Prkain gene as a molecular marker related to feed conversion rate of sheep and application thereof

By detecting the polymorphism at position 165 of the PRKAA1 gene in sheep, sheep with high feed conversion rates were screened, solving the problem of low feed conversion rates in sheep and achieving efficient screening and improved economic benefits in sheep breeding.

CN118345179BActive Publication Date: 2026-05-08JINCHUAN GROUP CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410672791.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-05-28
Publication Date
2026-05-08
Estimated Expiration
2044-05-28

AI Technical Summary

Technical Problem

The lack of effective gene-level analysis methods in existing technologies to improve sheep feed conversion rate leads to high sheep feed costs and affects economic benefits.

Method used

By detecting the C/T polymorphism at position 165 of the PRKAA1 gene in sheep, a molecular marker detection method was established using PCR primer pairs and KASPar primer pairs to screen sheep breeds with high feed conversion rates.

Benefits of technology

This method enables the efficient screening of sheep with high feed conversion rates, reduces feed costs, improves the economic benefits of sheep farming, and cultivates feed-saving, high-quality meat sheep.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application provides PRKAA1 The application provides a gene as a molecular marker related to feed conversion rate of sheep and application thereof, wherein the molecular marker is designed according to PRKAA1 A primer is designed according to the gene sequence, DNA is extracted from sheep blood, and through PCR amplification, DNA sequencing and sequence analysis, a C / T polymorphic site is found at the 165th site of the amplified fragment; further, the polymorphic site of 935 Hu sheep is detected by using KASPar primers, a least square model is established, genotype and feed conversion rate are associated, and finally the application of the amplified PRKAA1 The gene fragment can be used as a molecular marker related to feed conversion rate of sheep. The molecular marker of the application can be used for breeding of high-quality meat sheep with less feed, and provides a genetic engineering means for genetic improvement of feed conversion rate of sheep, and has great practical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker preparation, specifically involving the PRKAA1 gene as a molecular marker related to sheep feed conversion rate and its application. Background Technology

[0002] Lamb is one of the main meat products in society today, and improving its economic efficiency has become one of the most important tasks. In sheep production, feed costs account for a large proportion, so improving feed conversion ratio is of significant research importance. This research focuses on indicators designed through genetic improvement to reduce feed input without affecting normal animal growth, as well as feed utilization rates in livestock and poultry. Animal feed utilization rate refers to the efficiency with which it utilizes ingested feed, mainly affected by both feed and animal factors. Feed efficiency (FE) is short for feed conversion ratio (FCR), also known as feed return. Generally, feed conversion ratio refers to the amount of feed consumed to gain 1 kg of body weight, i.e., feed intake / gain (F / G), and has long been an important economic indicator used to measure the level of feed utilization. In addition, the gain / feed intake ratio (G / F) is an indicator that represents the relationship between weight gain and daily feed intake in livestock and poultry (Lancaster PA, Carstens GE, Jr CD, et al. Phenotypic and genetic relations of residual feed intake with performance and ultrasound carcasstraits in Brangus heifers. Journal of Animal Science, 2009, 87(12): 3887-3896). Feed conversion ratio is widely used at home and abroad. In meat production, the feed-to-meat ratio is used, while in poultry egg production, the feed-to-egg ratio is used. To improve feed conversion ratio, we need to focus on two aspects: increasing the weight gain or meat and egg production of livestock and poultry and reducing feed consumption (Aggrey SE, Karnuah AB, Sebastian B, et al. Genetic properties of feed efficiency parameters in meat-type chickens. Genetics Selection Evolution, 2010, 42(1):1-5. Aggrey SE, Rekaya R. Dissection of Koch's residual feed intake: implications for selection. Poultry Science, 2013, 92(92):2600-2605).Studies have shown that the heritability of feed conversion ratio is 0.26-0.41, which is a moderately heritable trait. It is genetically controlled and can be improved through selection (Willems OW, Miller SP, Wood B J. Assessment of residual body weight gain and residual intake and body weight gain as feed efficiency traits in the turkey (Meleagrisgallopavo). Genetics Selection Evolution, 2013, 45(1):1-8). Based on scientific data, selective breeding and genetic improvement of sheep flocks (Mo Futao. Study on production performance, body composition and digestive metabolism of fattening lambs with different RFI. Gansu Agricultural University, 2016) is one of the feasible methods. How to determine the scientific basis is one of the main problems to be solved. At present, most indicators are analyzed based on animal phenotypes, and there are few systematic analyses of sheep feed conversion ratio at the genetic level.

[0003] PRKAA1 (AMP-Activated Catalytic Subunit Alpha 1) is the catalytic subunit of AMP-activated protein kinase (AMPK), which plays a key role in regulating cellular energy metabolism through phosphorylation (Krishan, S., DR Richardson, and S. Sahni, AMP kinase ( <em> PRKAA1 < / em> (Journal of Clinical Pathology, 2014. 67(9): p.758-763.). Multiple studies have shown that... PRKAA1 High expression of this gene in certain gastric cancer cells promotes cancer cell proliferation and inhibits apoptosis (Zhang, Y., et al.). PRKAA1 PromotesProliferation and Inhibits Apoptosis of Gastric Cancer CellsThroughActivating JNK1 and Akt Pathways. Oncology Research FeaturingPreclinical and Clinical Cancer Therapeutics, 2020. 28(3): p.213-223.); PRKAA1 Preclinical data show that PRKAA1It plays a major role in the immunosuppressive activity induced by tumor myeloid suppressor cells (MDSCs), overcoming MDSC-driven tumor T cell dysfunction and further improving the effectiveness of immunotherapy (Jimena Trillo-Tinoco, Rosa A. Sierra, Eslam Mohamed, Yu Cao, Álvaro de Mingo-Pulido, Danielle L. Gilvary, Carmen M. Anadon, Tara Lee Costich, Sheng Wei, Elsa R. Flores, Brian Ruffell, José R. Conejo-Garcia, Paulo C. Rodriguez; AMPK Alpha-1 Intrinsically Regulates the Function and Differentiation of Tumor Myeloid-Derived Suppressor Cells. Cancer Res 1 October 2019; 79 (19): 5034–5047.). Clinically, it has been reported that... PRKAA1 Dynamic changes were observed during immunotherapy for colorectal cancer (Lee, SJ, Kang, BW, Chae, YS et al. Genetic Variations in STK11, PRKAA1 , and TSC1 Associated withPrognosis for Patients with Colorectal Cancer. Ann Surg Oncol 21 (Suppl 4), 634–639 (2014). https: / / doi.org / 10.1245 / s10434-014-3729-z). PRKAA1 Genetic research has focused more on tumors and cancer, with relatively little research on feed efficiency traits. Sheep feed conversion ratio is influenced by numerous minor genes. This invention addresses this issue by... PRKAA1 The genes were sequenced and analyzed to explore the correlation between different genotypes and sheep feed conversion rate, aiming to provide a reference for the selection and breeding of superior sheep breeds and to provide genetic engineering means for the breeding of excellent sheep breeds, so as to accelerate the breeding process. Summary of the Invention

[0004] The purpose of this invention is to provide the PRKAA1 gene as a molecular marker related to sheep feed conversion ratio and its application. This molecular marker is amplified from the sheep PRKAA1 gene, and its specific nucleotide sequence is shown in SEQ ID NO.1. By amplifying the DNA sequence of the sheep PRKAA1 gene and sequencing it, polymorphic sites in the PRKAA1 gene can be screened, thereby establishing a method for detecting molecular markers related to sheep feed conversion ratio. This molecular marker can also be applied to the breeding of new feed-saving, high-quality meat sheep breeds.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] PRKAA1 The gene serves as a molecular marker related to sheep feed conversion rate. Its nucleotide sequence is shown in SEQ ID NO.1, namely: CCGAGAAGCAGAAACACGACGGGCGGGTGAAGATCGGTCACTACATCCTAGGGGATACGCTGGGGGTCGGGACCTTCGGCAAAGTGAAGGGTGAGGACCCCCGGGCAAGGCTCGGCCCCCCGCCCAGGATCCAGGAGATTTCCGCCTTTCGCACCTCTTCATCYTCCCCCGCCCCTTGCGTTCCTGGTCTCCCGGGCTCCGCAGCCCCTGTCCTGCTCTGGCGCGAGCAGAACCCGAGGCCG The Y at position 165 represents C or T. Because the above sequence has a C / T mutation at position 165, it results in a C / T polymorphism in the sheep PRKAA1 gene at this site.

[0007] Secondly, the present invention provides a PCR primer pair for detecting the above-mentioned molecular marker, comprising a forward primer and a reverse primer, wherein the sequence of the forward primer is shown in SEQ ID NO.2 and the sequence of the reverse primer is shown in SEQ ID NO.3.

[0008] A KASPar primer pair for detecting the aforementioned molecular markers includes forward primers A1 and A2 and a universal reverse primer C. The nucleotide sequence of the forward primer A1 for detecting AlleleA is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer A2 for detecting AlleleG is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer C is shown in SEQ ID NO.6. The nucleotide sequences of the primer pair for detecting the molecular markers are as follows:

[0009] Forward primer MF (SEQ ID NO.2): 5'-CCGAGAAGCAGAAACACGAC-3';

[0010] Reverse primer MR (SEQ ID NO.3): 5'-TCCAGCAAAGGGAGCACTCA - 3'.

[0011] Thirdly, the present invention provides a kit for detecting the above-mentioned molecular markers, the kit comprising PCR primer pairs or KASPar primer pairs for detecting the above-mentioned molecular markers.

[0012] Fourthly, the present invention provides a method for detecting the above-mentioned molecular markers, the specific detection method comprising the following steps:

[0013] a) Amplify sheep genomic DNA using PCR primer pairs shown in SEQ ID NO.2 and SEQ ID NO.3;

[0014] b) Identify the polymorphic sites in the amplification products obtained in step a).

[0015] Furthermore, the identification of polymorphic sites employed direct sequencing, fluorescent probe methods, gene chip methods, and high-resolution melting curve methods.

[0016] More specifically, the method for detecting molecular markers related to sheep feed conversion ratio using the above primer pairs in this invention includes the following steps:

[0017] A. Genomic DNA was extracted from sheep blood samples and amplified by high-throughput water bath PCR using primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;

[0018] B. After amplification, use the BMG PHERAstar instrument to detect fluorescence signals and view the genotyping results.

[0019] The application of the detection methods described above, such as molecular markers, PCR primer pairs, KASPar primer pairs, or kits, in breeding allows for the detection of the molecular markers of the present invention in the genomic DNA of the sheep to be tested, and the analysis of the types of polymorphic sites. This enables the determination of the feed conversion ratio of the sheep, thereby screening out sheep with lower feed conversion ratios. When the genotype is CC, it has a better feed conversion ratio.

[0020] The application of the molecular markers and their polymorphic sites, PCR primer pairs, KASPar primer pairs, or kits described above in sheep-assisted breeding, specifically for selecting sheep breeds with low feed conversion ratios for the development of feed-efficient, high-quality meat sheep, involves amplifying and detecting the sheep's genomic DNA using the aforementioned primer pairs or kits to determine the characteristics of the sample being tested. PRKAA1 The genotype of the gene can be used to select sheep populations with advantages in feed conversion rate.

[0021] The beneficial effects of this invention are as follows:

[0022] This invention provides PRKAA1 This invention relates to a molecular marker for sheep feed conversion efficiency and its application. The molecular marker is a C / T polymorphic site at position 165 of the fragment in SEQ ID NO.1. Sheep with the CC genotype at this site have relatively good feed conversion efficiency. This invention also provides primer pairs, detection kits, or detection methods for detecting this molecular marker in feed conversion efficiency-related detections. By determining the polymorphic genotype of this molecular marker, it is possible to effectively identify sheep with dominant traits, providing an effective detection method for breeding sheep with high feed conversion efficiency. This invention, through the detection of the polymorphic site of this molecular marker, can be used to select homozygous CC-type sheep for breeding, accelerating the screening of sheep with better feed efficiency, effectively saving costs, cultivating feed-efficient, high-quality meat sheep, and contributing to improving the economic benefits of sheep farming. Attached Figure Description

[0023] Figure 1 For use as molecular markers in sheep PRKAA1 Gel electrophoresis images of gene fragments; where lane M: DL2000 Marker, lanes 1-10: PRKAA1 Gene amplification results.

[0024] Figure 2 The sheep in this invention PRKAA1 Sequencing results of gene mutation sites.

[0025] Figure 3 The sheep in this invention PRKAA1KASPar SNP genotyping results for the g.165 C>T mutation site. Green dots closer to the left represent the CC genotype, red dots closer to the center represent the CT or TC genotype, and blue dots closer to the right represent the TT genotype. Detailed Implementation

[0026] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0027] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and unless otherwise specified, all reagents used in the embodiments are analytical grade or higher.

[0028] Example 1 PRKAA1 Gene amplification

[0029] (1) Primer design

[0030] sheep PRKAA1 Using the genetic DNA (GenBank accession number: NC_056069.1) as a template, a pair of primers, upstream primer MF and downstream primer MR, were designed using Oligo 7.0 software. The primer sequences are as follows.

[0031] PRKAA1 :

[0032] MF (SEQ ID NO.2): 5′- CCGAGAAGCAGAAACACGAC -3′,

[0033] MR (SEQ ID NO. 3): 5′-TCCAGCAAAGGGAGCACTCA-3′.

[0034] (2) PRKAA1 Gene amplification and sequencing

[0035] DNA was extracted from sheep blood using a kit and used as a template. The PCR reaction volume was 35 μL, containing 1.3 μL DNA template, 17.5 μL 2×PCR Master Mix, 1.1 μL forward primer (10 μmol / L), 1.1 μL reverse primer (10 μmol / L), and 14 μL ddH2O. The PCR amplification program was: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 56.5℃ annealing for 30 s, 72℃ extension for 60 s, for 35 cycles, followed by a final extension at 72℃ for 10 min. The PCR products were detected by 1.5% agarose gel electrophoresis. The results are shown below. Figure 1The results showed a specific amplified fragment band. The amplified PCR stock solution was sent to the company for sequencing. The sequencing results showed a length of 429 bp, and a bimodal pattern was observed at the 165 bp position of this fragment (see [link to sequencing results]). Figure 2 The specific nucleotide sequence of the amplified fragment is shown in SEQ ID NO.1; the Y at position 165 of this fragment is represented by C or T, indicating that the amplified fragment is... PRKAA1 The gene fragment exhibits C / T polymorphism at the 165bp site.

[0036] SEQ ID NO.1: CCGAGAAGCAGAAACACGACGGGCGGGTGAAGATCGGTCACTACATCCTAGGGGATACGCTGGGGGTCGGGACCTTCGGCAAAGTGAAGGGTGAGGACCCCCGGGGCAAGGCTCGGCCCCCCGCCCAGGATCCAGGAGATTTCCGCCTTTCGCACCTCTTCATCYTCCCCCGCCCCTTGCGTTCCTGGTCTCCCGGGCTCCGCAGCCCCTGT CCTGCTCTGGCGCGAGCAGAACCCGAGGCCGCCGCGGGACTGCGGCGCAGCCCCCCGCCCCTGCCCACGGCGGGTGGGGGTGAGGTGGGGACTGGTCGCCATGGCGACGGTGCGGCGGCTGGAGGGGCTTGTACGTGAGAGGGGCGGGGATGCGGAGGTGCTAACTTTCCCAGGCCCGACCGTCGGCGGGCAGCGCTGAGTGCTCCCCTTTGCTGGA.

[0037] (3) DNA sequence homology retrieval and identification:

[0038] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained was similar to that of sheep... PRKAA1 The partial sequence homology of the gene DNA (GenBank accession number: 056069.1) reached 98.96%.

[0039] Example 2: Establishment of a genotyping detection method

[0040] (1) Primer sequence design

[0041] KASPar primer pairs were designed targeting the C / T polymorphic sites of the amplified fragment in Example 1 for the specific detection of these polymorphic sites. The nucleotide sequences of the KASPar primer pairs are as follows:

[0042] Forward primer A1 (SEQ ID NO.4) used to detect AlleleA:

[0043] 5′-GAAGGTGACCAAGTTCATGCTCCTTTTCGCACCTCTTCATCC - 3′;

[0044] Forward primer A2 (SEQ ID NO.5) used to detect AlleleG:

[0045] 5'-GAAGGTCGGAGTCAACGGATTGCCTTTCGCACCTCTTCATCT - 3';

[0046] Universal reverse primer C (SEQ ID NO.6): 5'-GGGAGACCAGGAACGCAAG-3'.

[0047] The above primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer in the KASPar primer pair was diluted to 10 μmol / L and mixed in a volume ratio of 12:12:30 for forward primer A1: forward primer A2: universal reverse primer C.

[0048] (2) DNA quality control

[0049] Sheep blood was frozen at -20°C, and DNA was extracted using a kit. The quality of the extracted genomic DNA was then assessed by 1% agarose gel electrophoresis and Nanodrop 2100, respectively. The required DNA templates were: agarose gel electrophoresis showing a single DNA band without significant diffusion; Nanodrop 2100 A260 / 280 between 1.8 and 2.0, indicating no protein contamination; A260 / 230 between 1.8 and 2.0, indicating low salt ion concentration; and no significant light absorption at 270 nm, indicating no phenol contamination. Based on the KASP detection technology from LGC (UK) and genome size calculations, the required DNA volume was 10–20 ng / sample, and the DNA template concentration was diluted to 10–20 ng / μL for later use.

[0050] (3) Genotyping

[0051] First, using a K-pette dispensing workstation, 1.5 μL of diluted DNA template (10-20 ng / μL) and a blank control (No template control, NTC) were added to separate 384-well reaction plates. The plates were then dried at 60°C for 30 min (using an LGC drying oven) until the DNA powder was ready for use. Next, using a Meridian dispensing workstation under the Kraken operating system, 1×Master mix (part no. KBS-1016-011 for 1536-well microplates) and primer mixture were added to each well. Immediately after mixing, the microplates were sealed using a Kube heat sealer and a Fusion laser sealer. High-throughput water bath PCR amplification was then performed using a Hydrocycler. The PCR reaction was conducted in the Hydrocycler high-throughput water bath system, and the specific procedure was as follows:

[0052] Pre-denaturation at 94℃ for 15 minutes;

[0053] 94℃, 20 seconds (denaturation) — 61℃-55℃, 1 minute (annealing & extension), amplified in touch-down order for 10 cycles, decreasing the temperature by 0.6℃ per cycle;

[0054] 94℃, 20 seconds (denaturation) — 55℃, 60 seconds, continue amplification for 26 cycles.

[0055] After amplification, fluorescence signals were detected and genotyping was performed using a BMG PHERAstar instrument. Specific results are shown below. Figure 3 As shown in the figure, each dot represents a sample to be tested. The green dot near the left indicates a homozygous genotype "CC"; the blue dot near the right indicates a homozygous genotype "TT"; the red dot near the center indicates a heterozygous genotype "CT" or "TC"; and the black dot indicates NTC. Figure 3 (The part that was not shown in the image) is the water control.

[0056] (4) Application of the molecular markers of the present invention in the association analysis of marker traits of sheep feed conversion rate

[0057] The experiment examined the polymorphism of 935 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct a correlation analysis between genotype and feed conversion ratio.

[0058] Y ijkl =μ+ Genotype i + P j +F k +M l +εijkl

[0059] Among them, Y ijkl Here, μ represents the observed trait value, Genotypei represents the genotype effect, and P represents the observed value. j Due to the batch effect, F k Due to the paternal effect, M l Maternal effect, ε ijkl Assuming random error, let ε ijlmk They are mutually independent and follow N(0, σ) 2 )distributed.

[0060] Genotyping results showed that among 935 individuals, 331 had the CC genotype, 441 had the CT genotype, and 163 had the TT genotype. The feed conversion ratio of Hu sheep refers to the amount of feed consumed per kilogram of weight gain, expressed in kg. The results of the genotype-trait association analysis are shown in Table 1. PRKAA1 The g.165 C>T mutation site was significantly correlated with the feed conversion rate of Hu sheep. p <0.05), among which the feed conversion ratio (FCR) of the TT genotype individuals was 6.565±0.061, which was significantly higher than that of the CT genotype (FCR=6.417±0.037) and CC genotype individuals (FCR=6.408±0.043) (P<0.05). The TT genotype individuals consumed 0.148 and 0.157 kg more feed per kg of weight gain than the CT and CC genotype individuals, respectively.

[0061] Note: Different superscript letters between data in the same row indicate significant differences. p <0.05, with the same letter indicating no significant difference ( p >0.05).

[0062] In conclusion, when breeding, it is advisable to select sheep with the CC genotype for conservation, as they have better feed efficiency. During breeding, artificial insemination with semen from rams with the CC genotype can be used to cultivate high-quality meat sheep that save feed, thereby improving production efficiency and being low-carbon and environmentally friendly.

Claims

1. A molecular marker related to sheep feed conversion ratio, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at position 165 represents C or T. Because there is a C / T mutation at position 165 of the above sequence, the sheep PRKAA1 gene has a C / T polymorphism at this site.

2. A PCR primer pair for detecting the molecular marker of claim 1, characterized in that, It includes a forward primer and a reverse primer, wherein the sequence of the forward primer is shown in SEQ ID NO.2 and the sequence of the reverse primer is shown in SEQ ID NO.

3.

3. A KASPar primer pair for detecting the molecular marker of claim 1, characterized in that, It includes forward primers A1 and A2 and a universal reverse primer C. The nucleotide sequence of forward primer A1 for detecting AlleleA is shown in SEQ ID NO.4, the nucleotide sequence of forward primer A2 for detecting AlleleG is shown in SEQ ID NO.5, and the nucleotide sequence of universal reverse primer C is shown in SEQ ID NO.

6.

4. A kit for detecting the molecular marker of claim 1, characterized in that, The kit contains the PCR primer pair as described in claim 2 or the KASPar primer pair as described in claim 3.

5. A method for detecting the molecular marker of claim 1, characterized in that, It includes the following steps: a) Amplify sheep genomic DNA using the primer pair described in claim 2 or 3, or using the kit described in claim 4; b) Identify the polymorphic sites in the amplification products obtained in step a).

6. The method according to claim 5, characterized in that, Polymorphic sites were identified using direct sequencing, fluorescent probes, gene chips, and high-resolution melting curves.

7. The method according to claim 5, characterized in that, PCR amplification was performed using the KASPar primer pair described in claim 3. After amplification, the fluorescence signal was detected and the genotyping results were viewed using a BMG PHERAstar instrument.

8. The application of the PCR primer pair of claim 2, the KASPar primer pair of claim 3, or the kit of claim 4, or the method of any one of claims 5-7, in the detection of sheep feed conversion ratio.

9. The application of the primer pair according to claim 2 or 3, or the kit according to claim 4, or the method according to any one of claims 5-7 in sheep breeding, characterized in that, The breeding program aims to develop feed-saving sheep.

Citation Information

Patent Citations

  • Molecular marker related with sheep feed conversion rate and applications thereof

    CN109694916A

  • RYR2 (ryanodine receptor 2) gene as molecular marker to affect feed conversion rate of sheep and application of molecular marker

    CN109913559A