deaminase conditional knockout engineered cells of base editing conditional knockout young mice;

[0009] The cytidine deaminase conditionally knockout engineered cells are implanted into a spontaneous immune disease mouse model with nephritis characteristics to establish an autoimmune-nephrogenesis model as the ectopic kidney of the base editing.

[0010] According to an embodiment of the present application, the base editing conditionally knockout young mouse is a B6.CD68 Cre / Cre .Apobec3 flp / flp Mouse, by CD68 + macrophage-Apobec3 gene conditionally knockout in a C57BL / 6 mouse genetic background.

[0011] And / or, the base editing conditionally knockout young mouse expresses cytidine deaminase conditionally knockout in CD68 macrophages and normal expression of cytidine deaminase in other cells.

[0012] According to an embodiment of the present application, the extracting and screening cytidine deaminase conditionally knockout engineered cells of the base editing conditionally knockout young mouse comprises:

[0013] The APOBEC3 base editing enzyme CD68 cell conditionally knockout mouse is taken out, and the young mouse kidney cells are obtained by dissection as the cytidine deaminase conditionally knockout engineered cells.

[0014] According to an embodiment of the present application, the cytidine deaminase conditionally knockout engineered cells are implanted into a spontaneous immune disease mouse model with nephritis characteristics to establish an autoimmune-nephrogenesis model, comprising:

[0015] Selecting a spontaneous immune disease mouse model with nephritis phenotype;

[0016] Injecting the extracted cytidine deaminase conditionally knockout engineered cells into the abdominal lymph nodes of the spontaneous immune disease mouse model with nephritis phenotype by needle puncture.

[0017] Among them, the spontaneous immune disease mouse model with nephritis phenotype is B6.Lyz2 luci / luci .Ncf1 * / * .Fas lpr / lpr Mouse;

[0018] The spontaneous immune disease mouse model with nephritis phenotype is genetically edited in a C57BL / 6 mouse genetic background, has a macrophage conditionally fluorescent tracer marker, a Ncf1 gene mononucleotide mutation, and a Fas gene sequence inserted into the transposon element Alu, and can spontaneously obtain a lupus phenotype, which gradually develops into lupus nephritis at 4 to 8 weeks.

[0019] According to a second aspect of the present application, an autoimmune-nephrogenesis model prepared by the above method is provided.

[0020] According to a third aspect of the present application, there is provided a method for monitoring the spatial omics imaging of the autoimmune-nephrogenesis model as described above, comprising the following steps:

[0021] Monitoring the disease progression, nephrogenesis progression and kidney function level of the autoimmune-nephrogenesis model in vivo;

[0022] At the end stage of nephritis, performing spatial omics detection on the autoimmune-nephrogenesis model, establishing a kidney function map, and quantitatively evaluating the nephrogenesis progression.

[0023] According to an embodiment of the present application, the monitoring of the disease progression, nephrogenesis progression and kidney function level of the autoimmune-nephrogenesis model in vivo comprises:

[0024] Performing spontaneous fluorescence live imaging on the autoimmune-nephrogenesis model once a week to detect the inflammation progression of the body surface organs;

[0025] Performing urine protein detection on the autoimmune-nephrogenesis model once every 3 days;

[0026] Performing anti-nuclear antibody detection on the autoimmune-nephrogenesis model once every 7 days to obtain kidney function indicators and blood anti-nuclear antibody indicators.

[0027] According to an embodiment of the present application, the spatial omics detection on the autoimmune-nephrogenesis model at the end stage of nephritis comprises:

[0028] At the end stage of nephritis, performing heart perfusion on the autoimmune-nephrogenesis model to obtain tissues such as in-situ kidney, abdominal lymph nodes or ectopic kidney, and preparing tissue sections;

[0029] Using spatial omics imaging technology, through multiple rounds of imaging, image registration, single cell segmentation, the spatial transcription expression level of the in-situ kidney function related genes of the autoimmune-nephrogenesis model is extracted;

[0030] Detecting the in-situ kidney function related genes of the autoimmune-nephrogenesis model;

[0031] The in-situ kidney function related genes comprise APOBEC3 base editing enzyme CD68 cell conditional knockout mouse specific sequence, lupus mouse cell specific sequence, and base editing target sequence of cytidine deaminase, and the cell typing of the transplanted donor mouse cells in the recipient tissue is identified.

[0032] According to an embodiment of the present application, the establishment of the kidney function map comprises using Umap dimension reduction clustering to establish a spatial omics correlation map, and the spatial omics correlation map comprises:

[0033] Orthotopic-ectopic kidney association transcriptome, which is obtained by comparing the overlap between the orthotopic kidney spatial omics map and the ectopic kidney spatial omics map of the autoimmune-renal development model, is used to show the spatial omics functional similarity between the ectopic kidney and the orthotopic kidney in the autoimmune-renal development model and the spatial similarity of genes encoding key immune function molecules, and to monitor the function and immune environment of the ectopic kidney;

[0034] The base editing association map was obtained by comparing the overlap and differentially expressed genes of the comparative orthotopic and ectopic kidney maps of the autoimmune-renal development model. The base editing association map shows the effect of in vivo base editing on ectopic kidney development.

[0035] Ectopic nephrogenesis association map, by comparing the overlap and differentially expressed genes of ectopic kidney spatial omics maps in the autoimmune-nephrogenesis model, is used to show the compensatory effect of ectopic nephrogenesis on lupus nephritis and the influence of key molecular encoding genes of immune function.

[0036] According to an embodiment of the present invention, the quantitative assessment of renal progression includes:

[0037] By comparing the overlap and differentially expressed genes between the orthotopic and ectopic kidney transcriptional maps, base editing association maps, and ectopic kidney development association maps, the occurrence level and functional degree of ectopic kidney function can be quantitatively assessed, thereby achieving a quantitative evaluation of the compensatory effect of ectopic kidneys.

[0038] As can be seen from the above technical solutions, the method for base editing ectopic kidneys and the space omics imaging monitoring method provided by the present invention have the following beneficial effects:

[0039] (1) Young mice from conditionally knocked-out CD68 cells of APOBEC3 base editing enzyme were used as the source of functionalized cells. + Knocking out the Apobec3 gene in cells prevents the translation of cytidine deaminase, making it suitable for ectopic kidney development. This avoids the time and cost required for single-cell expansion, propagation, and screening in traditional cell transplantation protocols, and greatly simplifies the experimental process.

[0040] (2) Conditional knockout of untranslated cytidine deaminase in renal cells by APOBEC3 base editing enzyme CD68 cells reduces immune response and prolongs cell transplantation effect.

[0041] (3) Use spatial omics technology to generate a kidney gene map and quantitatively assess kidney function at the gene transcription level;

[0042] (4) Using a lupus mouse model, we will assess the level of kidney development in the pathological environment of immune diseases, and provide a research model and treatment plan for the treatment of organ failure in the context of autoimmune diseases. Attached Figure Description

[0043] Fig. 1 Flow chart of the method for base editing ectopic kidney and the method for spatial omics imaging monitoring of embodiment 1 of the present application;

[0044] Fig. 2 Flow chart of the method for base editing ectopic kidney and the method for spatial omics imaging monitoring of embodiment 1 of the present application;

[0045] Fig. 3 Flow chart of the method for base editing ectopic kidney and the method for spatial omics imaging monitoring of embodiment 1 of the present application; DETAILED DESCRIPTION

[0046] In order to make the objects, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to specific embodiments and drawings.

[0047] According to a first aspect of the present application, a method for base editing ectopic kidney comprises the following steps:

[0048] S1: Extract and screen cytosine deaminase conditional knockout engineered cells of base editing conditional knockout young mice;

[0049] S2: Implant the cytosine deaminase conditional knockout engineered cells into a spontaneous immune disease mouse model characterized by nephritis, to establish an autoimmune-nephrogenesis model.

[0050] According to an embodiment of the present application, a control mouse model is also established, which is a C57BL / 6 mouse, a widely used inbred experimental mouse.

[0051] According to an embodiment of the present application, in S1, the base editing conditional knockout young mouse is a B6.CD68 Cre / Cre .Apobec3 flp / flp Mouse, which is obtained by conditional knockout of the CD68 + macrophage-Apobec3 gene in the genetic background of C57BL / 6 mice.

[0052] According to an embodiment of the present application, the base editing conditional knockout young mouse expresses cytosine deaminase conditional deletion in CD68-expressing macrophages, and cytosine deaminase is normally expressed in other cells.

[0053] According to an embodiment of the present application, in S2, the extraction and screening of cytosine deaminase conditional knockout engineered cells of base editing conditional knockout young mice comprises:

[0054] The APOBEC3 base editing enzyme CD68 cell conditional knockout mouse is taken out, and the kidney cells of the young mouse are obtained by dissection, as the cytidine deaminase conditional knockout engineered cells.

[0055] According to an embodiment of the present application, S2 comprises taking out 1-day-old young mice of APOBEC3 base editing enzyme CD68 cell conditional knockout mice and control mice, obtaining kidney cells of the young mice by dissection, and transplanting kidney cells of the conditional knockout mouse young mice and kidney cells of the control mouse young mice into 4-week-old lupus mice, respectively.

[0056] According to an embodiment of the present application, in S2, the cytidine deaminase conditional knockout engineered cells are implanted into a spontaneous immune disease mouse model with nephritis phenotype to establish an autoimmune-nephrogenesis model, comprising:

[0057] A spontaneous immune disease mouse model with nephritis phenotype is selected.

[0058] The extracted cytidine deaminase conditional knockout engineered cells are injected into the abdominal lymph nodes of the spontaneous immune disease mouse model with nephritis phenotype by needle puncture.

[0059] According to an embodiment of the present application, in S2, the spontaneous immune disease mouse model with nephritis phenotype is B6.Lyz2 luci / luci .Ncf1 * / * .Fas lpr / lpr mouse.

[0060] The spontaneous immune disease mouse model with nephritis phenotype is genetically edited on the C57BL / 6 mouse genetic background, has conditional fluorescent tracing markers of macrophages, Ncf1 gene single nucleotide mutations, and Fas gene sequence insertion of transposon element Alu, can spontaneously obtain a lupus phenotype, and gradually develops into lupus nephritis at 4 to 8 weeks.

[0061] According to an embodiment of the present application, S2 specifically comprises selecting a 4-week-old spontaneous immune disease mouse model with nephritis phenotype, hereinafter referred to as a lupus mouse, injecting the extracted conditional knockout mouse kidney cells into the abdominal lymph nodes of the lupus mouse by needle puncture, and setting up a control group injected with control mouse kidney cells and a control group injected with control mouse kidney cells and base editing target sequences. The lupus mouse is specifically B6.Lyz2 luci / luci .Ncf1 * / * .Fas lpr / lpr mouse, preferably 4 weeks old, which is genetically edited on the C57BL / 6 mouse genetic background, has conditional fluorescent tracing markers of macrophages, Ncf1 gene single nucleotide mutations, and Fas gene sequence insertion of transposon element Alu, can spontaneously obtain a lupus phenotype, and gradually develops into lupus nephritis at 4 to 8 weeks.

[0062] According to an embodiment of the present application, S2 specifically comprises establishing four groups of autoimmune-nephrogenesis models, specifically comprising:

[0063] A1. APOBEC3 base editing enzyme CD68 cell conditional knockout mouse pup kidney cells + lupus mouse recipient model;

[0064] A2. Control mouse pup kidney cells + lupus mouse recipient model;

[0065] A3. Control mouse pup kidney cells + lupus mouse recipient model + injection of base editing target sequence;

[0066] A4. Sham operation + lupus mouse recipient model.

[0067] In the A1 group, the Apobec3 gene is deleted in the CD68 cell macrophages of the APOBEC3 base editing enzyme CD68 cell conditional knockout mouse pup, so that the APOBEC3 base editing enzyme cannot be transcribed, and compared with the normal genotype, a large number of unedited C-T sites to be mutated are contained in the cells. The lupus mouse as a recipient naturally contains cytidine deaminase, and the cytidine deaminase in the recipient mouse cells can edit the implanted APOBEC3 base editing enzyme CD68 cell conditional knockout mouse macrophages, compared with the normal transplanted cells, the heterologous C-T mutation carried in the cells can be reduced, and the anti-viral inflammatory response can be reduced. In the A2 group, cytidine deaminase exists in the control pup kidney cells, and the C-T mutation site has been edited, which is easy to trigger the immune inflammatory response of the recipient mouse, and the nephrogenic cells are easy to be inhibited, and the efficacy is shortened compared with the A1 group. In the A3 group, the base editing target sequence is increased, which is used as a control with the A2 group, and the injected base editing target sequence interferes with the base editing of the cytidine deaminase in the recipient cells of the lupus mouse, prolongs the cell activity cycle, and prolongs the efficacy compared with the A2 group. In the A4 group, the lupus mouse recipient model has no cell implantation, and gradually develops into lupus nephritis spontaneously at the age of 4 to 8 weeks.

[0068] According to a second aspect of the present application, an autoimmune-nephrogenesis model prepared by the above method is provided.

[0069] According to a third aspect of the present application, a spatial omics imaging monitoring method of the above-mentioned autoimmune-nephrogenesis model is provided, comprising the following steps:

[0070] P1: monitoring the disease progression, nephrogenesis progression and kidney function level of the autoimmune-nephrogenesis model in vivo;

[0071] P2: performing spatial omics detection on the autoimmune-nephrogenesis model at the end stage of nephritis, establishing a kidney function map, and quantitatively evaluating the nephrogenesis progression.

[0072] According to an embodiment of the present application, P1 comprises monitoring the disease progression of the autoimmune-nephrogenesis model, the nephrogenesis progression and the kidney function level in vivo, including:

[0073] The spontaneous fluorescence live imaging of the autoimmune-nephrogenesis model is performed once a week to detect the inflammation progression of the surface organ;

[0074] The urine protein detection of the autoimmune-nephrogenesis model is performed once every 3 days;

[0075] The anti-nuclear antibody detection of the autoimmune-nephrogenesis model is performed once every 7 days to obtain the kidney function index and the blood anti-nuclear antibody index.

[0076] According to an embodiment of the present application, P2 comprises, at the end stage of nephritis, performing the spatial omics detection on the autoimmune-nephrogenesis model, including:

[0077] At the end stage of nephritis, the heart perfusion is performed on the autoimmune-nephrogenesis model to obtain tissues such as in-situ kidney, abdominal lymph node or ectopic kidney, and tissue sections are prepared;

[0078] The spatial transcription expression level of the in-situ kidney function related gene of the autoimmune-nephrogenesis model is extracted by using the spatial omics imaging technology, through multiple rounds of imaging, image registration and single cell segmentation;

[0079] The in-situ kidney function related gene of the autoimmune-nephrogenesis model is detected;

[0080] The in-situ kidney function related gene contains the APOBEC3 base editing enzyme CD68 cell conditional knockout mouse specific sequence, the lupus mouse cell specific sequence, and the base editing target sequence of the cytidine deaminase, and the cell typing of the transplanted donor mouse cells in the recipient tissue is identified.

[0081] According to an embodiment of the present application, P2 specifically comprises: at the age of 8 weeks of the model mouse, after implanting the engineered cells for 4 weeks, the mouse is over-anesthetized and sacrificed, the heart perfusion is performed to obtain tissues such as in-situ kidney, abdominal lymph node or ectopic kidney, tissue sections are prepared, the spatial transcription expression level of 120 in-situ kidney function related genes is extracted by using the spatial omics imaging technology, through multiple rounds of imaging, image registration and single cell segmentation. The detected gene contains the APOBEC3 base editing enzyme CD68 cell conditional knockout mouse specific sequence, the lupus mouse cell specific sequence (Ncf1 defect), and the base editing target sequence of the cytidine deaminase, and the cell typing of the transplanted donor mouse cells in the recipient tissue is identified. The spatial omics imaging technology is suitable for the commercial 10x Visium technology or STARmap, smFISH and other spatial omics technologies, the lower limit is to detect 120 genes, and the spatial resolution accuracy is higher than 55 microns.

[0082] According to an embodiment of the present application, P2 comprises: establishing a kidney function atlas comprises utilizing Umap dimensionality reduction clustering, establishing a spatial correlation atlas, the spatial correlation atlas comprises:

[0083] An in-situ-ex situ kidney correlation transcription atlas, the in-situ-ex situ kidney correlation transcription atlas is obtained by comparing the coincidence degree of the in-situ kidney spatial omics atlas and the ex situ kidney spatial omics atlas of the autoimmune-kidney generation model, and is used to show the spatial omics function similarity and the spatial similarity of the immune function key molecule coding genes of the in-situ kidney and the ex situ kidney in the autoimmune-kidney generation model and monitor the ex situ kidney function and the immune environment;

[0084] A base editing correlation atlas, the base editing correlation atlas is obtained by comparing the coincidence degree and the differential genes of the comparison of the in-situ and ex situ kidney atlas of the autoimmune-kidney generation model, and the base editing correlation atlas shows the influence of the in-vivo base editing on the ex situ kidney generation;

[0085] An ex situ kidney generation correlation atlas, the ex situ kidney generation correlation atlas is obtained by comparing the coincidence degree and the differential genes of the ex situ kidney spatial omics atlas of the autoimmune-kidney generation model, and is used to show the compensation effect of the ex situ kidney generation on the lupus nephritis and the influence of the immune function key molecule coding genes thereof.

[0086] According to an embodiment of the present application, P2 specifically comprises: for the spatial omics data of the in-situ and lymph node ex situ kidney of each group, utilizing Umap dimensionality reduction clustering, establishing four groups of spatial correlation atlases:

[0087] An in-situ-ex situ kidney correlation transcription atlas, A1, A2, A3 and A4 groups compare the coincidence degree of the in-situ kidney spatial omics atlas and the ex situ kidney spatial omics atlas respectively; show the spatial omics function similarity and the spatial similarity of the immune function key molecule (NOX2, FAS, TCR, IgG, etc.) coding genes of the in-situ kidney and the ex situ kidney in each group and monitor the ex situ kidney function and the immune environment;

[0088] A base editing correlation atlas, the coincidence degree and the differential genes of the comparison of the in-situ and ex situ kidney atlas among A1-A3 three groups; show the influence of the in-vivo base editing (A1+A2 group differential genes, A2+A3 group differential genes, A1+A3 group gene correlation) on the ex situ kidney generation;

[0089] An ex situ kidney generation correlation atlas, the coincidence degree and the differential genes of the ex situ kidney spatial omics atlas among A1-A4 four groups; show the compensation effect of the ex situ kidney generation (A2+A4 group differential genes) on the lupus nephritis and the influence of the immune function key (NOX2, FAS, TCR, IgG, etc.) molecule coding genes thereof.

[0090] According to an embodiment of the present application, P2 comprises: quantitatively evaluating kidney generation progress comprises:

[0091] By in-situ-ex-renal correlation transcriptome, base editing correlation graph and ex-renal genesis correlation graph, the coincidence and differential genes of the ex-renal graph and the in-situ renal graph are compared, the occurrence level and functional degree of the ex-renal function are quantitatively evaluated, and the compensatory effect of the ex-renal kidney is quantitatively evaluated.

[0092] The technical solutions of the application will be described in detail below through preferred embodiments. It should be noted that the specific embodiments below are only used for illustration and do not limit the application.

[0093] Embodiment:

[0094] As shown in Figs. 1-3 , an ex-renal genesis based on in-vivo base editing and a spatial omics monitoring method thereof are disclosed, comprising the following steps:

[0095] Step S1. Extract and screen base editing conditional knockout kidney cells, implant a spontaneous autoimmune disease mouse model characterized by nephritis, and establish 3 groups of autoimmune-renal genesis models.

[0096] The step of extracting and screening base editing conditional knockout kidney cells specifically comprises:

[0097] The 1-day-old APOBEC3 base editing enzyme CD68 cell conditional knockout mouse or control mouse offspring pups are taken out, and the kidney of the pup is surgically obtained under a dissecting microscope. 2 milliliters of 0.25% trypsin-EDTA are added dropwise to lyse the cells, and the kidney cell suspension is prepared by grinding. The supernatant is discarded by centrifugation, and the cells are resuspended in PBS to a concentration of 10^7 cells per milliliter, and stored on ice.

[0098] The step of implanting a spontaneous autoimmune disease mouse model characterized by nephritis specifically comprises:

[0099] The 4-week-old female lupus mice are randomly divided into 4 groups (A1 group, APOBEC3 base editing enzyme CD68 cell conditional knockout mouse kidney cells + lupus mouse recipient model; A2 group, control pup kidney cells + lupus mouse recipient model; A3 group, control pup kidney cells + lupus mouse recipient model + injection of base editing target sequence; A4 group, sham operation + lupus mouse recipient model.), and preferably 3 mice in each group. As Fig. 2As shown, based on mouse body weight, 20 micrograms of diclofenac per gram of body weight were injected intraperitoneally to eliminate myeloid cells in the mice. Three days after the injection, the abdominal hair of the mice was removed using depilatory cream, and a 5 mm incision was made above the lymph node epithelium to expose the lymph nodes (preferably the right inguinal lymph nodes). Young mouse kidney cells were injected into the lymph nodes, and the wound was sutured. Specifically, in group A1, 10 microliters of freshly extracted APOBEC3 base editing enzyme CD68 cells at a concentration of 10^7 / mL were injected into the lymph nodes of each mouse to conditionally knock out mouse kidney cells; in group A2, 10 microliters of freshly extracted control mouse kidney cells at a concentration of 10^7 / mL were injected into the lymph nodes of each mouse; in group A3, the procedure was the same as in group A2, and an additional 100 microliters of 100 nanomolar concentration base editing target sequence DNA (5') was injected intraperitoneally into each mouse.

[0100] ATACGCGATACAATTTGATCAGTATA 3'); In group A4, 10 μL of PBS was injected into the lymph nodes of each mouse.

[0101] Step S2. Monitor disease progression, renal development, and renal function levels in vivo.

[0102] The specific steps for monitoring disease progression in vivo include:

[0103] Starting 3 days after kidney cell implantation or sham surgery, autofluorescence in vivo imaging was performed on each group to record the autofluorescence levels in the limb joints and abdominal cavity. 20 μL of urine was collected every 3 days for urine protein testing using urine protein test strips. 50 μL of facial blood was collected weekly, allowed to stand at room temperature for 30 minutes, then centrifuged at 350G for 30 minutes. 10 μL of supernatant serum was extracted and subjected to enzyme-linked immunosorbent assay (ELISA) to detect blood antinuclear antibodies (preferably dsDNA antibody, Ro52 antibody, Ro60 antibody, and cardiolipin antibody).

[0104] Step S3. In the end stage of nephritis, spatial omics testing is performed to establish a renal function atlas and quantitatively assess the progression of nephropathy.

[0105] The specific steps for establishing a renal function atlas through spatial omics testing in end-stage renal disease include:

[0106] Four weeks after implantation of kidney cells or sham operation, the mice are sacrificed under anesthesia, and the in situ kidney and ectopic lymph nodes are extracted after heart perfusion, fixed in 4% paraformaldehyde for 8 hours, and prepared into tissue sections (preferably 10-micron-thick frozen sections). Using 10x Visium technology, or STARmap, smFISH spatial omics technology, the technical indicators are spatial resolution higher than 55 μm, and the detection lower limit is 120 genes, wherein the detected genes need to include APOBEC3 enzyme base editing target sequences and APOBEC3 enzyme coding sequences. Taking STARmap spatial omics technology as an example, a key gene library for lupus detection is established (including but not limited to: NOX2, FAS, TCR, IgG, etc.), and additional monitoring target sequences are added: APOBEC3 base editing enzyme CD68 cell conditional knockout mouse internal reference gene (Apobec3 conditional knockout site: 5’CTGAAGGAACCACTGACCAAGGG 3’), lupus mouse internal reference gene (Ncf1 mutation identification site: 5’CCGCGGACC-(WT-A / mut-C)-GGTGAACC 3’), base editing target sequence (5’ATACGCGATACAATTTGATCAGTATA 3’). Synthesize STARmap-DNA primers, design and order coding probes, dissolve in double distilled water as mixed coding probes. Add 50 microliters of 5 nanomoles per liter concentration of mixed coding probes to the surface of each group of ectopic and in situ kidney tissue sections, and incubate at 40 degrees in a humidified box for 36 hours. After incubation, wash with PBS, add 50 microliters of 5 units per microliter concentration of T4 ligase, incubate at room temperature for 2 hours, wash with PBS, add 50 microliters of 0.2 units per microliter Phi29 DNA amplification enzyme, incubate at 30 degrees Celsius for 2 hours, wash with PBS, and perform multiple rounds of fluorescence imaging. When detecting 120 genes, 5 rounds of imaging are preferred, and each round of operation is as follows: use 2 milliliters of phosphate buffer to rinse the unbound coding probes, add 20 microliters of fluorescence reading probes, incubate at 37 degrees Celsius for 3 hours, use 2 milliliters of phosphate buffer to rinse the unbound fluorescence reading probes, and use a 4-channel confocal laser microscope to image and obtain fluorescence signals (fluorescence channels are preferably: channel 1-Cy5 fluorescence, channel 2-Cy3 fluorescence, channel 3-FITC fluorescence, and channel 4-DAPI fluorescence; the imaging magnification is preferably 63 times oil immersion; the Z-axis step is preferably 0.5 micrometers; and the fluorescence images are taken in a stitching manner, with the image size obtained in each round being preferably more than 900 micrometers x 900 micrometers x 5 micrometers). According to the coding probe design, multiple rounds of elution-fluorescence incubation-imaging are repeatedly performed to obtain multiple rounds of gene expression information. Using python code, the multiple rounds of images are overlapped and aligned, the cell boundaries are segmented and aligned with the fluorescence points of each round of image, and the single-cell gene spatial expression map of the in situ and ectopic kidney tissues is decoded.

[0107] The quantitative evaluation of the progression of kidney development specifically includes:

[0108] As Fig. 3 shown, for the reconstructed A1-A4 group spatial transcriptome, the spatial omics data of multiple samples in each group was reduced batch effect and integrated, the within-group differential genes were removed, the Umap algorithm was used for dimension reduction clustering, and 8 in-situ-ex situ spatial omics maps (A1-A4 in-situ kidney map, A1-A4 ex-situ kidney map) were obtained. The differences and correlation genes of in-situ kidney map and ex-situ kidney map in each group were calculated, and S1. in-situ ex-situ kidney correlation transcriptome was obtained; the in-situ kidney and ex-situ kidney spatial maps of A1, A2 and A3 groups were integrated and calculated, and S2. base editing difference-correlation gene was obtained; the in-situ kidney and ex-situ kidney spatial maps of A2 and A4 groups were integrated and calculated, and S3. ex-situ kidney occurrence correlation map was obtained. In S1. in-situ ex-situ kidney correlation transcriptome, the kidney function related genes were quantitatively investigated, and it could be observed that the base editing improved the compensatory effect of kidney function of ex-situ kidney. In S2. map, the expression level of base editing sequence and the coding gene of key molecules (NOX2, FAS, TCR, IgG, etc.) for detecting lupus were quantitatively investigated, and the regulation and correlation of base editing on autoimmune related genes were monitored. In S3. map, the in-situ kidney function related genes and the autoimmune related genes were quantitatively investigated, and the relief level of ex-situ kidney occurrence on autoimmune nephritis was quantitatively monitored.

[0109] The above specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application. It should be understood that the above description is only for specific embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A method of base editing ectopic kidneys, comprising, Comprising the following steps: Extract and screen cytosine deaminase conditional knockout engineered cells of base editing conditional knockout young mice; Implant the cytosine deaminase conditional knockout engineered cells into a spontaneous immune disease mouse model characterized by nephritis, establish an autoimmune-nephrogenesis model as the ectopic kidney of base editing; The base editing conditionally knocks out the young mouse is B6.CD68 Cre / Cre .Apobec3 flp / flp mouse, by CD68 + macrophage-Apobec3 gene conditionally knocked out; And / or, the cytosine deaminase conditional knockout in the CD68 macrophages of the base editing conditional knockout young mice, and the normal expression of cytosine deaminase in other cells; The extraction and screening of cytosine deaminase conditional knockout engineered cells of base editing conditional knockout young mice comprises: Take out the APOBEC3 base editing enzyme CD68 cell conditional knockout mouse, dissect the young mouse kidney cells, and use them as the cytosine deaminase conditional knockout engineered cells; The implantation of the cytosine deaminase conditional knockout engineered cells into a spontaneous immune disease mouse model characterized by nephritis to establish an autoimmune-nephrogenesis model comprises: Select a spontaneous immune disease mouse model with nephritis phenotype; Inject the extracted cytosine deaminase conditional knockout engineered cells into the abdominal lymph nodes of the spontaneous immune disease mouse model with nephritis phenotype by needle puncture; The kidney inflammation phenotype spontaneous immune disease mouse model is B6.Lyz2 luci / luci .Ncf1 * / * .Fas lpr / lpr mouse; The spontaneous immune disease mouse model with nephritis phenotype is genetically edited on the C57BL / 6 mouse genetic background, has conditional fluorescent tracing labeling of macrophages, Ncf1 gene mononucleotide mutation, and Fas gene sequence insertion of retrotransposon element Alu, and can spontaneously obtain a lupus phenotype, which gradually develops into lupus nephritis at 4 to 8 weeks.

2. A method for spatial omics imaging monitoring of an autoimmune-nephrogenesis model prepared by the method of claim 1, characterized in that, Comprising the following steps: In vivo monitoring of disease progression, nephrogenesis progression, and kidney function level of the autoimmune-nephrogenesis model; At the end of nephritis, perform spatial omics detection on the autoimmune-nephrogenesis model to establish a kidney function map and quantitatively evaluate nephrogenesis progression.

3. The monitoring method according to claim 2, characterized in that, The in vivo monitoring of disease progression, nephrogenesis progression, and kidney function level of the autoimmune-nephrogenesis model comprises: Perform spontaneous fluorescent live imaging on the autoimmune-nephrogenesis model once a week to detect inflammation progression of the body surface organs; Perform urine protein detection on the autoimmune-nephrogenesis model once every 3 days; Perform anti-nuclear antibody detection on the autoimmune-nephrogenesis model once every 7 days to obtain kidney function indicators and blood anti-nuclear antibody indicators.

4. The monitoring method of claim 2, wherein, The spatial omics detection on the autoimmune-nephrogenesis model at the end of nephritis comprises: At the end of nephritis, perform heart perfusion on the autoimmune-nephrogenesis model to obtain in situ kidney, abdominal lymph node, or ectopic kidney tissue, and prepare tissue sections; Use spatial omics imaging technology to extract the spatial transcription expression level of the in situ kidney function-related genes of the autoimmune-nephrogenesis model through multiple rounds of imaging, image registration, and single-cell segmentation; Detect the in situ kidney function-related genes of the autoimmune-nephrogenesis model; The in situ kidney function-related genes comprise APOBEC3 base editing enzyme CD68 cell conditional knockout mouse specific sequences, lupus mouse cell specific sequences, and cytosine deaminase base editing target sequences, and identify the cell typing of the donor mouse cells transplanted in the recipient tissue.

5. The monitoring method of claim 2, wherein, The kidney function atlas comprises a Umap dimensionality reduction clustering, and a spatial correlation atlas, wherein the spatial correlation atlas comprises: An in-situ-ex situ kidney correlation transcription atlas, which is obtained by comparing the coincidence of the in-situ kidney spatial omics atlas and the ex-situ kidney spatial omics atlas of the autoimmune-kidney generation model, and is used to display the spatial omics functional similarity and the spatial similarity of immune function key molecule coding genes between the ex-situ kidney and the in-situ kidney in the autoimmune-kidney generation model and to monitor the ex-situ kidney function and the immune environment; A base editing correlation atlas, which is obtained by comparing the coincidence and the differential genes of the in-situ and ex-situ kidney atlas of the autoimmune-kidney generation model, and is used to display the effect of in-vivo base editing on the ex-situ kidney generation; An ex-situ kidney generation correlation atlas, which is obtained by comparing the coincidence and the differential genes of the ex-situ kidney spatial omics atlas of the autoimmune-kidney generation model, and is used to display the compensatory effect of the ex-situ kidney generation on lupus nephritis and the effect of immune function key molecule coding genes.

6. The monitoring method of claim 5, wherein, The quantitative evaluation of the kidney generation progress comprises: By the in-situ-ex situ kidney correlation transcription atlas, the base editing correlation atlas and the ex-situ kidney generation correlation atlas, the coincidence and the differential genes of the ex-situ kidney atlas and the in-situ kidney atlas are compared, the generation level and the functional degree of the ex-situ kidney function are quantitatively evaluated, and the compensatory effect of the ex-situ kidney is quantitatively evaluated.

Citation Information

Patent Citations

  • Method for conditional knockout of Lox13 gene of mouse and application

    CN104651400A

  • CRBN gene humanized animal model, construction system, construction method and application

    CN117426353A