ZmEIL9 gene and protein and their application in regulating maize kernel development

Abstract

This invention provides a ZmEIL9 gene. A CRISPR / Cas9 vector pBUE411-ZmEIL9-gRNA for the ZmEIL9 gene is constructed, and this vector is introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium EHA105 / pBUE411-ZmEIL9-gRNA. Introducing this recombinant Agrobacterium EHA105 / pBUE411-ZmEIL9-gRNA into the wild-type maize inbred line B104 yields maize seeds with significantly reduced kernel length and 100-kernel weight. Overexpression of the ZmEIL9 gene in the wild-type maize inbred line B104 can significantly increase the 100-kernel weight, kernel length, kernel width, and kernel thickness of maize seeds, which is of great significance for breeding high-yielding maize varieties.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to the ZmEIL9 gene and protein and their application in regulating maize kernel development. Background Technology

[0002] Maize (Zea mays L.) belongs to the genus Zea in the family Poaceae. Increased maize yield is the result of the coordinated development of three major yield components: the number of ears per unit area, the number of kernels per ear, and the kernel weight. Under certain planting density conditions, maize kernel yield depends on the number of kernels per plant and kernel weight. With the completion of maize genome sequencing and the gradual maturation of transformation technologies, excellent resources and technical support have been provided for the discovery, cloning, and functional analysis of maize functional genes. Given the crucial role of kernel weight in maize yield formation, identifying key genes affecting kernel formation and studying their influence on kernel development is of great significance for achieving efficient improvement of kernel weight through a combination of conventional and molecular selection methods, thereby increasing maize yield.

[0003] Ethylene is a simple gaseous hormone with biological activity. Plants can regulate the physiological processes of ethylene in plants through the biosynthesis and signal transduction pathways of ethylene, coordinate the interaction of the ethylene signaling pathway with other signaling pathways, and complete various physiological activities and responses, such as fruit maturation, organ senescence, flowering, seed dormancy, seed germination, root hair development, and responses to biotic and abiotic stresses (Zhang et al., 2012; Zhao et al., 2021).

[0004] Current research on ethylene biosynthesis and signal transduction pathways mainly focuses on dicotyledonous plants such as Arabidopsis thaliana. Research on the function of genes related to the ethylene signaling pathway in maize lags behind that in Arabidopsis thaliana and rice, resulting in a very limited understanding of ethylene biosynthesis and signal transduction pathways in maize. EIN3 (Ethylene-insensitive3) / EIL (Ethylene-insensitive like) encodes a small family of transcription factors in the genomes of higher plants. It is the first positive regulator in the ethylene signal transduction pathway, directly binding to primary ethylene response elements to regulate the expression of related genes. Members of the EIN3 / EIL transcription factor family mainly participate in regulating plant responses to ethylene, including influencing the "triple response" in seedlings and plant growth and development, and playing an important role as a crossover point between ethylene and other signals (Mou et al., 2014; Zhang et al., 2012; Zhao et al., 2021). Therefore, clarifying the biological functions of the EIN3 / EIL gene in maize growth and development and elucidating its molecular regulatory mechanism can provide a theoretical basis for the genetic improvement of maize grain yield, quality, and stress resistance. Summary of the Invention

[0005] The problem that this invention aims to solve is that there are no EILs genes in the prior art that simultaneously affect the plant's response to ethylene, including both kernel length and 100-kernel weight.

[0006] To address this technical problem, this invention provides a ZmEIL9 gene and protein and its application in regulating maize kernel development.

[0007] The present invention provides a ZmEIL9 gene that regulates the development of maize kernels, and the nucleotide sequence of the ZmEIL9 gene is SEQ ID No. 1.

[0008] A nucleic acid molecule containing the ZmEIL9 gene.

[0009] A recombinant vector containing the ZmEIL9 gene.

[0010] The recombinant vector is the CRISPR / Cas9 vector pBUE411-ZmEIL9-gRNA. The CRISPR / Cas9 vector is a recombinant vector obtained by inserting the selected target 1 sequence and target 2 sequence from the ZmEIL9 gene into the BsaI site of the pBUE411 vector. The CRISPR / Cas9 vector expresses target 1 and target 2 on the ZmEIL9 gene.

[0011] The target 1 sequence is as shown in SEQ ID No. 3; the target 2 sequence is as shown in SEQ ID No. 4.

[0012] The amino acid sequence of the ZmEIL9 protein it encodes is SEQ ID No. 2.

[0013] A fusion protein, wherein the fusion protein is obtained by attaching a tag to the N-terminus and / or C-terminus of the ZmEIL9 protein of claim 3.

[0014] A recombinant bacterium, wherein the recombinant bacterium is a recombinant Agrobacterium containing the CRISPER / Cas9 vector of claim 4.

[0015] A method for obtaining maize seeds with reduced kernel weight and / or reduced kernel length and / or reduced yield, the method comprising:

[0016] (1) Extraction of ZmEIL9 gene: Using inbred line N04 cDNA as template, cloning primers EIL9F / EIL9R were designed. Cloning, purification, ligation of 007T vector, transformation, bacterial detection and sequencing were performed using landing PCR to finally obtain the gene ZmEIL9.

[0017] (2) Constructing a CRISPER / Cas9 vector for the maize ZmEIL9 gene: Insert the target 1 sequence and target 2 sequence of the screened ZmEIL9 gene into the BsaI site of the pBUE411 vector to obtain a recombinant vector, named pBUE411-ZmEIL9-gRNA.

[0018] (3) The pBUE411-ZmEIL9-gRNA vector was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium EHA105 / pBUE411-ZmEIL9-gRNA;

[0019] (4) Recombinant Agrobacterium EHA105 / pBUE411-ZmEIL9-gRNA was introduced into wild-type maize inbred line B104 maize by infecting wild-type maize embryo callus tissue;

[0020] (5) Plant the maize with the ZmEIL9 gene obtained in step (4), screen transgenic positive plants that differ from the wild-type B104 sequence, select single plants with mutations that are non-synonymous mutations and are homozygous events for genetic transformation and offspring identification, and screen to obtain positive maize plants that can be stably inherited.

[0021] (6) Plant the positive maize plants obtained in step (5) to obtain maize seeds with reduced grain weight and / or reduced grain length and / or reduced yield.

[0022] A method for obtaining maize seeds with increased kernel weight and / or increased kernel length and / or increased yield, the method comprising:

[0023] (1) Extraction of ZmEIL9 gene: Using maize inbred line N04 cDNA as template, cloning primers EIL9F / EIL9R were designed. Cloning, purification and ligation of 007T vector were carried out by landing PCR. The gene ZmEIL9 was finally obtained through transformation, bacterial detection and sequencing.

[0024] (2) Constructing an overexpression vector for the ZmEIL9 gene: The target fragment amplified by homologous recombination primers was inserted between the SgsI and XbaI sites of the pEGC5941 vector to obtain the recombinant vector, named pEGC5941-ZmEIL9.

[0025] (3) The pEGC5941-ZmEIL9 vector was introduced into Agrobacterium EHA105 to obtain Agrobacterium EHA105 / pEGC5941-ZmEIL9 containing the target gene;

[0026] (4) Infect the young embryos of wild-type maize inbred line B104 with Agrobacterium EHA105 / pEGC5941-ZmEIL9 and introduce it into wild-type maize inbred line B104;

[0027] (5) Genomic DNA and RNA were extracted from the ZmEIL9 overexpressing transgenic plants obtained in step (4), and the transformed plants were identified by PCR. Individual plants with significantly increased ZmEIL9 gene expression levels compared to wild type were screened to obtain stable ZmEIL9 overexpressing transgenic positive plants.

[0028] (6) Plant the ZmEIL9 overexpressing transgenic positive plants obtained in step (5) to obtain maize seeds with increased grain weight and / or longer grain length and / or increased yield.

[0029] The technical advantage of this invention compared to existing technologies is that by constructing the CRISPR / Cas9 vector pBUE411-ZmEIL9-gRNA of the ZmEIL9 gene, and introducing the pBUE411-ZmEIL9-gRNA vector into Agrobacterium EHA105, recombinant Agrobacterium EHA105 / pBUE411-ZmEIL9-gRNA can be obtained. Introducing the recombinant Agrobacterium EHA105 / pBUE411-ZmEIL9-gRNA into the wild-type maize inbred line B104 can yield maize seeds with significantly reduced kernel length and 100-kernel weight. Overexpression of the ZmEIL9 gene in the wild-type maize inbred line B104 can significantly increase the 100-kernel weight, kernel length, kernel width, and kernel thickness of maize seeds, which is of great significance for breeding high-yielding maize varieties. Attached Figure Description

[0030] Figure 1 Electrophoretic gel images for detecting mutation types and events after gene knockout: A is the sequencing result of PCR product of edited mutant ZmEIL9-cir1; B is the sequencing result of PCR product of edited mutant ZmEIL9-cri2; C is the agarose gel electrophoresis result of edited mutant ZmEIL9-cir1.

[0031] Figure 2 Phenotypic identification of T2 generation maize kernels transgenic with ZmEIL9-gRNA: A represents wild-type and mutant seed phenotypes; B represents kernel length; and C represents 100-kernel weight.

[0032] Figure 3 Phenotypic identification of T3 generation maize kernels transgenic with ZmEIL9-gRNA: A represents wild-type and mutant seed phenotypes; B represents kernel length; and C represents 100-kernel weight.

[0033] Figure 4 This is a schematic diagram of the evolutionary relationships of the EIN3 family of maize genes.

[0034] Figure 5 This is a schematic diagram of the sequence alignment results. Detailed Implementation

[0035] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0036] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0037] Wild-type maize inbred line B104 was derived from the US National Plant Germplasm System.

[0038] (https: / / npgsweb.ars-grin.gov / gringlobal / search).

[0039] I. Obtaining the ZmEIL9 gene

[0040] The nucleotide sequence of the ZmEIL9 gene involved in this embodiment is SEQ ID No. 1, and the amino acid sequence of the protein ZmEIL9 encoded by it is SEQ ID No. 2.

[0041] Methods for obtaining the ZmEIL9 gene:

[0042] A BLASTP search using the amino acid sequence of chromosome 1 of the EIN3 family in maize (GenBank accession number NP001152035) from NCBI revealed that it is most closely related to the EIN3 gene on chromosome 9 of the same family in maize. Figure 4 A preliminary shared sequence of NP_001146219 on chromosome 9 was identified in maize. Based on the nucleotide sequence of NP_001146219, primers (EIL9-F and EIL9-R) covering the open reading frame (ORF) were designed. PCR amplification was performed using the cDNA sequence of maize inbred line N04 as a template. The obtained PCR product was purified, ligated into a T vector, transformed into DH5α E. coli, and single clones were selected for bacterial culture testing. Three positive clones were sent to a biotechnology company for sequencing. Sequence alignment results showed that two positive clones had completely identical sequences, with 12 base mutations and one small deletion in the gene sequence of B73. Figure 5 ), and obtained the gene ZmEIL9.

[0043] EIL9-F: GTCAGTCTGCCCGTGACT

[0044] EIL9-R:GCTACTGCAGAAAACCTATACGAC

[0045] II. Construction of the CRISPER / Cas9 system carrier for maize

[0046] 1. Design of ZmEIL9 gene gRNA

[0047] First, log in to the website http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html to screen for targets. The targets have enzyme cleavage sites and Cas9 cleavage sites (NGG). The sequence of target 1 is shown in SEQ ID No. 3 (AGGGAACTGCAGCAGACCCGCGG) and the sequence of target 2 is shown in SEQ ID No. 4 (TCATGAGGCTTCTTGTACGGGGG).

[0048] The above sequence was submitted to the website (http: / / www.rgenome.net / cas-offinder / ) for preliminary testing. The results showed that this gRNA can be used as a CRISPR / Cas9 system vector for the ZmEIL9 gene.

[0049] 2. gRNA sequence amplification and recombinant vector construction

[0050] 1) Design primers containing adapters based on gRNA sequences.

[0051] MT1-F0:TTCATGAGGCTTCTTGTACGGGGGGTTTTAGAGCTAGAAATAGC;

[0052] MT2-R0: AACTCATGAGGCTTCTTGTACGGGGGGCTTCTTGGTGCC;

[0053] MT1-BsF: ATATATGGTCTCTGGCAGGGAACTGCAGCAGACCCGCGGGTT;

[0054] MT2-BsR: ATTATTGGTCTCTAAACTCATGAGGCTTCTTTGTACGGGGG;

[0055] 2) PCR amplification system:

[0056]

[0057] Note: Use pCBC-MT1T2 diluted 100 times as a template for PCR amplification with the above four primers. MT1-BsF / MT2-BsR are the normal primer concentrations; MT1-F0 / MT2-R0 are diluted 20 times.

[0058] The PCR reaction system is as follows:

[0059]

[0060] 3) Purify and recover the PCR product, and establish the following enzyme digestion-ligation system:

[0061]

[0062] Reaction procedure: The established enzyme digestion and ligation system was placed in a PCR instrument and kept at a constant temperature of 37 °C for 5 h; 50 °C for 5 min; and 80 °C for 10 min to inactivate the enzyme. After cooling to room temperature, the vector ligation was completed.

[0063] The recombinant vector was obtained by inserting the PCR purified product from step 2) above into the BsaI site of the pBUE411 vector, and named pBUE411-ZmEIL9-gRNA. This vector is a CRISPER / Cas9 vector. This vector expresses two gRNAs targeting the ZmEIL9 gene: gRNA1 (target site 1) and gRNA2 (target site 2).

[0064] III. Transgenic maize obtained by transforming maize B104 with CRISPER / Cas9 system vector.

[0065] 1. Recombinant plasmid transformation of Agrobacterium

[0066] The CRISPER / Cas9 vector pBUE411-ZmEIL9-gRNA prepared in step one above was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium EHA105 / pBUE411-ZmEIL9-gRNA.

[0067] 2. Obtaining genetically modified corn

[0068] 1) Agrobacterium infection of maize inbred line B104

[0069] The above-mentioned Agrobacterium EHA105 / pBUE411-ZmEIL9-gRNA was transferred into wild-type maize inbred line B104 maize using the Agrobacterium inoculation method to obtain T0 generation transgenic maize.

[0070] The experiment also included an empty plasmid EHA105 / pBUE411 as a control.

[0071] 2) PCR detection of ZmEIL9-gRNA-transformed maize seedlings that were positive

[0072] Based on the gene location of the gRNA, primers were designed approximately 150 bp upstream and downstream of it. The primer sequences are as follows:

[0073] EIL9-F:AGGACGACAGCGACGATGA

[0074] EIL9-R:TCTTGTCCTGGAGGCACTTG

[0075] DNA was extracted from T0 generation ZmEIL9-gRNA maize leaves and wild-type control inbred line B104 using the CTAB method as templates. PCR amplification was performed using primers EIL9-F / EIL9-R to obtain PCR products of approximately 700 bp.

[0076] PCR products from T0 generation ZmEIL9-gRNA transgenic maize and wild-type maize B104 were sequenced by agarose gel electrophoresis and sequencing. Target regions of transgenic and wild-type maize were obtained through PCR amplification. The amplified fragments were detected by agarose gel electrophoresis and sequencing, and then compared with the wild-type maize B104 sequence. Plants with sequences differing from the wild-type B104 sequence were defined as transgenic positive plants.

[0077] The results showed that a total of 10 mutation types were obtained. Individual plants (cri1 and cri2) with non-synonymous mutations and homozygous events were selected as subjects for subsequent experimental research.

[0078] Mutation event 1 (cri1) was detected by gel electrophoresis. Figure 1 C) and sequencing detection ( Figure 1 A) A large base deletion was found between the two target sites. The PCR product of mutation event 2 (cri2) was sequenced, and the sequencing results were compared with the wild-type gene sequence. It was found that target site 1 had a one-base insertion, and target site 2 had two-base deletions. Figure 1 B) Both cases resulted in premature termination of translation due to frameshift mutations.

[0079] 3) Genetic transformation and progeny identification of the ZmEIL9 gene in maize

[0080] The kernels harvested from the maize plants corresponding to the positive events selected in the T0 generation were planted in rows to form the T1 generation transgenic material. PCR amplification was then performed using the specific primers EIL9-F / EIL9-R.

[0081] The PCR products were sequenced, and the sequencing results showed that the ZmEIL9 gene sequence of each T1 generation transgenic ZmEIL9-gRNA maize was mutated. The mutation modes of events 1 (cri1) and 2 (cri2) were the same as those of the T0 generation ZmEIL9-gRNA maize plants, indicating that both events can be stably inherited.

[0082] PCR amplification was performed on T1 generation ZmEIL9-gRNA-transgenic maize plants with mutations using Bar primers 208bar-F and 208bar-R. The PCR products were then analyzed by gel electrophoresis. If no band of approximately 500 bp was observed, it indicated that the plant did not contain the CRISPER gene knockout expression vector and could undergo stable inheritance; therefore, the plant was a positive T1 generation ZmEIL9-gRNA-transgenic maize plant.

[0083] 208bar-F:CCATCGTCAACCACTACATCGAGACA;

[0084] 208bar-R:CTTCAGCAGGTGGGTGTAGAGCGT;

[0085] Positive T1 generation maize plants transgenic with ZmEIL9-gRNA were self-crossed, and the harvested kernels were used to grow T2 generation transgenic plants.

[0086] DNA molecular detection of T2 generation plants was performed using primers EIL9-F / EIL9-R. After sequencing, it was found that the plants did not contain the Bar gene, and the sequence mutation mode was the same as that of the T0 generation, indicating that these transgenic plants were homozygous.

[0087] Seeds harvested from the two positive events detected in the T2 generation were transferred to the T3 generation of corn for greenhouse cultivation. The T3 generation plants were tested using the above-mentioned testing method, and positive T3 generation seedlings were obtained.

[0088] IV. Phenotypic Identification of ZmEIL9-gRNA in Transgenic Maize

[0089] T2 generation ZmEIL9-gRNA transgenic maize and T3 generation ZmEIL9-gRNA transgenic maize were planted in greenhouses, with wild control materials planted as a comparison, and normal field management was carried out.

[0090] Single-plant ear self-pollination was carried out by bagging individual ears. The ears were harvested and dried. After they were completely dry, the kernels that were closely arranged and of uniform growth in the middle of the ears were manually removed. The kernel length, width, thickness, and weight of 100 kernels were examined. More than 15 sets of data were measured for each event.

[0091] 1. Phenotypic analysis of T2 generation maize kernels transgenic with ZmEIL9-gRNA

[0092] The results are as follows Figure 2 As shown in Table 1, the grain length of the two T2 generation transgenic positive lines (cri1 and cri2) was reduced by 5.5% and 9.4% respectively compared with the wild type B104, and the 100-grain weight was reduced by 13.79% and 15.67% respectively compared with the wild type B104. There were no significant differences in grain width and grain thickness compared with the wild type.

[0093] Table 1. Results of kernel length and 100-kernel weight determination in maize transgenic ZmEIL9-gRNA from generation T2.

[0094]

[0095] 2. Phenotypic analysis of T3 generation maize kernels transfected with ZmEIL9-gRNA

[0096] The results are as follows Figure 3 As shown in Table 2, the grain length of the two T3 generation transgenic positive lines (cri1 and cri2) was reduced by 9.0% and 6.4% respectively compared with the wild type B104, and the 100-grain weight was reduced by 15.85% and 15.34% respectively compared with the wild type B104. There were no significant differences in grain width and grain thickness compared with the wild type.

[0097] Table 2 Results of T3-transformed ZmEIL9-gRNA maize kernel length and 100-kernel weight determination

[0098]

[0099] V. Construction of ZmEIL9 overexpression vector

[0100] 1. Using CE Design V1.04 software, select SgsI / XbaI to design seamless cloning primers as follows:

[0101] EIL1-1-P5941F: TTACCATGGGGGCGCCATGATGGGAGGCGGGC

[0102] EIL1-1-P5941R: TAATTAACTCTCTAGATCAGTAGAACCAATTGGTCCCGT

[0103] 2. pFGC5941 was digested and purified by enzyme digestion.

[0104] The 35S::eGFP empty vector plasmid was digested with restriction enzymes SgsI and XbaI, as shown in the following system:

[0105]

[0106] Add the above components to the PCR tube in the specified amounts, mix well, and then place in a PCR instrument at 37°C for 3-5 hours. After the reaction, perform agarose gel electrophoresis detection and recovery.

[0107] 3. Using ZmEIL9-T plasmid as a template, the target sequence was amplified and recovered using primers EIL9-P5941F and EIL9-P5941R.

[0108] 4. Construction and transformation of recombinant carriers

[0109] The purified products of the target gene and vector were ligated and transformed using a homologous recombinase, as shown in the following system:

[0110] Components Dosage plasmid was recovered after pFGC5941 enzyme digestion. 4 μl Fragments with homologous arms 1 μl 2×Hieff Clone®Enzyme Premix 5 μl

[0111] After the system is prepared, gently mix it by pipetting, centrifuge briefly, place the centrifuge tube in a metal bath at 50°C for 20 min, and then place the centrifuge tube on ice to cool for 10 min to transform Escherichia coli DH5α.

[0112] (1) Take Escherichia coli competent cells DH5α stored in a -80℃ freezer and place them on ice for about 10 min. When the ice and water mixture is in a mixed state, add 10 μL of ligation product, gently tap to mix, and place on ice for 30 min.

[0113] (2) Heat shock in a 42℃ water bath for 60 s, then quickly ice bath for 2 min;

[0114] (3) In a clean bench, add 900 μL of antibiotic-free LB liquid culture medium to a 2 ml centrifuge tube and shake for 55 min at 37℃ and 220 rpm.

[0115] (4) Centrifuge at 5000 rpm for 1 min, take 900 μL of supernatant, and use a pipette to mix the remaining bacterial precipitate with the culture medium thoroughly, and prepare for plating;

[0116] (5) Take 40 μL of bacterial culture and shake it with glass beads on a solid medium containing kana (100 μg / ml) to spread the bacterial culture evenly on the plate. Place the plate at room temperature until the liquid is absorbed, and then incubate overnight at 37°C.

[0117] (6) Pick a single colony and add it to LB liquid medium containing kana (final kana concentration is 0.1 mg / mL), shake at 37°C until the bacterial solution becomes turbid, and then perform bacterial solution testing;

[0118] (7) Send the positive clone to the biotechnology company for sequencing and compare it with the target sequence to obtain the correctly linked recombinant plasmid pFGC5941-ZmEIL9.

[0119] The recombinant vector was obtained by inserting the PCR purification product from step 3) above between the SgsI and XbaI sites of the pFGC5941 vector, and named pFGC5941-ZmEIL9. This vector is the overexpression vector.

[0120] VI. Transgenic plants were obtained by transforming the pFGC5941-ZmEIL9 vector into the maize inbred line B104.

[0121] 1. Recombinant plasmid transformation of Agrobacterium

[0122] The overexpression vector pFGC5941-ZmEIL9 prepared in step five above was introduced into Agrobacterium EHA105 to obtain Agrobacterium EHA105 / pFGC5941-ZmEIL9.

[0123] 2. Obtaining genetically modified corn

[0124] 1) Agrobacterium infection of maize inbred line B104 embryos

[0125] The recombinant Agrobacterium EHA105 / pFGC5941-ZmEIL9 was transformed into wild-type maize inbred line B104 by Agrobacterium infection of the immature embryo, resulting in T0 generation transgenic maize.

[0126] The experiment also included an empty vector of plasmid EHA105 / pFGC5941 as a control.

[0127] 2) PCR detection of positive transgenic maize seedlings overexpressing pFGC5941-ZmEIL9

[0128] Based on the location of the target gene on the overexpression vector, one primer segment was designed for the target fragment, and the other segment was designed for the vector, with an amplification length of approximately 700 bp. The primer sequences are as follows:

[0129] EIL9-OEF: ACGAGGAGCATCGTGGAAA

[0130] EIL9-OER: TGAGCATGTACTTGAGGATGC

[0131] DNA was extracted from T0 generation pFGC5941-ZmEIL9 maize leaves and wild-type control maize inbred line B104 using the CTAB method. PCR amplification was performed using primers EIL9-OEF / EIL9-OER, yielding a PCR product of approximately 700 bp. Wild-type maize inbred line B104 served as a control. Plants showing differences from the wild type were defined as positive.

[0132] 3) Analysis of expression levels in T0 generation overexpression positive materials

[0133] When the T0 generation of transgenic material grows to the 4-leaf stage, samples are taken. Fresh leaf samples are placed in 2ml centrifuge tubes and then quickly frozen in liquid nitrogen. They can be stored in a -80℃ freezer for later use.

[0134] RNA extraction: Total RNA was extracted from the preserved leaf samples using the TRnaZol Reagent kit (Synthetic Biotechnology Co., Ltd.).

[0135] Quantitative primer design: Quantitative primers for ZmEIL9 were designed using the online software qPrimerDB (https: / / qprimerdb.biodb.org / ).

[0136] EIL9-QPCR-F: TAGCAAGTGGGAGATAAACAGG

[0137] EIL9-QPCR-R: ACAAGAACTGGGAAGCATAGAA

[0138] Gene expression quantification was performed using a Bioradchorom 4 real-time quantitative PCR instrument. The CT values ​​of the quantitative data were analyzed, and 2-ΔΔCT (Livak) was used for data processing. Plotting was performed using Prism software. RT-PCR reaction system: Using reverse-transcribed cDNA as a template, 10 μL of Hieff® qPCR SYBR Green Master Mix real-time PCR kit was prepared.

[0139] Green Master Mix, 0.4 μL Primer-F, 0.4 μL Primer-R, 1 μL template cDNA, 8.2 μL ddH2O to bring the total to 20 μL. RT-PCR reaction program: 95 ℃ pre-denaturation for 5 min, 95 ℃ denaturation for 10 s.

[0140] Annealing / extending at 60 ℃ for 30 s, for a total of 40 cycles, during the dissolution curve stage, using the instrument's default settings.

[0141] By analyzing the expression levels of this gene in leaves of overexpressed transgenic materials and wild-type materials, four events were found where the expression level was significantly higher than that of wild-type materials. These events were then planted in greenhouses, with wild-type control materials planted as a comparison.

[0142] Single-plant ear self-pollination was carried out by bagging individual ears. The harvested ears were then dried. After they were completely dry, the tightly packed and uniformly growing kernels in the middle of the ears were manually removed. The kernel length, width, thickness, and weight of 100 kernels were examined. More than 15 sets of data were measured for each event.

[0143] Results analysis: Overexpression significantly increased the 100-kernel weight, kernel length, kernel width, and kernel thickness of maize kernels.

[0144] The ZmEIL9 gene provided by this invention is obtained by constructing a CRISPR / Cas9 vector pBUE411-ZmEIL9-gRNA for the ZmEIL9 gene, and then introducing the pBUE411-ZmEIL9-gRNA vector into Agrobacterium EHA105 to obtain recombinant Agrobacterium EHA105 / pBUE411-ZmEIL9-gRNA. Introducing the recombinant Agrobacterium EHA105 / pBUE411-ZmEIL9-gRNA into the wild-type maize inbred line B104 yields maize seeds that significantly reduce kernel length and 100-kernel weight. Overexpression of the ZmEIL9 gene in the wild-type maize inbred line B104 can significantly increase the 100-kernel weight, kernel length, kernel width, and kernel thickness of maize seeds, which is of great significance for breeding high-yielding maize varieties.

[0145] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several changes and improvements without departing from the overall concept of the present invention, and these should also be considered within the scope of protection of the present invention.

Claims

1. A ZmEIL9 gene that regulates maize kernel development, characterized in that, The nucleotide sequence of the ZmEIL9 gene is SEQ ID No.

1.

2. A nucleic acid molecule comprising the ZmEIL9 gene as described in claim 1.

3. A recombinant vector comprising the ZmEIL9 gene as described in claim 1.

4. A ZmEIL9 protein that regulates maize kernel development, characterized in that, The amino acid sequence of the ZmEIL9 protein is SEQ ID No.

2.

5. A fusion protein, characterized in that, The fusion protein is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of the ZmEIL9 protein according to claim 3.

6. A method for obtaining maize seeds with increased kernel weight and / or increased kernel length and / or increased yield, characterized in that, The method is as follows: (1) Constructing an overexpression vector for the ZmEIL9 gene: The ZmEIL9 gene described in claim 1 is inserted between the SgsI and XbaI sites of the pEGC5941 vector to obtain a recombinant vector, named pEGC5941-ZmEIL9. (2) The pEGC5941-ZmEIL9 vector was introduced into Agrobacterium EHA105 to obtain Agrobacterium EHA105 / pEGC5941-ZmEIL9 containing the target gene; (3) Infect the young embryos of wild-type maize inbred line B104 with Agrobacterium EHA105 / pEGC5941-ZmEIL9 and introduce it into wild-type maize inbred line B104; (4) Genomic DNA and RNA were extracted from the ZmEIL9 overexpressing transgenic plants obtained in step (3). The transformed plants were identified by PCR. Individual plants with significantly increased ZmEIL9 gene expression levels compared to wild type were screened to obtain stable ZmEIL9 overexpressing transgenic positive plants. (5) Plant the ZmEIL9 overexpressing transgenic positive plants obtained in step (4) to obtain maize seeds with increased grain weight and / or increased grain length and / or increased yield.

Images